CN108795903B

CN108795903B - Expression method of amylase with high enzyme activity

Info

Publication number: CN108795903B
Application number: CN201810735301.7A
Authority: CN
Inventors: 金锋杰; 张智敏; 庄淼; 王宝腾
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2018-06-08
Filing date: 2018-07-05
Publication date: 2020-12-15
Anticipated expiration: 2038-07-05
Also published as: CN108795903A

Abstract

The invention discloses an expression method of amylase with high enzyme activity, which comprises the steps of knocking out AO090701000363 genes in aspergillus oryzae, and then utilizing the strain to express the amylase to obtain the amylase with high enzyme activity. The invention uses the selection marker gene pyrG to replace AO090701000363 gene in the aspergillus oryzae through homologous recombination, thereby obtaining AO090701000363 knockout strain, then uses the strain to express amylase, can obtain amylase with high enzyme activity, and the test result proves that: the deletion of AO090701000363 significantly improves the activity of Aspergillus oryzae amylase, the amylase activity of the AO090701000363 knockout strain is about 1.5 times that of the reference strain on day 3, and the activity of the defect strain is 2 times that of the reference strain on the following two days.

Description

Expression method of amylase with high enzyme activity

Technical Field

The invention belongs to the technical field of enzyme engineering, and particularly relates to an expression method of amylase with high enzyme activity.

Background

The amylase is one of the most widely used and most consumed enzyme preparations. Mainly used for dough improvement in bread production (reduction of dough viscosity, acceleration of fermentation process, increase of sugar content, alleviation of bread aging); preprocessing the cereal raw materials in the infant food; manufacturing beer; industrial by-products and waste treatment, silage, microbial agents and other fields. Aspergillus oryzae is classified as a food grade safe strain (GRAS) by the FDA and world health organizations in the United states and is an important source of industrial amylase. The Aspergillus oryzae with higher enzyme yield is bred by means of gene knockout, and the method is favorable for better industrial application of the Aspergillus oryzae.

Starch is one of the most abundant raw materials in the nature, is an important component of human food, is easily obtained from plants, and is low in price. The key to starch utilization is the degradation by amylase to fermentable sugars such as glucose. Depending on the mode of action, these enzymes can be classified as alpha-amylases and beta-amylases. Alpha-amylases are widely distributed in animals (saliva, pancreas, etc.), plants (malt, behenic), and microorganisms.

Aspergillus oryzae has a long application history, strains with high amylase yield are obtained along with the development and living needs of human beings, the reduction of the production cost of amylase becomes a necessary way for industrial utilization of the amylase, and the breeding of excellent strains is a core problem of the enzyme preparation industry. Compared with escherichia coli and yeast, aspergillus oryzae has the advantages of stronger protein secretion and synthesis capacity, rapid growth, easy culture and the like, has a strong post-translational modification function, and is considered to be one of the strains with the most application prospect in producing amylase. At present, excellent high-yield strains are obtained, and methods such as mutagenesis and genetic engineering are generally adopted to construct genetic engineering strains. The mutagenesis method is simple and low in cost, but has certain randomness, so that the genetic engineering technical means is an effective method for breeding high-yield strains in the future, and the application of the genetic engineering technology is promoted by the whole genome deciphering of the aspergillus oryzae in particular. The development of a safe, universal, efficient and large-scale expression system is a necessary strategy for comprehensively improving the technical level of the enzyme preparation industry, and has very important significance for realizing the revolutionary breakthrough of the enzyme preparation industry.

In Aspergillus oryzae, amylase transcription activator AmyR can activate the expression of downstream amylase under the induction of starch or maltose, and creA and creB are involved in regulating the expression of amylase transcription activator AmyR. The bottleneck in aspergillus oryzae amylase production is: although studies have been made in this respect to increase the amylase activity to some extent in the late stages of high-concentration cultivation by deleting single creA and double creA/creB gene fragments, the effect is not very obvious.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the defects in the prior art, the invention aims to provide an expression method of amylase with high enzyme activity, wherein the AO090701000363 gene in aspergillus oryzae is replaced by a selection marker gene pyrG through homologous recombination, so that an AO090701000363 knockout strain is obtained, and then the strain is used for carrying out amylase expression, so that the amylase with high enzyme activity can be obtained.

The technical scheme is as follows: in order to achieve the purpose of the invention, the invention adopts the technical scheme that:

an expression method of amylase with high enzyme activity comprises the steps of knocking out AO090701000363 genes in aspergillus oryzae, and then utilizing the strain to express the amylase to obtain the amylase with high enzyme activity.

According to the expression method of the amylase with high enzyme activity, the AO090701000363 gene in the Aspergillus oryzae is replaced by a selective marker gene pyrG through homologous recombination, so that the AO090701000363 gene is knocked out.

The expression method of the amylase with high enzyme activity comprises the following specific steps:

1) amplifying by using PrimeStar PCR polymerase to obtain a fragment on both sides of AO090701000363 gene and pyrG gene;

2) the AO090701000363 gene flanking segment is fused with the pyrG gene;

3) transforming the fusion gene into E-F1 strain, separating and purifying at least twice with selective culture medium, extracting genome, and identifying with Southern blot;

4) culturing the positive strain to obtain the high-activity amylase.

In step 1), the two-sided fragments of AO090701000363 gene are: AO090701000363L, the gene sequence is shown as SEQ ID NO.1, AO090701000363R, the gene sequence is shown as SEQ ID NO. 2; the sequence of the pyrG gene is shown in SEQ ID NO. 3.

In step 1), the PCR system: 25 μ L of the primestar Mix enzyme; 2 mu L of each of the upstream primer and the downstream primer; 1 μ L a.oryzae RIB40 genomic DNA; adding water to 50 μ L; the specific primer sequences are shown in the following table:

in step 1), PCR conditions: 10s at 98.0 ℃; 10s at 98.0 ℃, 15s at 55.0 ℃, 2min at 72.0 ℃ for 20s, and circulating for 35 times; 5min at 72.0 ℃; storing at 16.0 deg.C.

In the step 2), fusion is carried out by using fusion PCR, and the molar concentration ratio of genes is as follows: AO090701000363L pyrG 090701000363R 1:3: 1.

In step 2), PCR system: primestar Mix 25 μ L; adding 2 mu L of upstream primer and downstream primer respectively; adding the template according to the concentration ratio; adding water to a constant volume of 50 μ L.

In step 2), a two-step process: 10s at 98.0 ℃; 10s at 98.0 ℃, 4min at 68.0 ℃ and 35 cycles; 5min at 72.0 ℃; storing at 16.0 deg.C;

the three-step method comprises the following steps: 10s at 98.0 ℃; 10s at 98.0 ℃, 15s at 55.0 ℃, 4min at 72.0 ℃ and 35 cycles; 5min at 72.0 ℃; storing at 16.0 deg.C.

In step 3), the conversion process is as follows: solution1, sterilized using a 0.45 μm filter into a fresh 50mL sterilized tube; filtering cultured Aspergillus oryzae with a funnel, washing away the culture medium with water, and squeezing with a spoon; putting the thallus into Solution0+1 configured in 1 by using a medicine spoon, wrapping tube with a seal, and carrying out 3h at 30 ℃ and 50 rpm; making ice; filtering to obtain liquid; adding Solution 210 mL, and mixing up and down; taking out the tube, centrifuging at 4 deg.C for 8min at 2000rpm, and collecting precipitate; adding 5mL Solution2, mixing uniformly, centrifuging at 4 deg.C for 8min at 2000rpm, and discarding supernatant; adding Solution2 according to the precipitation amount, and subpackaging 200 μ L × 4 respectively; respectively adding 10 μ L of plasmid, and mixing with disposable pipette; placing on ice for 30min, dissolving CD selective culture medium in microwave oven, pouring into 50mL tub, and maintaining at 45 deg.C; after 30min, adding Solution3 in 3 times: mixing with 250 μ L; mixing with 250 μ L; 850 mu L of the mixture is mixed evenly; standing at room temperature for 20 min; adding 5mL Solution2, mixing, centrifuging at 4 deg.C for 8min at 2000rpm, and discarding the supernatant; adding 500 mu LSolution2, mixing uniformly, adding 10mL CD upper layer culture medium, mixing uniformly, and pouring into a flat plate; culturing in CD culture medium at 30 deg.C in dark condition for 3-5 days.

Has the advantages that: compared with the prior art, the AO090701000363 gene in the aspergillus oryzae is replaced by the selection marker gene pyrG through homologous recombination, so that an AO090701000363 knockout strain is obtained, then the strain is used for carrying out amylase expression, the amylase with high enzyme activity can be obtained, and the test result proves that: deletion of AO090701000363 significantly increased the amylase activity of aspergillus oryzae, the amylase activity of the AO090701000363 knockout strain was 1.5-fold higher than the reference strain at day 3, and the enzyme activity of the knockout strain was 2-fold higher than the control strain in later cultures.

Drawings

FIG. 1 is a schematic diagram of the AO090701000363 gene knockout;

FIG. 2 is a 0.8% agarose gel electrophoresis of the gene fragment;

FIG. 3 is a 0.8% agarose gel electrophoresis of the fusion gene;

FIG. 4 is a diagram showing the results of southern blot verification;

FIG. 5 is a graph showing the measurement of the enzyme activity of Aspergillus oryzae amylase.

Detailed Description

The present invention will be further described with reference to the following specific examples.

Example 1

An expression method of amylase with high enzyme activity is disclosed, the flow chart is shown in figure 1, AO090701000363 gene in Aspergillus oryzae is replaced by selection marker gene pyrG through homologous recombination, so as to obtain AO090701000363 knockout strain, then the strain is used for carrying out amylase expression, so as to obtain the amylase with high enzyme activity, SmaI enzyme cutting site marked in the figure and probe position are used for Southern blot verification. The method comprises the following specific steps:

1) the flanking fragment of AO090701000363 gene (AO 090701000363L, the gene sequence is shown in SEQ ID NO. 1; AO090701000363R, the gene sequence is shown as SEQ ID NO. 2) and pyrG gene (the gene sequence is shown as SEQ ID NO. 3), the main process is as follows:

and (3) PCR system: 25 μ L of the primestar Mix enzyme; 2 mu L of each of the upstream primer and the downstream primer (the specific primer sequences are shown in Table 1); 1. mu.L of A.oryzae RIB40 (given by Japan (Kagaku corporation) Seikagaku scientific institute of Sta); water was added to 50. mu.L.

TABLE 1 specific primer sequences

PCR conditions were as follows: 10s at 98.0 ℃; 10s at 98.0 ℃, 15s at 55.0 ℃, 2min at 72.0 ℃ for 20s, and circulating for 35 times; 5min at 72.0 ℃; storing at 16.0 deg.C.

2) The results of electrophoresis are shown in FIG. 2, which shows three bands: the left sequence (L) of the ORF of AO090701000363 gene, the right sequence (R) of the ORF of AO090701000363 gene and the pyrG selection marker gene are sequentially arranged, and the sizes of the sequences are about 1kb, 1kb and 2.2kb respectively, which indicates that the amplification is successful.

3) Purification of DNA from electrophoresis gels

With the kit: the Takara MiniBest Agarose Gel DNA extraction kit (TaKaRa, Japan) cuts the Gel to extract the DNA, and the main process is as follows:

preparing: the dry heat thermostat was set to 37 ℃. Cutting the gel into pieces, adding into 1.5mL microcentrifuge tube, adding 3 times of Buffer GM, mixing, and standing at 37 deg.C for 10min (vortex can be taken out midway to dissolve more quickly); spin Column was placed in the collection tube and the above medium solution was transferred to the Spin Column using a pipette gun. Centrifuging at 12000rpm for 1min, and removing the liquid below after the centrifugation is finished; add 700. mu.L Buffer WB to column. Centrifuge at 12000rpm for 30 s. After the centrifugation is finished, removing the liquid below, and repeating the step; centrifuging at 12000rpm for 1 min; spin column was placed in a new 1.5mL tube. Adding 30 μ L of water/Elution Buffer, and standing at room temperature for 1 min; centrifuge at 12000rpm for 1 min.

4) The AO090701000363 gene flanking segment is fused with pyrG gene

Fusion was performed by fusion PCR, gene addition molar concentration ratio: AO090701000363L to pyrG to AO090701000363R is 1:3: 1.

And (3) PCR system: primestarMix 25 μ L; adding 2 μ L of each of the upstream primer and the downstream primer (the specific primer sequences are shown in Table 1); adding the template according to the concentration ratio; adding water to a constant volume of 50 μ L.

A two-step method: 10s at 98.0 ℃; 10s at 98.0 ℃, 4min at 68.0 ℃ and 35 cycles; 5min at 72.0 ℃; storing at 16.0 deg.C.

5) The results of electrophoresis confirmation are shown in FIG. 3, in which: the fusion fragment of AO090701000363 gene flanked by fragments of about 4.2kb with the pyrG gene, and the appearance of 4.2kb in the electrophoretogram indicated that the fusion was successful. This fragment was used for transformation by purifying the DNA in the Gel using Takara MiniBest agar Gel DNA Extraction kit (TaKaRa, Japan).

6) Transformation of

Preparing: solution0(50mM Maleate buffer pH5.5); solution2(1.2M Sorbitol, 50mM CaCl)₂，35mM NaCl，10mM Tris-HCl pH7.5)：Solution3(60％PEG4000，50mM CaCl₂10mM Tris-HCl pH 7.5); CD top medium (CD medium +1.2M Sorbitol + 0.8% Agar); CD selection Medium (0.3% NaNO)₃，0.2％KCl，0.1％KH₂PO₄，0.05％MgSO₄·7H₂O，0.002％FeSO₄·7H₂O, 2% glucose, pH 5.5); YPD liquid medium.

Pre-culture: YPD liquid medium was used to culture E-F1 strain (Δ ku70:: ptrA, Δ AF, Δ pyrG, given by Japan, Setarian laboratories, Japan) at 30 ℃ at 150rpm for 18-24 hours.

Transformation experiments: solution1 (0.1% Yatalase, 0.6M (NH)₄)₂SO₄10mL Solution0) was added and sterilized using 0.45 μm filtration into a new 50mL sterile tube; filtering cultured Aspergillus oryzae with a funnel, washing with water to remove culture medium (white thallus), squeezing with a spoon to remove water; putting the thallus into Solution0+1 prepared in 1 by using a medicine spoon, wrapping tube with a seal, and carrying out protoplast transformation at 30 ℃ and 50rpm for 3 h; making ice; filtering (disposable), and collecting liquid; adding Solution 210 mL, and mixing up and down; taking out the tube, centrifuging at 4 deg.C for 8min at 2000rpm (the rising rate is adjusted to 3'), and collecting the precipitate; adding 5mL Solution2, mixing uniformly, centrifuging at 4 deg.C for 8min at 2000rpm, and discarding supernatant; adding solvent 2 (1-5X 10) according to precipitation amount⁷Adding 1mL), and subpackaging 200 mu L of the mixture by multiplying 4; respectively adding 10 μ L plasmid (no more than 15 μ L), and mixing with disposable pipette; placing on ice for 30min, dissolving CD selective culture medium in microwave oven, pouring into 50mL tub, and maintaining at 45 deg.C; after 30min, adding Solution3 in 3 times: mixing with 250 μ L; mixing with 250 μ L; 850. mu.L of the mixture was mixed. Standing at room temperature for 20 min; adding 5mL Solution2, mixing, centrifuging at 4 deg.C for 8min at 2000rpm, and discarding the supernatant; adding 500 mu LSolution2, mixing uniformly, adding 10mL CD upper layer culture medium, mixing uniformly, and pouring into a flat plate; culturing in CD culture medium at 30 deg.C for 3-5 days in dark place;

7) at least two times of separation and purification by using a selective medium (CD) and then extracting a genome are carried out, and the following processes are carried out:

preparing: nucleic acid solubilization solution (600. mu.L) was added. Liquid nitrogen treatment, grinding by a mortar and placing into 1.5mL of tube; treating with dry thermostat at 65 deg.C for 15min, taking out, and cooling to hand temperature; adding 3 μ L RNaseA to hydrolyze RNA at 37 deg.C for 30-60 min; adding 200 μ L protein precipitation solution, turning and mixing up and down for 20s to remove protein; centrifuging at 12000rpm for 3min to transfer the supernatant to a new 1.5mL tube; 600 μ L of PCI was treated (gloved) by mixing them upside down to further remove impurities such as protein (Phenol: chloroform: Isoamyl Alcohol: 25: 24: 1); centrifuging at 12000rpm for 3min to obtain supernatant; adding 600. mu.L Isopropanol Isopropanol to precipitate the gene; centrifuging at 12000rpm for 5min to remove supernatant and obtain precipitate; washing with 600 μ L70% ethanol at 12000rpm for 5min to remove supernatant and obtain precipitate; centrifuging at 12000rpm for 1min to remove supernatant, and air drying for 10 min; add 100. mu.L of TE solution.

8)Southern blot

Identifying the transformed strain by Southern blot analysis, extracting genomic DNA of an Aspergillus oryzae strain, after electrophoresis, transferring the digested genomic DNA onto a Hybond-N + membrane (Amersham Biosciences, Amersham, UK) for Southern hybridization (Takahashi et al, 2004), constructing a Digoxigenin (DIG) -labeled probe using a PCRDIG labeling kit (Roche Diagnostics, Mannheim, Germany), and performing signal hybridization and detection of the DIG system according to the instructions (Roche Diagnostics), as shown in FIG. 4, where M is marker (. lamda.DNA/HindIII); 1 is a control strain; 2. 3 and 4 were both transformants. The genome DNA of the control strain is cut by BglII enzyme and the fragment reacted with the probe is about 4.4 kb; the genomic DNA of the strain with the AO090701000363 gene successfully knocked out is cut by BglII, and the fragment reacted with the probe is about 6.1 kb.

Example 2 Amylase Activity assay

The transformant No.2 prepared in example was transformed with a Control: a strain obtained by introducing pyrG into E-F1 (delta ku70:: ptrA, delta AF, delta pyrG) was used as a reference strain, inoculated into YPD liquid medium, and inoculated into a 45 mL/flask; number of conidia: 10⁵The culture was carried out at 30 ℃ and 150rpm, 3 replicates. Enzyme activity days are measured: 2, 3, 4, 5 d.

Amylase activity in YPD medium was determined using the Amylase (AMS) test kit starch-iodine colorimetry (shanghai dinning).

The results are shown in FIG. 5, Control: a strain obtained by introducing pyrG into E-F1(Δ ku70:: ptrA, Δ AF, Δ pyrG) was used as a reference strain; Δ 363: AO090701000363 knock-out strain. The deletion of AO090701000363 significantly improves the activity of Aspergillus oryzae amylase, the amylase activity of the AO090701000363 knockout strain is about 1.5 times that of the reference strain on day 3, and the activity of the defect strain is 2 times that of the reference strain on the following two days.

Sequence listing

<110> Nanjing university of forestry

<120> expression method of amylase with high enzyme activity

<130> 100

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1118

<212> DNA

<213> Aspergillus oryzae

<400> 1

gtttcgcgta taacgccttg tggtgtgata aagatcaaag agaagcacgt cttcgggtgt 60

tactatcagc ggtgcaccgt atatagtgca cccacgactg gcgttggcat cgtcagaata 120

aaaaagctga ctgcgattgc tcatcaatgg tctgctgcca cacttgatga tatctgccaa 180

ctgctaccgt ccctaggagt tgacctctag tccctgtgga gtgagtcgtc gactacctcc 240

acatagctgc ccggttacaa ccattcagct acaacaggtg ttagagctat gccattcaga 300

aggatgccaa gcatgagtga atcgtagtcg atcagtgacg caggaagtat ataagctcta 360

agagagcctt cttgttcata gctcaatgag gagaaatctc acaacgtgaa gatgcccgtg 420

tgggacgcaa cgcgacaggc tgggggttca ctgtacgatg gtcaacatct gtaccctcca 480

gtagcatcac ctcgacgaaa ggttgacttc tagacaccaa tgttcttttg cattgattcc 540

agttccccac tcaaggagca agtgaagaca agatcacggt aattgagatg cttccaaggc 600

cccactaacc cacaaccccc tcaccccgga ttccacgtga cgggatctag tgcggagaag 660

gacgattgat aactttcccc aggtttctct acttacccga gcagtcaaat taattctagc 720

catgagtaca tccggcaacc aacgggtcgc tactaaggtc gatcggaaac gtattacgga 780

ccgcaaagcc cagagaaacc accgagaacg tgtcaaagca tatatcagtc gcctcgagac 840

cactgttgag gagcttacca aagcatccca ggagggctct gaatgcagtc tactacagaa 900

gctgcaagaa aagcaactcg agatagaacg gcttaagggg gcgatacggc aagccaatac 960

agccctgcga actgcccttg acacgacctc cgcgtccata acgcgttccc ccatcgccga 1020

gatcgtgcct agagataccc cggtaacaga gaataactcg ccgtccgtag ctgagcatga 1080

aacgacacaa agactcaata accgcagaat gcagatgg 1118

<210> 2

<211> 821

<212> DNA

<213> Aspergillus oryzae

<400> 2

gatgacttga ctattcgggc catcttacac ggatgggata ctatcaagga ggagaagcca 60

ctcgaccgtg cctggaactt tctcagagct ctagaccaag gcctatttca ccgcactggc 120

cctgtggagc gcctggctat cttgcgccta atgcgatcca tgctgatggt gggtcgaaac 180

aagtaaccct ttgcatattc attgtaacat tgagtagtcg aagaacgggt ccccggggca 240

ctccactggc caggttccgt ctttcatgtt ccccacgtac gtaccagccc tcttccgtcg 300

atatgaagct gagtagtgcg taacaatagt accatgcaaa ccctcgtgac tcacgcgtgt 360

attatcgact ttttcgtgtg gtgagaatta ggaagtagga atattcttga atctcgcgta 420

ctaatcagag attaggccaa acctccgtga ccacttaatc gcctccgaaa cctcccatac 480

ttctgaagca gcagcggcgc attatgcgga agaaatccag ctgagttggc catatcagat 540

tcgagatgcc tacaggtacc acgaagaaga aggcaggttt caattttcga tcgaattcaa 600

caacgtttat tacgacttaa agtcatggca atttcgttcg aaccctgcac tcaagatgct 660

tgttgcgaat ggaccaatgt cctcactgga aggacgctta caggcctcgt caagtatact 720

gattagttct ctggatccaa atgggtttat tgagtcaggg ggagttgttg gctattgatt 780

ctatttgaat tttcccatgc atgcaatgtc ggctgtcaaa g 821

<210> 3

<211> 2260

<212> DNA

<213> Aspergillus oryzae

<400> 3

cgagaacgtg tcaaagacaa cagacgtacc ctgtgatgtt catcactaat gccggcaagc 60

ctccagttac ggatcgagag atgagggctg ccagcataca gtccgctgtt cgatttgcca 120

agaggtggaa tttatctggc cttgtctttg catctgaggc gctggtaatg tgccccaggc 180

ttgtcagata tgttcaacga tcaggattga tctgtggatc ctatggatct cagaacaata 240

taccagaaaa tgcgaaggta agtgcttcta tattgatcct tagtgctttc aaactgtgat 300

gtagaagttg ctcggtagct gattaaatat tctagaccca agccgctgct ggaattgaca 360

ttattatggc cgatagggtt gggcttattg ctatgtccct gaaaggatat caaaagcagg 420

caaaaagcca ggcataatcc ccgcgtggac ggtaccctaa ggataggccc taatcttatc 480

tacatgtgac tgcatcgatg tgtttggtca aaatgaggca tgtggctcac cccacaggcg 540

gagaaacgtg tggctagtgc atgacagtcc cctccataga ttcaatttaa tttttcgcgg 600

caattgtcgt gcagtttgta tctacatttc attccatata tcaagagtta gtagttggac 660

atcctgatta ttttgtctaa ttactgaaaa ctcgaagtac taacctacta ataagccagt 720

ttcaaccact aagtgctcat ttatacaata tttgcagaac cccgcgctac ccctccatcg 780

ccaacatgtc ttccaagtcg caattgacct acagcgcacg cgctagcaag caccccaatg 840

cgctcgtaaa gaagctcttc gaggttgccg aggccaagaa aaccaatgtc accgtttccg 900

ccgacgtgac aaccaccaaa gagctgctgg atttggctga ccgtatgcgc accggggatg 960

ccacttacat gtgatctagt aatggttaat ggtggattat ataacaggac tcggtccgta 1020

cattgccgtg atcaaaactc acatcgatat cctctccgat ttcagcgaag aaaccatcac 1080

cggtctgaag gcccttgcag agaagcacaa tttcctcatc ttcgaagatc gcaagttcat 1140

cgatatcgga aacacagtcc aaaagcagta ccatggcggc actctgcgta tctctgagtg 1200

ggcccacatc atcaactgca gtattctgcc cggtgagggt atcgtcgagg ctctggccca 1260

gactgcttcg gccgaggact tcccctacgg ctccgagagg ggccttttga tccttgcgga 1320

gatgacctcc aagggatctt tggctaccgg tcaatatact acttcttctg ttgactatgc 1380

tcggaagtat aagaagtttg tgatgggatt cgtctcgaca cgtcaccttg gcgaggttca 1440

gtctgaagtt agctcgcctt cggaggagga agattttgtc gtcttcacga caggtgtcaa 1500

cctctcctcg aagggtgaca agctgggaca gcagtaccaa actcctgagt cggctgttgg 1560

acgcggtgcc gactttatta ttgctggccg tggaatttat gctgctcctg atcccgtgga 1620

ggcggcgaag cagtaccaga aggagggatg ggatgcatac ctgaagcgtg ttggtgcgca 1680

ataagtagtg gtggatacgt actcctttta tggcagtatg tcgcaagtat gatgcgattt 1740

ataaattcag cactcgaaat gactactact atgtgtctac gacagatacc ctctccgtac 1800

gaataagaca cctgcctcga tatatggaca aattcaaaat cagggtcaag ggtcatgttt 1860

caaagtcaca acaatctcca acatagacga gaatttgtac cggagtgtct gaaggtgcag 1920

ctggagattg gtctattttc ttagagtggg gtatcactaa tgtacagtcg gtcactatcg 1980

tacaaacaat cacaattata tacaagattt cccaccaccc cctactctaa cacggcacaa 2040

ttatccatcg agtcagagcc tagccaccat ttggtgctct cgtagagacc aaagtataat 2100

cctgatccga cagcggccat aaacgtgttg atagcacacc ctcggaatag tcctctcggg 2160

ccatctgttc gtacaatctc ccgtacggta ttgatcatcc ttttcttctg aggtgcagtt 2220

atccttttct tctgaggtgc agttgatgac ttgactattc 2260

<210> 4

<211> 25

<212> DNA

<213> AO090701000363 L -F(Artificial)

<400> 4

gtttcgcgta taacgccttg tggtg 25

<210> 5

<211> 24

<212> DNA

<213> AO090701000363 L -R(Artificial)

<400> 5

ctttgacacg ttctcggtgg tttc 24

<210> 6

<211> 38

<212> DNA

<213> pyrG-F(Artificial)

<400> 6

cgagaacgtg tcaaagacaa cagacgtacc ctgtgatg 38

<210> 7

<211> 40

<212> DNA

<213> pyrG-R(Artificial)

<400> 7

gaatagtcaa gtcatcaact gcacctcaga agaaaaggat 40

<210> 8

<211> 24

<212> DNA

<213> AO090701000363 R -F(Artificial)

<400> 8

gatgacttga ctattcgggc catc 24

<210> 9

<211> 26

<212> DNA

<213> AO090701000363 R -R(Artificial)

<400> 9

ctttgacagc cgacattgca tgcatg 26

Claims

1. An expression method of amylase with high enzyme activity is characterized in that the amylase in aspergillus oryzae is firstly knocked outAO090701000363And then, the amylase is expressed by utilizing the strain to obtain the amylase with high enzyme activity.

2. The method for expressing high-enzyme-activity amylase according to claim 1, wherein the expression of the high-enzyme-activity amylase in Aspergillus oryzae is performed by homologous recombinationAO090701000363Selectable marker gene for genepyrGInstead of, thereby realizingAO090701000363And (4) knocking out.

3. The method for expressing the amylase with high enzyme activity according to claim 1 or 2, which is characterized by comprising the following steps:

2) the AO090701000363 gene flanking segment is fused with the pyrG gene;

3) transforming the fusion gene into an Aspergillus oryzae Δ ku70, a ptrA, an AF, a pyrG, performing at least two times of separation and purification by using a selective culture medium, then extracting a genome, and performing Southern blot identification;

4) culturing the positive strain to obtain the high-activity amylase.

4. The method for expressing amylase with high enzyme activity according to claim 3, wherein in step 1), the two side fragments of AO090701000363 gene are: AO090701000363L, the gene sequence is shown as SEQ ID NO.1, AO090701000363R, the gene sequence is shown as SEQ ID NO. 2; the sequence of the pyrG gene is shown in SEQ ID NO. 3.

5. The method for expressing amylase with high enzyme activity according to claim 3, wherein in the step 1), the PCR system: 25 μ L of the primestar Mix enzyme; 2 mu L of each of the upstream primer and the downstream primer; 1 μ L of a. oryzae RIB40 genomic DNA; adding water to 50 μ L; the specific primer sequences are as follows:

AO090701000363 L –F：5'–GTTTCGCGTATAACGCCTTGTGGTG–3'，

AO090701000363 L -R：5'–CTTTGACACGTTCTCGGTGGTTTC–3'，

pyrG-F：5'–CGAGAACGTGTCAAAGACAACAGACGTACCCTGTGATG–3'，

pyrG-R：5'–GAATAGTCAAGTCATCAACTGCACCTCAGAAGAAAAGGAT–3'，

AO090701000363 R -F：5'–GATGACTTGACTATTCGGGCCATC–3'，

AO090701000363 R -R：5'–CTTTGACAGCCGACATTGCATGCATG–3'。

6. the method for expressing amylase with high enzyme activity according to claim 3, wherein in step 1), PCR conditions are as follows: 10s at 98.0 ℃; 10s at 98.0 ℃, 15s at 55.0 ℃, 2min at 72.0 ℃ for 20s, and circulating for 35 times; 5min at 72.0 ℃; storing at 16.0 deg.C.

7. The method for expressing amylase with high enzyme activity according to claim 3, wherein in the step 2), fusion is performed by using fusion PCR, and the molar concentration ratio of gene addition: AO 090701000363L: pyrG: AO090701000363R =1:3: 1.

8. The method for expressing amylase with high enzyme activity according to claim 3, wherein in the step 2), the PCR system: primestar Mix 25 μ L; adding 2 mu L of upstream primer and downstream primer respectively; adding the template according to the concentration ratio; adding water to a constant volume of 50 μ L.

9. The method for expressing the amylase with high enzyme activity according to claim 3, wherein in the step 2), the two-step method comprises the following steps: 10s at 98.0 ℃; 10s at 98.0 ℃, 4min at 68.0 ℃ and 35 cycles; 5min at 72.0 ℃; storing at 16.0 deg.C;

10. The method for expressing amylase with high enzyme activity according to claim 3, wherein in step 3), the transformation process is as follows: solution1, sterilized using 0.45 μm filtration into a new 50mL sterile tube; filtering cultured Aspergillus oryzae with a funnel, washing away the culture medium with water, and squeezing with a spoon; putting the thallus into the solution1 by using a medicine spoon, wrapping a test tube by using a seal, and carrying out reaction at 30 ℃ and 50rpm for 3 h; making ice; filtering to obtain liquid; adding 210 mL of solution, and mixing up and down; taking out the test tube, centrifuging at 4 deg.C for 8min at 2000rpm, and collecting precipitate; adding 5mL of solution2, mixing uniformly, centrifuging at 4 ℃ for 8min at 2000rpm, and discarding the supernatant; adding solution2 according to the amount of precipitate, and subpackaging 200 μ L × 4 respectively; respectively adding 10 μ L of plasmid, and mixing with disposable pipette; placing on ice for 30min, dissolving CD selective culture medium in microwave oven, pouring into 50mL test tube, and maintaining at 45 deg.C; after 30min, add solution3 in 3 portions: mixing with 250 μ L; mixing with 250 μ L; 850 mu L of the mixture is mixed evenly; standing at room temperature for 20 min; adding 5mL of solution2, mixing uniformly, centrifuging at 4 ℃ for 8min at 2000rpm, and discarding the supernatant; adding 500 mu L of the solution2, mixing uniformly, adding 10mL of CD upper layer culture medium, mixing uniformly, and pouring into a flat plate; culturing in CD culture medium at 30 deg.C for 3-5 days in dark place; wherein, the solution0 comprises the following components: 50mM Maleate buffer pH 5.5; the composition of solution1 was: 0.1% Yatalase, 0.6M (NH)₄)₂SO₄Adding 10mL of solution 0; the components of solution2 were: 1.2M Sorbitol, 50mM CaCl₂35mM NaCl, 10mM Tris-HCl pH 7.5; the composition of solution3 was: 60％PEG4000，50mM CaCl₂，10mM Tris-HCl pH7.5。