CN108795787A - A kind of production fusaruside engineering bacterias and its construction method and application - Google Patents

A kind of production fusaruside engineering bacterias and its construction method and application Download PDF

Info

Publication number
CN108795787A
CN108795787A CN201810643362.0A CN201810643362A CN108795787A CN 108795787 A CN108795787 A CN 108795787A CN 201810643362 A CN201810643362 A CN 201810643362A CN 108795787 A CN108795787 A CN 108795787A
Authority
CN
China
Prior art keywords
fusaruside
seq
leu
desaturases
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810643362.0A
Other languages
Chinese (zh)
Other versions
CN108795787B (en
Inventor
田园
李艳玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong First Medical University and Shandong Academy of Medical Sciences
Original Assignee
Taishan Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Taishan Medical University filed Critical Taishan Medical University
Priority to CN201810643362.0A priority Critical patent/CN108795787B/en
Publication of CN108795787A publication Critical patent/CN108795787A/en
Application granted granted Critical
Publication of CN108795787B publication Critical patent/CN108795787B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to microorganism and pharmaceutical technology fields, and in particular to a kind of production fusaruside engineering bacterias and its construction method and application.The present invention will be derived from 3 desaturases and 10 desaturases in Fusarium graminearum and be expressed in Pichia pastoris, construct the Pichi strain that can produce fusaruside.Compared with fusaruside originates in bacterial strain sickle-like bacteria, the fermentation time of the saccharomycete is shorter, it is only necessary to 5~7d, and sickle-like bacteria generally requires 10~14d.In addition, the present invention solves the problems, such as that fusaruside is poor in reaping hook fungi, yield relatively originates in bacterial strain and improves 11.6 times, lays the foundation for further exploitation and the application of fusaruside.

Description

A kind of production fusaruside engineering bacterias and its construction method and application
Technical field
The present invention relates to microorganism and pharmaceutical technology fields, and in particular to a kind of production fusaruside engineering bacterias and its structure Construction method and application.
Background technology
Immunosuppressor is to treat the key agents of graft-rejection and autoimmune disease.But it is clinical at present normal There are a variety of adverse reactions, long-term uses can lead to serious side effect for immunosuppressor, this mostly with immunosuppressive drug It is not high to the selectivity of target spot related.Therefore, it finds new disease of immune system therapy target and exploitation is directed to these target spots Efficient, less toxic, highly selective new small molecule immunosuppressor become the task of top priority.
It is nearest the study found that novel cerebroside micromolecular compound fusaruside lives with good immunosupress Property, it can specifically inhibit the activation of mouse primary T cell STAT1, but do not influence STAT3,4,5 and 6 activation, targeting effect Fruit is preferable.Further study show that fusaruside can promote the phosphorylation of phosphatase SHP-2, the SHP-2 of phosphorylation can be with born of the same parents The STAT1 selective bindings of non-phosphorylating in slurry, to selectively block the signal path of IFN-γ/STAT1/T-bet, And then the immunosuppressive action of its selectivity is played, it is the potentiality molecule of clinic immunosuppressor.
However, fusaruside chemical constitutions are complicated, obtained by chemically synthesized method, not only operating difficulties, step It is rapid cumbersome, and the use of toxic chemical also would seriously pollute the environment.And in microorganism field, fusaruside is present in In filamentous fungi sickle-like bacteria, belong to cell composition object, content is little, only gets 24mg in 200g sickle-like bacteria crude extracts fusaruside.These factors seriously constrain the research and application of cerebroside immunosuppressor.It would therefore be highly desirable to establish one kind Simply, fusaruside production methods inexpensively, efficiently, environmentally friendly.
Invention content
To solve the above-mentioned problems, the present invention provides a kind of production fusaruside engineering bacterias and its construction method with answer With.The present invention constructs the Pichi strain that can produce fusaruside by synthetic biology technology.With Fusaruside originates in bacterial strain sickle-like bacteria and compares, and the fermentation time of the saccharomycete is shorter, it is only necessary to 5~7d, and sickle-like bacteria generally needs Want 10~14d.In addition, the present invention solves the problems, such as that fusaruside is poor in reaping hook fungi, yield relatively originates in bacterial strain and carries It is 11.6 times high, it lays the foundation for further exploitation and the application of fusaruside.
To achieve the goals above, the present invention uses following technical scheme：
The present invention provides a kind of production fusaruside engineering bacterias, will be derived from 3 desaturases in Fusarium graminearum and 10 Desaturase is expressed in Pichia pastoris.
Further, the amino acid sequence of 3 desaturases is as shown in SEQ ID NO.1；10 desaturations The amino acid sequence of enzyme is as shown in SEQ ID NO.2.
Further, the nucleotide sequence of 3 desaturases is as shown in SEQ ID NO.3；10 desaturations The nucleotide sequence of enzyme is as shown in SEQ ID NO.4.
Currently, finding there is complete fusaruside route of synthesis, and the present invention only in filamentous fungi Fusarium People is found that Δ 10 (E)-SD for the first time in early-stage study Fusarium fusaruside route of synthesis, and confirms Δ 10 (E)- SD can be catalyzed cerebroside B and generate fusaruside.And there is only cerebroside D synthesis ways in Pichia pastoris Diameter, the present invention realizes for the first time to be co-expressed in Pichia pastoris derived from (the E)-SD of Δ 3 of Fusarium graminearum and Δ 10 (E)-SD, In more complicated pichia yeast expression system, it can effectively realize that Δ 3 (E)-SD catalysis cerebroside D are generated Cerebroside B, Δ 10 (E)-SD are further catalyzed cerebroside B and generate fusaruside, and the present invention is in complete red ferment Complete fusaruside route of synthesis is constructed in female expression system, and realizes a large amount of synthesis of fusaruside, this The engineering bacteria production fusaruside amounts of invention structure relatively originate in bacterial strain and improve 11.6 times, are established for fusaruside large-scale productions Basis is determined.
The two of the object of the invention provide a kind of construction method of production fusaruside engineering bacterias, include the following steps：
S1. the gene of 3 desaturases and 10 desaturases in Fusarium graminearum is expanded；
S2. design primer, in the case of ensureing that purpose amino acid sequence is immovable by Overlap extension PCR, to step S13 BamH I and the EcoR I contained in position desaturase and 10 delta 8 desaturase genes is transformed, and makes no longer to include this in gene The restriction enzyme site of two kinds of enzymes；Improved 3 desaturase nucleotide sequences are as shown in SEQ ID NO.3；Improved 10 The nucleotide sequence of desaturase is as shown in SEQ ID NO.4；
S3. the recombinant expression carrier built, conversion Pichia pastoris to get.
Further, step S2 the primers are：
3 desaturases：D3-F1：GCCACCATGGCCGAACACCTC, as shown in SEQ ID NO.5；D3-R1： AGTGAAGGATTCCATGTATCCATGAGAAATTG, as shown in SEQ ID NO.6；
D3-F2：CAATTTCTCATGGATACATGGAATCCTTCACT, as shown in SEQ ID NO.7；D3-R2： GTGGCTCCGGACCCCTGCCTCTTAAACTTCT, as shown in SEQ ID NO.8；
10 desaturases：D10-F1：GAAAACCCCGGTCCTATGGCGCATAGCTCTTT, such as SEQ ID NO.9 institutes Show；D10-R1：GCGATATATCGAAGGAACTCGATCCCATAGGCT, as shown in SEQ ID NO.10；D10-F2： AGCCTATGGGATCGAGTTCCTTCGATATATCGC, as shown in SEQ ID NO.11；D10-R2： CTAGTGATGAGAGAGATCACCA, as shown in SEQ ID NO.12.
Further, the method for step S3 structures recombinant expression carrier is：3 after being transformed using nested amplification PCR amplification Desaturase and 10 delta 8 desaturase genes are inserted into 2A peptide genes between two sections of genetic fragments, constitute Δ 3 (E)-SD -2A-Δs The combination gene segment of 10 (E)-SD, using BamH I and EcoR I to combination gene segment and Yeast expression carrier pPIC3.5K Carry out double digestion, be attached and be transformed into Escherichia coli expand to get.
Further, 2A peptide genes nucleotide sequence is as shown in SEQ ID NO.13.
In order to improve the expression efficiency of Δ 3 (E)-SD, Δ 10 (E)-SD, the present invention using pPIC3.5K as expression vector, and And 2A peptide genes are inserted between Δ 3 (E)-SD, two fragment genes of Δ 10 (E)-SD, it is ensured that Δ 3 (E)-SD, Δ 10 (E)-SD The expression of two fragment genes balances, and keeps Δ 3 (E)-SD, Δ 10 (E)-SD active in Pichia pastoris, and can It is catalyzed cerebroside D and generates cerebroside B, and further generate fusaruside.
The three of the object of the invention provide application of the production fusaruside engineering bacterias in producing fusaruside.
The four of the object of the invention provide a kind of production method of fusaruside, and the above is produced fusaruside bases It is cultivated because engineering bacteria is inoculated in MGY culture mediums, culture is inoculated in MGY culture mediums culture to logarithmic phase, 1500~ 3000g centrifuges 5-10min and collects cell, and cell is resuspended to OD with MM600=1.0, be added methanol carry out induced expression to get.
Further, it is 0.5% that methanol volumetric concentration, which is added,.
The technique effect that the present invention obtains：
(1) present invention realizes fusaruside and is largely synthesized in Pichia pastoris for the first time, and what the present invention was built finishes Red Yeast engineering bacteria produces fusaruside, relatively originates in bacterial strain and improves 11.6 times, and so that a large amount of acquisitions of fusaruside is become can Energy.
(2) fermentation period needed for present invention production fusaruside engineering bacterias production fusaruside is short, it is only necessary to 5~7d, and sickle Knife bacterium generally requires 10~14d, thus substantially reduces the fusaruside production cycles.
(3) method of production fusaruside of the invention is simple, cheap, efficient, environmentally friendly, is conducive to the work of fusaruside Industry metaplasia is produced.
Description of the drawings
The Figure of description for constituting the part of the present invention is used to provide further understanding of the present invention, and of the invention shows Meaning property embodiment and its explanation are not constituted improper limitations of the present invention for explaining the present invention.
Fig. 1：The coexpression vector schematic diagram (left side) and digestion verification result (right side) built.
Fig. 2：Pichia pastoris converts daughter colony PCR verifications.
Fig. 3：Methanol induction of Pichia pastoris expression：M：marker；1：0h；2：12h；3：24h；4：36h；5：48h；6： 60h；7：72h；8：84h.
Fig. 4：The HPLC-MS testing results of double enzyme coexpression Pichi strains：1：Fusaruside (molecular formula C43H77NO9, [M]+Na+ molecular weight is 774.5) 2：Cerebroside B (molecular formula C43H79NO9, [M]+Na+ molecules Amount is 776.5)
Fig. 5：Fusaruside's1H NMR (solvent C DCl3, 400MHz).
Specific implementation mode
It is noted that described further below be all exemplary, it is intended to provide further instruction to the present invention.Unless another It indicates, all technical and scientific terms used herein has usual with general technical staff of the technical field of the invention The identical meanings of understanding.
It should be noted that term used herein above is merely to describe specific implementation mode, and be not intended to restricted root According to exemplary embodiments of the present invention.As used herein, unless the context clearly indicates otherwise, otherwise singulative It is also intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet Include " when, indicate existing characteristics, step, operation and/or combination thereof.
Embodiment one:The acquisition and transformation of target gene
Required 3 desaturases (Δ 3 (E)-Sphingolipid Desaturase, Δ 3 (E)-SD) in the present invention With 10 desaturases (Δ 10 (E)-SD) gene both from Fusarium graminearum Fusarium graminearum PH-1.From American Type Culture Collecti buys the bacterial strain, extracts its total serum IgE, and reverse transcription obtains cDNA and obtains Δ 3 (E)-by PCR amplification SD genes (1722bp) and (the E)-SD genes of Δ 10 (1320bp).2A peptides for coexpression select most common F2A, derive from Foot and mouth disease virus (foot-and-mouth disease virus, FMDV), which is obtained by chemical synthesis, and length is 66bp, nucleotide sequence is as shown in SEQ ID NO.13.
The present invention selects pPIC3.5K carriers to carry out double gene coexpression experiment, due to restriction enzyme site negligible amounts, and mesh Gene and F2A genes in include these restriction enzyme sites, need to be transformed target gene.Design primer is prolonged by overlapping Stretch in the case of PCR (OL PCR) ensures that purpose amino acid sequence is immovable, to the BamH I and the EcoR I that contain in gene into Row transformation, makes the restriction enzyme site for no longer including both enzymes in gene.(the E)-SD of improved Δ 3 nucleotide sequences such as SEQ ID Shown in NO.3, amino acid sequence is as shown in SEQ ID NO.1；(the E)-SD of improved Δ 10 nucleotide sequences such as SEQ ID Shown in NO.4, amino acid sequence is as shown in SEQ ID NO.2.The primer of the present invention, shown in table 1 specific as follows：
1 the primer of the present invention of table
Embodiment two:The structure of coexpression vector
The method that the present invention utilizes OL-PCR, between two sections of delta 8 desaturase genes ((the E)-SD of Δ 3 and Δ 10 (E)-SD) 2A peptide genes are inserted into, the combination gene segment of 10 (E)-SD of (E)-SD -2A-of Δ 3 Δs are constituted, using BamH I and EcoR I to group It closes segment and Yeast expression carrier pPIC3.5K carries out double digestion, then connect and be transformed into Escherichia coli.It is big to what is grown Enterobacteria bacterium colony carries out PCR verifications.Digestion verification is carried out after plasmid in extraction positive bacteria, the coexpression vector schematic diagram built And the results are shown in Figure 1 for digestion verification, and the segment that length is 3000bp or so can be obtained after digestion, this and the gene piece combined Section (3108bp) length is consistent, shows to successfully obtain double enzyme coexpression vectors.
Embodiment three:The conversion of recombinant vector and transformant screening
Conversion：
The coexpression vector built (about 10 μ g) is carried out single endonuclease digestion with Bgl I and linearizes target gene by the present invention. The carrier of linearisation is to prevent it from occurring, from connecting, dephosphorylation to be carried out with alkaline phosphatase.It prepares in accordance with the following methods simultaneously Pichia pastoris competent cell：
1, Pichia pastoris is inoculated in 500mL YPD culture mediums, and 30 DEG C are incubated overnight, and bacteria concentration is made to reach 5-7x 107；
2,4 DEG C of 3000g centrifugations 5min collect cell；
3,50mL YPD/HEPES, 1.25mL 1M DTT, light mixing is added, 200mL precoolings are added in 30 DEG C of incubation 15min 1M sorbierites, 4 DEG C of 3000g centrifugation 5min collect cells；
4, it is washed again 2 times with the 250mL 1M sorbierites being pre-chilled, the 1M sorbierites of 10mL precoolings are washed 1 time；
5, the 1M sorbierites of the precooling of 0.5mL are finally resuspended in, total volume answers general 1.3mL, cell number 109A/mL, It is placed in and uses as early as possible on ice.
40 μ L of competent cell are added into linearized and dephosphorylized DNA sample, gently mixing.Sample shifts Into 2mm electricity revolving cups, design parameter 2kV, 5ms electric shock is primary.It is immediately transferred in YPD/ sorbierite fluid nutrient mediums.30 DEG C quiet 1-2h is set, is coated onto on the YPD tablets containing 1M sorbierites and 0.25mg/mL Geneticins, is cultivated 3~4 days.
Screening：
The present invention is directed to the transformant grown and is verified with PCR diagnosises, and verification result as shown in Fig. 2, select at random 8 transformants be all positive colony, PCR can amplify target gene (3108bp).
Example IV：Induction and expression
1, picking monoclonal is seeded in the 250ml shaking flasks of the MGY containing 25ml, 28-30 DEG C, 250-300rpm cultivate to OD600=2-6 (about 16~18 hours)；
2, by the 3~4L shaking flasks of 25ml culture medium inoculateds to the MGY containing 1L, 28-30 DEG C acutely vibrates (250- 300rpm), until exponential phase (OD600=2~6)；
3, with sterile centrifugation tube, room temperature 1500~3000g centrifugation 5min collection cells.When induced expression, supernatant is removed, is used Cell is resuspended to OD in MM600=1.0 are induced；
4, packing culture medium is covered with 2 layers of sterile gauze or cheese cloth to several 3-4L partition boards shaking flasks, is put into shaking table 28-30 DEG C is continued to cultivate.
5, every 24 hours, add methanol to 0.5% concentration, until reaching best induction time.
6, cell is collected in room temperature 1500-3000g centrifugations 5min at interval of 12h, the table of two kinds of enzymes is detected with SDS-PAGE Up to situation.
As shown in figure 3, (the E)-SD of Δ 3 and Δ 10 (E)-SD success induced expressions in Pichia pastoris after 84h.
Embodiment five：The detection of Fusaruside
The saccharomycete induced success is dried, with ethanol/methylene (volume ratio 1:1) dry thalline is carried out Impregnate extraction three times, the leaching liquor of acquisition is evaporated through Rotary Evaporators, and 3L Pichia pastoris obtains 3.6g medicinal extract altogether.Take micro medicinal extract Fusaruside productions are detected through HPLC-MS, the ion stream ESI after extraction detection, the results are shown in Figure 4, shows to build Engineering bacteria can generate fusaruside and its precursor compound cerebrocide B, without convert recombinant vector Pichia yeast can not then produce.
Embodiment six：Fusaruside's isolates and purifies
After determining that engineering bacteria can produce fusaruside after testing, by reverse phase silica gel column to the 3.6g coarse extracts of acquisition Rough segmentation is carried out, through LC-MS tracers, contains fusaruside in the water methanol eluent that methanol content is 90%, the composition weight For 0.8g.The component is further segmented with gel column LH-20, with methylene chloride/methanol (volume ratio 1:1) it is eluted, is passed through LC-MS tracers obtain the ointment-like medicine for oral or plastering use that 63mg contains fusaruside.This section of ointment-like medicine for oral or plastering use is further isolated and purified through liquid chromatogram, most The amount of the pure fusaruside obtained afterwards is 5mg, is composed by hydrogen and determines that the chemical constitution of fusaruside is correct (Fig. 5).It should Saccharomycete fusaruside yield and sickle-like bacteria yield comparison are as shown in table 2.
Table 2 produces the yield comparison of fusaruside genetic engineering bacteriums and sickle-like bacteria production fusaruside
As shown in Table 2, the yield that production fusaruside engineering bacterias produce fusaruside is 11.6 times of sickle-like bacteria.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, it is other it is any without departing from the spirit and principles of the present invention made by changes, modifications, substitutions, combinations, simplifications, Equivalent substitute mode is should be, is included within the scope of the present invention.
SEQUENCE LISTING
<110>Taishan Hospital
<120>A kind of production fusaruside engineering bacterias and its construction method and application
<130>
<160> 17
<170> PatentIn version 3.3
<210> 1
<211> 439
<212> PRT
<213>Artificial sequence
<400> 1
Met Ala Glu His Leu Val Phe His Pro Gln Leu Thr Lys Ala Asp Ala
1 5 10 15
Leu Ile Leu Glu Gly Leu Arg Gln Asp Ile Asn Glu Tyr Lys Gln Pro
20 25 30
Lys Val Asn Ala Asn Val Ser Ser Gln Asp Gly Gln Thr Pro Ala Leu
35 40 45
Arg Gln Arg Ala Ala Asn Gly Glu Pro Ser Lys Ala Arg Asp Glu Asp
50 55 60
Leu Leu Arg His Leu Gln Ser Met Asn Asp Pro Lys Asp Ala His Phe
65 70 75 80
Glu Glu Ser Ile Thr Ser Thr Trp Asp Phe Asp Gln Ile Lys Leu Pro
85 90 95
Leu Phe Leu Glu Lys Leu Val Leu Arg Pro Tyr Val Arg Ile Ala Lys
100 105 110
Ser Ile Val Arg Val Asp Thr Asp Val Ile Met Leu Thr His Leu Leu
115 120 125
Leu Tyr Phe Ser Thr Ser Leu Pro Ser Ala Ile Gln Leu Phe Arg Asn
130 135 140
Phe Ser Trp Ile His Gly Ile Leu His Phe Ile Met Gln Phe Thr Tyr
145 150 155 160
Met Gly Ser Tyr Thr Leu Leu Met His Gln His Ile His Met Arg Gly
165 170 175
Val Leu Asn Lys Arg Phe Ala Leu Phe Asp Ser Leu Phe Pro Tyr Ile
180 185 190
Thr Asp Pro Leu Met Gly His Thr Trp Asn Ser Tyr Phe Tyr His His
195 200 205
Val Lys His His His Val Glu Gly Asn Gly Pro Asn Asp Leu Ser Ser
210 215 220
Thr Ile Arg Tyr Gln Arg Asp Ser Ile Leu His Leu Leu His Tyr Ile
225 230 235 240
Gly Lys Phe Leu Phe Phe Val Trp Leu Glu Leu Pro Leu Tyr Phe Ile
245 250 255
Arg Asn Gly Lys Thr Met Thr Gly Met Lys Ala Ala Phe Trp Glu Leu
260 265 270
Ser Asn Tyr Ala Phe Leu Thr Thr Met Phe Cys Leu Asn Arg Asn Ala
275 280 285
Thr Ile Cys Val Phe Leu Met Pro Leu Gly Leu Met Arg Leu Gly Met
290 295 300
Met Met Gly Asn Trp Gly Gln His Ala Phe Val Asp Glu His Glu Pro
305 310 315 320
Asp Ser Asp Tyr Arg Ser Ser Ile Thr Val Ile Asp Val Met Ser Asn
325 330 335
Arg Gln Cys Tyr Asn Asp Gly Tyr His Thr Ser His His Leu Asn Pro
340 345 350
Arg Arg His Trp Arg Asp His Pro Val His Phe Gln Lys Ser Lys His
355 360 365
Thr Tyr Ala Glu Glu His Ala Leu Val Phe His Asp Ile Asp Tyr Phe
370 375 380
Met Ile Thr Val Arg Leu Met Met Lys Asp Tyr Lys Thr Leu Ala Lys
385 390 395 400
Cys Leu Val Pro Ile Gly Asp Gln Ile Gly Leu Thr Met Asp Glu Arg
405 410 415
Ala Ala Met Leu Lys Arg Thr Thr Arg Arg Phe Thr Glu Glu Glu Ile
420 425 430
Gln Lys Lys Phe Lys Arg Gln
435
<210> 2
<211> 574
<212> PRT
<213>Artificial sequence
<400> 2
Met Ala His Ser Ser Phe Val Thr Gly Leu Pro Pro Thr Val Gly Asn
1 5 10 15
Ala Leu Glu Lys Thr Pro Lys Leu Met Ser Arg Asp Asp Ile Glu Ala
20 25 30
Leu Ile Ala Glu Gly Lys His Ile Thr Ile Phe His Asn Gln Val Ile
35 40 45
Lys Met Asp Ala Trp Met Pro Tyr His Pro Gly Gly Asp Lys Ala Met
50 55 60
Leu His Leu Val Gly Lys Asp Ala Ser Asp Glu Ile Asp Ala Leu His
65 70 75 80
Ser Tyr Gly Thr Arg Gln His Val Leu Arg Tyr Arg Ile Gly Arg Val
85 90 95
Glu Gly Thr Trp Glu Asn Leu Leu Pro Pro Ile Gln Gly Gly Val His
100 105 110
Arg Thr Arg Glu Glu Ile Glu Arg Ala Asn Ser Glu Gly Asp Leu Asn
115 120 125
Gln Asp Arg Asp Ser Ser Thr Pro Ser Thr Arg Val Pro Ser Pro Val
130 135 140
Phe Asp Glu Asp Asp Ala Lys Gly Val Arg Gln Arg Arg Gly Asp Lys
145 150 155 160
Met Lys Lys Asp Gly Ala Arg Ala Ser Ser Ile Ser Ser Ala Ser Ser
165 170 175
Val Asp Glu Pro Glu Met Asp Gly Met Ser Tyr Leu Asp Thr Ile Thr
180 185 190
Arg Gln His Ile Asn Leu Asp Leu Asp Lys Tyr Pro Pro Pro Asp Lys
195 200 205
Glu Thr Gln Ala Lys Ile Ala Ser Lys Tyr Arg Glu Leu His Gln Lys
210 215 220
Val Tyr Asp Thr Gly Leu Tyr Asp Cys Asn Tyr Arg Ala Tyr Gly Ile
225 230 235 240
Glu Phe Leu Arg Tyr Ile Ala Leu Ala Val Gly Ser Ala Val Ser Leu
245 250 255
Gln His Glu Trp Tyr Ala Leu Ser Ala Phe Leu Leu Gly Ala Leu Trp
260 265 270
His Gln Leu Ser Phe Thr Val His Asp Ala Gly His Met Gly Ile Thr
275 280 285
His Asn Tyr Leu Val Asp Ser Cys Ile Gly Ala Leu Ile Ala Asp Phe
290 295 300
Met Gly Gly Leu Ser Ile Gly Trp Trp Lys Arg Asn His Asn Val His
305 310 315 320
His Val Val Thr Asn Ala Pro Glu His Asp Pro Asp Ile Glu His Met
325 330 335
Pro Leu Phe Ala Val Ser His Arg Leu Leu Gly Ser Leu Arg Ser Thr
340 345 350
Tyr Tyr Glu Arg Val Met Ser Tyr Asp Ala Val Ala Lys Val Leu Leu
355 360 365
Arg Val Gln Ala Trp Thr Tyr Tyr Pro Leu Leu Ser Leu Ala Arg Phe
370 375 380
Asn Leu Tyr Arg Leu Ser Trp Asp Phe Leu Leu Met Gly Arg Gly Pro
385 390 395 400
Lys Lys Gly Pro Ala Leu Ala Ile Trp Trp Leu Glu Val Thr Gly Gln
405 410 415
Val Phe Phe Trp Thr Trp Phe Gly Tyr Gly Leu Val Tyr Asn Met Leu
420 425 430
Pro Asp Asn Trp Thr Arg Phe Tyr Phe Val Met Ile Ser Asn Ile Thr
435 440 445
Ala Ser Pro Leu His Val Gln Ile Val Leu Ser His Phe Ala Met Ser
450 455 460
Thr Val Glu Leu Gly Pro Gln Glu Ser Phe Pro Gln Arg Gln Leu Arg
465 470 475 480
Thr Thr Met Asp Ile Asp Cys Pro Glu Trp Leu Asp Phe Phe His Gly
485 490 495
Gly Leu Gln Phe Gln Val Ile His His Leu Phe Pro Arg Val Pro Arg
500 505 510
His Asn Leu Arg Ala Thr Gln Lys Leu Val Gln Glu Phe Cys Asn Glu
515 520 525
Val Asn Ile Pro Tyr Ala Leu Tyr Gly Phe Ala Asn Gly Asn Gln Lys
530 535 540
Val Ile Gly Arg Leu Ala Glu Val Ser Arg Gln Ala Ala Ile Leu Ser
545 550 555 560
Lys Cys Gln Gln Ser Ile Gln Asn Gly Asp Leu Ser His His
565 570
<210> 3
<211> 1317
<212> DNA
<213>Artificial sequence
<400> 3
atggccgaac acctcgtctt ccacccgcag ctcacaaagg ccgatgccct gattctcgaa 60
ggcttgcgcc aagacatcaa cgagtacaag caacccaagg tcaatgccaa cgtctcaagt 120
caagatggcc aaaccccagc tctacgccaa agagcagcca atggcgaacc ttccaaagcc 180
cgcgatgagg atctgctacg ccatcttcaa tccatgaatg accccaagga tgcccacttt 240
gaagaaagca taaccagcac ttgggacttt gatcagatca agttgccgct tttcctcgag 300
aagctggtcc tacggcccta tgtgcgcatt gcgaaatcta ttgttcgcgt cgacacagat 360
gtcatcatgc tcacccatct tctcctctac ttctctacat ctctacccag tgccatccag 420
ctctttcgca atttctcatg gatccatgga atccttcact tcatcatgca gttcacatac 480
atgggctcct acacactttt gatgcaccag cacatccaca tgcgaggtgt tctcaacaag 540
cgtttcgctt tatttgatag cttgttccct tacatcaccg atccgctcat gggccatacc 600
tggaactcgt acttttacca ccacgtcaag catcaccacg tcgaaggcaa cggacccaac 660
gatctctcgt cgaccatccg atatcagcga gacagcattc ttcacttgct tcactacatc 720
ggcaagttcc tcttctttgt ctggcttgag cttccgctct actttattcg aaatggaaag 780
accatgactg gaatgaaggc tgccttctgg gagctgtcca actatgcttt cctcaccacc 840
atgttttgcc tcaaccgaaa tgctacaatc tgtgtgttcc tcatgccatt gggtcttatg 900
agactgggca tgatgatggg taactggggt caacacgcct ttgtggacga gcatgagccc 960
gactccgatt accgttcaag tattaccgtt attgatgtta tgagcaaccg tcaatgctac 1020
aacgatggat accacacttc tcaccatctc aaccctcgcc gccactggcg cgaccacccc 1080
gtccacttcc aaaagtcgaa gcacacctat gccgaagagc acgctctggt tttccacgat 1140
atcgattact tcatgatcac tgttagactg atgatgaagg attacaagac ccttgccaag 1200
tgtctggtgc ccatcggtga tcagattggg ctgaccatgg atgagcgagc tgccatgttg 1260
aagcgaacca ctcgacgctt caccgaggag gagatccaga agaagtttaa gaggcag 1317
<210> 4
<211> 1725
<212> DNA
<213>Artificial sequence
<400> 4
atggcgcata gctctttcgt taccggcctg ccgcccacgg tgggcaacgc acttgaaaaa 60
acaccaaagc tcatgtctcg agacgacatc gaagctctga ttgccgaagg caagcatatc 120
actatctttc ataatcaagt aatcaaaatg gatgcttgga tgccgtatca tccaggtggt 180
gataaagcca tgcttcatct ggttggtaaa gacgcctcgg acgaaatcga tgcccttcac 240
agttatggaa cccgccagca cgtactgcga tatcgtatcg gtcgagtcga aggtacctgg 300
gagaacctgc tacctcctat ccagggcggc gtccatcgaa cacgggaaga gatcgagcga 360
gccaattcgg agggcgatct caatcaggac cgagattcaa gtacaccgtc gactcgtgtt 420
ccatccccgg tattcgacga ggatgacgca aagggtgttc ggcaacgaag aggggacaag 480
atgaagaagg atggtgctcg agcatcttcg atatcatctg cctccagtgt cgatgagcca 540
gagatggacg gcatgtcgta cttggataca atcactcgcc aacacatcaa cctcgatctc 600
gacaaatacc cccctcccga taaagaaaca caagccaaaa tcgcttccaa gtaccgcgaa 660
cttcatcaaa aagtttacga caccggcctc tacgactgta actacagagc ctatgggatc 720
gaattccttc gatatatcgc attagctgtt ggctcggcgg ttagtctaca acatgagtgg 780
tatgccctca gcgccttcct cttaggcgcc ctctggcatc aactatcgtt caccgttcac 840
gatgctggcc atatgggtat tacccacaac tacctcgtcg attcttgcat cggggccctg 900
attgccgact tcatgggagg tctgtcgata ggctggtgga agcggaatca caacgtgcac 960
catgtcgtca ccaacgctcc ggaacatgac cctgatattg aacacatgcc tctcttcgcc 1020
gtttctcacc gactgcttgg tagcttgcga tcgacatact acgagcgagt aatgtcttac 1080
gatgctgtgg caaaggttct cctcagagtc caggcctgga cctactatcc gctactttcc 1140
ctggcccgtt tcaacctcta ccgactatct tgggactttc ttctcatggg tcgaggtccc 1200
aagaagggcc ctgcattggc tatctggtgg cttgaggtta ctggtcaggt cttcttctgg 1260
acttggttcg gttatggcct cgtctacaat atgcttccag acaactggac tcgattctac 1320
tttgtcatga taagcaacat cacagcgtcg cccctgcacg ttcaaattgt gctatctcac 1380
ttcgccatga gtactgtaga gttggggccc caggaatcct tccctcagag acagcttcga 1440
acgaccatgg atatcgactg ccctgagtgg cttgatttct tccatggtgg cctgcagttc 1500
caagttattc atcatctctt ccctcgtgta ccccgccata acctacgtgc tacacaaaag 1560
ctcgtccagg agttctgtaa cgaggtcaac atcccttacg cactttatgg gttcgccaat 1620
ggtaaccaga aagtgattgg aagactggct gaagtttccc gacaagcggc gatcctttct 1680
aagtgccagc aatcaatcca gaatggtgat ctctctcatc actag 1725
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence
<400> 5
gccaccatgg ccgaacacct c 21
<210> 6
<211> 32
<212> DNA
<213>Artificial sequence
<400> 6
agtgaaggat tccatgtatc catgagaaat tg 32
<210> 7
<211> 32
<212> DNA
<213>Artificial sequence
<400> 7
caatttctca tggatacatg gaatccttca ct 32
<210> 8
<211> 31
<212> DNA
<213>Artificial sequence
<400> 8
gtggctccgg acccctgcct cttaaacttc t 31
<210> 9
<211> 32
<212> DNA
<213>Artificial sequence
<400> 9
gaaaaccccg gtcctatggc gcatagctct tt 32
<210> 10
<211> 33
<212> DNA
<213>Artificial sequence
<400> 10
gcgatatatc gaaggaactc gatcccatag gct 33
<210> 11
<211> 33
<212> DNA
<213>Artificial sequence
<400> 11
agcctatggg atcgagttcc ttcgatatat cgc 33
<210> 12
<211> 22
<212> DNA
<213>Artificial sequence
<400> 12
ctagtgatga gagagatcac ca 22
<210> 13
<211> 66
<212> DNA
<213>Artificial sequence
<400> 13
ggatccggag ccacgaactt ctctctgtta aagcaagcag gagacgtgga agaaaacccc 60
ggtcct 66
<210> 14
<211> 21
<212> DNA
<213>Artificial sequence
<400> 14
atggccgaac acctcgtctt c 21
<210> 15
<211> 20
<212> DNA
<213>Artificial sequence
<400> 15
ctgcctctta aacttcttct 20
<210> 16
<211> 21
<212> DNA
<213>Artificial sequence
<400> 16
atggcgcata gctctttcgt t 21
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence
<400> 17
ctagtgatga gagagatcac 20

Claims (10)

1. a kind of production fusaruside engineering bacterias, which is characterized in that will be gone derived from 3 desaturases in Fusarium graminearum and 10 Saturation enzyme is expressed in Pichia pastoris.
2. engineering bacteria as described in claim 1, which is characterized in that the amino acid sequence such as SEQ ID of 3 desaturases Shown in NO.1；The amino acid sequence of 10 desaturases is as shown in SEQ ID NO.2.
3. engineering bacteria as described in claim 1, which is characterized in that the nucleotide sequence such as SEQ ID of 3 desaturases Shown in NO.3；The nucleotide sequence of 10 desaturases is as shown in SEQ ID NO.4.
4. producing the construction method of fusaruside engineering bacterias described in claim 1, which is characterized in that include the following steps：
S1. the gene of 3 desaturases and 10 desaturases in Fusarium graminearum is expanded；
S2. design primer, in the case of ensureing that purpose amino acid sequence is immovable by Overlap extension PCR, to step, S13 are gone BamH I and the EcoR I contained in saturation enzyme and 10 delta 8 desaturase genes is transformed, and makes no longer to include both in gene The restriction enzyme site of enzyme；Improved 3 desaturase nucleotide sequences are as shown in SEQ ID NO.3；Improved 10 are gone to satisfy Nucleotide sequence with enzyme is as shown in SEQ ID NO.4；
S3. the recombinant expression carrier built, conversion Pichia pastoris to get.
5. construction method according to claim 4, which is characterized in that step S2 the primers are：
3 desaturases：D3-F1：GCCACCATGGCCGAACACCTC, as shown in SEQ ID NO.5；D3-R1： AGTGAAGGATTCCATGTATCCATGAGAAATTG, as shown in SEQ ID NO.6；
D3-F2：CAATTTCTCATGGATACATGGAATCCTTCACT, as shown in SEQ ID NO.7；D3-R2： GTGGCTCCGGACCCCTGCCTCTTAAACTTCT, as shown in SEQ ID NO.8；
10 desaturases：D10-F1：GAAAACCCCGGTCCTATGGCGCATAGCTCTTT, as shown in SEQ ID NO.9； D10-R1：GCGATATATCGAAGGAACTCGATCCCATAGGCT, as shown in SEQ ID NO.10；D10-F2： AGCCTATGGGATCGAGTTCCTTCGATATATCGC, as shown in SEQ ID NO.11；D10-R2： CTAGTGATGAGAGAGATCACCA, as shown in SEQ ID NO.12.
6. construction method according to claim 4, which is characterized in that the method for step S3 structure recombinant expression carrier is：Profit 3 desaturases and 10 delta 8 desaturase genes after being transformed with nested amplification PCR amplification, 2A is inserted between two sections of genetic fragments Peptide gene constitutes the combination gene segment of 10 (E)-SD of (E)-SD -2A-of Δ 3 Δs, using BamH I and EcoR I to combination gene Segment and Yeast expression carrier pPIC3.5K carry out double digestion, be attached and be transformed into Escherichia coli expand to get.
7. construction method according to claim 6, which is characterized in that 2A peptide genes nucleotide sequence such as SEQ ID NO.13 institutes Show.
8. producing application of the fusaruside engineering bacterias in producing fusaruside described in claim 1.
9. a kind of production method of fusaruside, which is characterized in that connect fusaruside engineering bacterias are produced described in claim 1 Kind is cultivated in MGY culture mediums, and culture, which is inoculated in culture to logarithmic phase, 1500~3000g in MGY culture mediums, centrifuges 5- 10min collects cell, and cell is resuspended to OD with MM600=1.0, be added methanol carry out induced expression to get.
10. production method according to claim 9, which is characterized in that it is 0.5% that methanol volumetric concentration, which is added,.
CN201810643362.0A 2018-06-21 2018-06-21 Engineering bacterium for producing fusaruside and construction method and application thereof Expired - Fee Related CN108795787B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810643362.0A CN108795787B (en) 2018-06-21 2018-06-21 Engineering bacterium for producing fusaruside and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810643362.0A CN108795787B (en) 2018-06-21 2018-06-21 Engineering bacterium for producing fusaruside and construction method and application thereof

Publications (2)

Publication Number Publication Date
CN108795787A true CN108795787A (en) 2018-11-13
CN108795787B CN108795787B (en) 2020-07-07

Family

ID=64084107

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810643362.0A Expired - Fee Related CN108795787B (en) 2018-06-21 2018-06-21 Engineering bacterium for producing fusaruside and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN108795787B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101912406A (en) * 2010-06-01 2010-12-15 南京大学 Application of fusaruside in preparing medicament for treating inflammatory enteritis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101912406A (en) * 2010-06-01 2010-12-15 南京大学 Application of fusaruside in preparing medicament for treating inflammatory enteritis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SIMONE ZAUNER ET.AL: "Identification and Functional Characterization of the 2-Hydroxy Fatty N-Acyl-delta 3(E)-desaturase from Fusarium graminearum.", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 *
TIAN Y ET.AL: "Δ10(E)-Sphingolipid Desaturase Involved in Fusaruside Mycosynthesis and Stress Adaptation in Fusarium graminearum.", 《SCI REP.》 *

Also Published As

Publication number Publication date
CN108795787B (en) 2020-07-07

Similar Documents

Publication Publication Date Title
Wawrik et al. Identification of unique type II polyketide synthase genes in soil
WO2016188449A1 (en) Single-domain antibody targeting cd47
CN106434702B (en) A kind of biological synthesis gene cluster of Parker spy&#39;s amide and its application
Jiang et al. Huanglongmycin AC, cytotoxic polyketides biosynthesized by a putative type II polyketide synthase from Streptomyces sp. CB09001
CN115197172B (en) Sesterterpene compound, synthetic gene cluster and synthetic method thereof
CN109609424B (en) Escherichia coli for producing farnesene
CN112142585A (en) Mangicols sesterterpene compounds, synthetic method, gene cluster, nucleic acid molecule, construct and application thereof
CN110343709A (en) A kind of arctic nocardia lasso trick peptide gene cluster and its cloning and expression method
CN108795787A (en) A kind of production fusaruside engineering bacterias and its construction method and application
CN104673813B (en) A kind of ophiobolin class compound parent nucleus synthetic gene AuOS and its application
CN113699130A (en) Polyketide synthase PreuA-TEPreu3Construction of (A) and its application in preparation of nervonic acid
CN104311672B (en) A kind of inhibitor polypeptide with tumour cell targeting
CN107540739A (en) A kind of tumor-targeting polypeptide
CN105002106B (en) The high-yielding engineering bacterial strain of plate mycin peace laminin and its fermentation and separation purifying technique
CN115896058B (en) O-methyltransferase protein with high specific catalytic function on various BIAS parent nuclei, and encoding gene and application thereof
CN113248513B (en) Novel cytochalasin compound with function of antagonizing clinically drug-resistant bacteria and preparation method thereof
CN113444737B (en) Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoid
CN108948109B (en) Raffinolactone glycoside compound and application thereof
CN105153073B (en) Antibiotic difluostatin A and preparation method thereof and the application in antibacterials are prepared
Chang et al. Nocaviogua A and B: two lipolanthines from root-nodule-associated Nocardia sp.
CN107903227B (en) Succinic anhydride compound, gene and protein related to succinic anhydride compound and preparation method of succinic anhydride compound
CN112795494A (en) Genetically engineered bacterium and construction method and application thereof
CN113583993B (en) Polyketide synthase PreuA and application thereof in preparation of lichen ruber acid
Li et al. Purification and identification of an actinomycin D analogue from actinomycetes associated with Ganoderma applanatum via magnetic molecularly imprinted polymers and tandem mass spectrometry
CN105754917B (en) A kind of five lipopeptid of Plipastatin derivative ring and its producing strains and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address

Address after: 250012 No. 18877 Jingshi Road, Jinan City, Shandong Province

Patentee after: Shandong First Medical University (Shandong Academy of Medical Sciences)

Address before: 271016 No. 619, the Great Wall Road, hi tech Development Zone, Shandong, Tai'an

Patentee before: TAISHAN MEDICAL University

CP03 Change of name, title or address
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200707