CN108754023A - A kind of indirect in situ hybridization PCR detection method of oyster herpetovirus - Google Patents
A kind of indirect in situ hybridization PCR detection method of oyster herpetovirus Download PDFInfo
- Publication number
- CN108754023A CN108754023A CN201810602385.7A CN201810602385A CN108754023A CN 108754023 A CN108754023 A CN 108754023A CN 201810602385 A CN201810602385 A CN 201810602385A CN 108754023 A CN108754023 A CN 108754023A
- Authority
- CN
- China
- Prior art keywords
- pcr
- concentration
- indirect
- situ
- histotomy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is a kind of indirect in situ hybridization PCR detection method of oyster herpetovirus, belongs to gene engineering technology field, includes the following steps：Detected sample is fixed first, dehydration, embedding is prepared into histotomy, and prepare liquid phase P CR reaction systems, by PCR response procedures, fixed target DNA in situ in histotomy is expanded, then specific probe and the histotomy after amplification are subjected in situ hybridization, testing result is judged under the microscope finally by immunoenzymatic technique, if there is bluish violet positive signal, then it represents that the oyster herpetovirus testing result of the sample is positive and can accomplish to be accurately positioned to virus.Its advantage is that：The advantages of present invention combines common liquid phase P CR methods high sensitivity and in-situ hybridization method that tissue positioning may be implemented, to reach to the sensitive of oyster herpetovirus, specific detection and be accurately positioned.The tracing detection for the oyster herpetovirus that the detection method can be used in each period breeding process of shellfish has very high use value.
Description
Technical field
The invention belongs to gene engineering technology fields, and in particular to one kind hybridizing PCR by indirect in situ
（indirect in-situ PCR, Indirect ISPCR）Detect oyster herpetovirus（Ostreid herpesvirus1,
OsHV-1）Method.
Background technology
Since early 1990s, OsHV-1 causes 13, the whole world including China countries and regions seawater to be supported
Grow the massive mortality of bivalve shellfish.It includes oyster to be currently known impacted host species（6 kinds）, scallop（2 kinds）, clam class（2
Kind）With 11 species including stalwart blood clam；Wherein it is most affected be China cultivation Chlamys farreri（Chlamys farreri）With the long oyster of Europe cultivation（Crassostrea gigas）.Establish accurate, sensitive and pinpoint detection side
Method is the corresponding prevention and control measure premise and basis that finds the cause of disease and take early.
At present for the detection of OsHV-1, most common method is PCR（PCR）Technology；PCR is used
Primer mostly be design based on the areas viral genome C, and by OIE be recommended as the virus regular-PCR detect universal method, mesh
It is preceding widely used by multiple countries and regions.PCR detection method has the advantages that high sensitivity and high specificity, but since it takes
Sample process, which needs to destroy institutional framework, could extract DNA, thus be unable to get in testing result cause of disease at different tissues position and
Distributed intelligence in cell type.Although in situ hybridization detection method can make up the shortcomings that PCR detection method can not position,
The detection method sensitivity is relatively low.
Invention content
The technical problem to be solved by the present invention is to：Overcome technological deficiency existing for regular-PCR and in situ hybridization detection method,
Round pcr and hybridization in situ technique are combined, liquid phase is carried out to the DNA of fixation in situ target tissue in histotomy first
Then PCR is hybridized and is developed the color；Not only it had maintained the advantage of two technologies but also had compensated for respective deficiency.Inspection of the present invention
Survey method can be used for tracking and the tissue detection and localization of OsHV-1 in each period breeding process of bivalve shellfish.
The technical solution adopted by the present invention to solve the technical problems is：1）It is prepared by probe：With OsHV-1 positive samples DNA
Probe is prepared through PCR amplifications using C2/C6 primers for template；2）It is fixed, is dehydrated using conventional animal tissue, embedded, slice
The methods of, sample preparation to be detected at histotomy and digests it；3）With pre- mixed PCR reaction systems to step
Rapid 2）Histotomy target DNA carry out indirect in situ amplification；4）Take step 3）Histotomy prehybridization after indirect in situ amplification
It carries out prehybridization with hybridizing and hybridizes；5）Take step 4）Histotomy after hybridization fully washs and antibody incubation； 6）By exempting from
Epidemic disease enzyme mark technology is to step 5）Histotomy develops the color, and redyes, micro- sem observation, if there is bluish violet signal detection knot in tissue
Fruit is the positive.
Specifically comprise the following steps：
Step 1）It is prepared by DNA probe：Using the DNA of OsHV-1 positive samples as template, using C2/C6 primers through PCR amplification, primer
Information is as follows：
C2：- 3 ' of 5 '-CTCTTTACCATGAAGATACCCACC,
C6：- 3 ' of 5 '-GTGCACGGCTTACCATTTTT,
PCR reaction systems used are：10×PCR Buffer 10.0µL,MgCl2(15mmol/L) 6.0 μ L, 10 × PCR DIG
Labeling Mix 10.0 μ L, C2 (10.0 μm of ol/L) 4.0 μ L, C6 (10.0 μm of ol/L) 4.0 μ L, archaeal dna polymerase
(5U/ μ L) 1.0 μ L, 4 μ L of DNA profiling, 61 μ L of deionized water, 100 μ L of total system.PCR response procedures used are：94 DEG C of pre-degenerations
2 min, 95 DEG C of denaturation 45s, 55 DEG C of annealing 45s, 68 DEG C of extension 2min, 30 cycles, 4 DEG C preserve.Pass through Ago-Gel electricity
Whether swimming observation probe marks success.
Step 2）Film-making and digestion：Detected sample is fixed through 4% paraformaldehyde, is dehydrated, and is embedded, slice.Histotomy into
The conventional dewaxing aquation of row, 5 min × 3 of dimethylbenzene, (100%) 5 min × 2 of absolute ethyl alcohol, (95%) 5 min of ethyl alcohol, ethyl alcohol
(85%) 5 min, (70%) 5 min of ethyl alcohol, (50%) 5 min of ethyl alcohol；PBS balances 10 min, HCl（0.2 N）Room temperature processing 20
min；37 DEG C of Proteinase K digestion 20 min-25 min, PBS embathe several minutes, and gradient alcohol dehydration is dried.
Step 3）Indirect in situ expands：Indirect in situ used expands PCR reaction systems：10×PCR buffer 5.0µ
L, MgCl2(15mmol/L) 4.0 μ L, dNTP (2.5mmol/L) 5.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, C2/C6
（10.0µmol/L）Each 2.0 μ L of primer, 31 μ L of deionized water, 50 μ L of total volume.PCR amplification program used is：94 DEG C of denaturation
2min, 95 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 68 DEG C of extension 2min, 20 recycle.
Step 4）Prehybridization with hybridize：500 μ L prehybridization solutions are added in histotomy after amplification, and 37 DEG C -42 DEG C in wet box
Interior prehybridization 2h-4h draws prehybridization solution and the hybridization solution that 500 μ L contain probe is added（2.5 ng/ μ L of concentration and probe concentration）, it is capped silicon
Change coverslip, is placed in 95 DEG C of 5 ~ 6 min in situ hybridization stove and is denaturalized target DNA and probe, then rapidly as 5 min on ice
Hybridize 16 h-20 h in 42 DEG C of wet box afterwards.
Step 5）Coverslip, SSC solution various concentration gradient different temperatures gradient wash are removed after hybridization.Malaysia acid balance
After 5 min, 1 h-2 h are closed at room temperature using sealer, 500 μ L sealers are added dropwise on every histotomy by 1:1000
Diluted alkali phosphatase enzyme mark anti digoxin antibody, 4 DEG C overnight.
Step 6）Phosphate buffer containing Tween-20 fully washs, and draws prepared alkaline phosphatase substrate colour developing
200 μ L of agent are added dropwise on tissue sections, and 30 min-2 h of color development at room temperature in wet box, core fast red redyes 1 min-2 min, gradient
Dehydration of alcohol, dimethylbenzene is transparent, resinene mounting.Bluish violet or darkviolet hybridization signal is presented in positive position under light microscopic.
Compared with prior art, the beneficial effects of the invention are as follows：The present invention is with fixation in situ target tissue in histotomy
DNA be template, screen suitable PCR primer.These primers are suitble to indirect in situ amplification and make detection probe simultaneously, and by
PCR reaction systems by optimization and program amplification, are completed to the in-situ enrichment of oyster herpetovirus DNA, hybridization and colour developing, gram
The technological deficiency of PCR and in situ hybridization are used alone before having taken.Reach to the accurate of oyster herpetovirus, Sensitive Detection and sense
Dye tissue site and cell type are accurately positioned.
Description of the drawings
Fig. 1：The present invention prepares Digoxigenin labeled DNA probe figure；
Fig. 2：Detection figures of the indirect ISPCR of the present invention to stalwart blood clam outer embrane；
Fig. 3：Detection figures of the indirect ISPCR of the present invention to stalwart blood clam hepatopancrease；
Fig. 4：Detection figures of the indirect ISPCR of the present invention to the stalwart blood clam gill；
Fig. 5：Detection figures of the indirect ISPCR of the present invention to stalwart blood clam abdominal foot.
Specific implementation mode
Embodiment below in conjunction with the accompanying drawings is described in further detail the present invention：
Embodiment one：Indirect foundation of the ISPCR to the detection method of OsHV-1 in stalwart blood clam outer embrane
1. prepared by indirect ISPCR probes
Using the DNA of oyster herpetovirus positive sample as template, using C2/C6 primers through PCR amplification, PCR reaction systems used
For：10×PCR Buffer 10.0µL,MgCl210.0 μ of (15mmol/L) 6.0 μ L, 10 × PCR DIG Labeling Mix
L, C2 (10.0 μm of ol/L) 4.0 μ L, C6 (10.0 μm of ol/L) 4.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, DNA profiling 4
μ L, 61 μ L of deionized water, 100 μ L of total system.PCR response procedures used are：94 DEG C of pre-degeneration 2 min, 95 DEG C of denaturation 45s, 55
DEG C annealing 45s, 68 DEG C extension 2min, 30 cycle, 4 DEG C preservation.Observe whether probe is marked as by agarose gel electrophoresis
Work(, the results are shown in Figure 1, wherein M：DL1000TM DNA marker；1：Probe band, 2：Standard PCR amplification band.
2. the optimization of film-making and protease K digesting concentration
Detected sample is fixed through 4% paraformaldehyde, is dehydrated, and is embedded, slice.Histotomy carries out conventional dewaxing aquation, dimethylbenzene
5 min × 3, (100%) 5 min × 2 of absolute ethyl alcohol, (95%) 5 min of ethyl alcohol, (85%) 5 min of ethyl alcohol, (70%) 5 min of ethyl alcohol,
(50%) 5 min of ethyl alcohol；PBS（pH=7.4）Balance 10 min, HCl（0.2 N）Room temperature handles 20 min；Proteinase K（Optimize dense
Degree：10 μ g/mL, 20 μ g/mL, 50 μ g/mL, 100 μ g/mL）37 DEG C of digestion 25 min, PBS embathe 10 min, graded ethanol
Dehydration, dries.It is a concentration of after Proteinase K optimization：20 μg/mL.
3. indirect in situ expands and the optimization of amplification cycles number
Indirect in situ used expands PCR reaction systems：10×PCR buffer 5.0µL, MgCl2 (15mmol/L)4.0µ
5.0 μ L of L, dNTP (2.5mmol/L), archaeal dna polymerase (5U/ μ L) 1.0 μ L, C2/C6（10.0µmol/L）Each 2.0 μ of primer
L, 31 μ L of deionized water, 50 μ L of total volume.PCR amplification program used is：94 DEG C of denaturation 2min, 95 DEG C of denaturation 1min, 55 DEG C are moved back
Fiery 1min, 68 DEG C of extension 2min, 20 cycles（The recurring number of optimization is set as：5,10,15,20,25）.After recurring number optimization
For：20.
4. prehybridization with hybridize
500 μ L prehybridization solutions are added in histotomy after amplification（50% deionized formamide, 4 × SSC, 10% dextran sulfate, 10
× Denhardt ' s, 250 μ g/ml transfer ribonucleic acids) 42 DEG C of prehybridization 2h in wet box, draw prehybridization solution and 500 μ L are added
Hybridization solution containing probe（2.5 ng/ μ L of concentration and probe concentration）, it is capped silication coverslip, is placed in in situ hybridization stove 95 DEG C 5 ~ 6
Target DNA and probe are denaturalized by min, then rapidly as hybridized overnight in 42 DEG C of wet box after 5 min on ice.
5. washing and antibody incubation
Remove coverslip after hybridization, 2 × SSC room temperatures 10min, 1 × SSC 42 DEG C of 10 min of 37 DEG C of 10min, 0.5 × SSC,
0.1×SSC 42℃ 10 min.After 5 min of Malaysia acid balance, 2h is closed at room temperature using sealer, on every histotomy
500 μ L sealers are added dropwise by 1:1000 4 DEG C of diluted alkali phosphatase enzyme mark anti digoxin antibodies are overnight.
6. colour developing and observation
Phosphate buffer containing Tween-20 fully washs, and draws 200 μ L drops of prepared alkaline phosphatase substrate color developing agent
Adding on tissue sections, 30 min of color development at room temperature in wet box, core fast red redyes 2 min, and gradient alcohol dehydration, dimethylbenzene is transparent,
Resinene mounting.Bluish violet or darkviolet hybridization signal is presented in positive position under light microscopic.
Fig. 2 is testing results of the indirect ISPCR to OsHV-1 in stalwart blood clam outer embrane.
Embodiment two：Indirect detections and positioning scenarios of the ISPCR to OsHV-1 in stalwart blood clam hepatopancrease
1. prepared by indirect ISPCR probes
Using the DNA of OsHV-1 positive samples as template, using C2/C6 primers through PCR amplification, PCR reaction systems used are：10×
PCR Buffer 10.0µL、MgCl2(15mmol/L) 6.0 μ L, 10 × PCR DIG Labeling Mix 10.0 μ L, C2
(10.0 μm of ol/L) 4.0 μ L, C6 (10.0 μm of ol/L) 4.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, 4 μ L of DNA profiling are gone
61 μ L of ionized water, 100 μ L of total system.PCR response procedures used are：94 DEG C of 2 min of pre-degeneration, 95 DEG C of denaturation 45s, 55 DEG C are annealed
45s, 68 DEG C of extension 2min, 30 cycles, 4 DEG C of preservations.Observe whether probe marks success by agarose gel electrophoresis, as a result
As shown in Figure 1, wherein M：DL1000TM DNA marker；1：Probe band, 2：Standard PCR amplification band.
2. film-making and digestion
Detected sample is fixed through 4% paraformaldehyde, is dehydrated, and is embedded, slice.Histotomy carries out conventional dewaxing aquation, dimethylbenzene
5 min × 3, (100%) 5 min × 2 of absolute ethyl alcohol, (95%) 5 min of ethyl alcohol, (85%) 5 min of ethyl alcohol, ethyl alcohol (70%) 5
Min, (50%) 5 min of ethyl alcohol；PBS（pH=7.4）Balance 10 min, HCl（0.2 N）Room temperature handles 20 min；Proteinase K (20
μ g/mL) 37 DEG C of digestion 25 min, PBS embathe 10 min, and gradient alcohol dehydration is dried.
3. indirect in situ expands
Indirect ISPCR reaction systems used are：10×PCR buffer 5.0µL, MgCl2 (15mmol/L)4.0µL, dNTP
(2.5mmol/L) 5.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, C2/C6（10.0µmol/L）Each 2.0 μ L of primer, deionization
31 μ L of water, 50 μ L of total volume.PCR amplification program used is：94 DEG C of denaturation 2min, 95 DEG C of denaturation 1min, 55 DEG C of 1min that anneal, 68
DEG C extend 2min, 20 cycle.
4. prehybridization with hybridize
500 μ L prehybridization solutions are added in histotomy after amplification（50% deionized formamide, 4 × SSC, 10% dextran sulfate, 10
× Denhardt ' s, 250 μ g/ml transfer ribonucleic acids) 42 DEG C of prehybridization 2h in wet box, draw prehybridization solution and 500 μ L are added
Hybridization solution containing probe（2.5 ng/ μ L of concentration and probe concentration）, it is capped silication coverslip, is placed in in situ hybridization stove 95 DEG C 5 ~ 6
Target DNA and probe are denaturalized by min, then rapidly as hybridized overnight in 42 DEG C of wet box after 5 min on ice.
5. washing and antibody incubation
Remove coverslip after hybridization, 2 × SSC room temperatures 10min, 1 × SSC 42 DEG C of 10 min of 37 DEG C of 10min, 0.5 × SSC,
0.1×SSC 42℃ 10 min.After 5 min of Malaysia acid balance, 2h is closed at room temperature using sealer, on every histotomy
500 μ L sealers are added dropwise by 1:1000 4 DEG C of diluted alkali phosphatase enzyme mark anti digoxin antibodies are overnight.
6. colour developing and observation
Phosphate buffer containing Tween-20 fully washs, and draws 200 μ L drops of prepared alkaline phosphatase substrate color developing agent
Adding on tissue sections, 30 min of color development at room temperature in wet box, core fast red redyes 2 min, and gradient alcohol dehydration, dimethylbenzene is transparent,
Resinene mounting.Bluish violet or darkviolet hybridization signal is presented in positive position under light microscopic.
Fig. 3 is testing results of the indirect ISPCR to OsHV-1 in stalwart blood clam hepatopancrease.
Embodiment three：Indirect detections and positioning scenarios of the ISPCR to OsHV-1 in the stalwart blood clam gill
1. prepared by indirect ISPCR probes
Using the DNA of oyster herpetovirus positive sample as template, using C2/C6 primers through PCR amplification, PCR reaction systems used
For：10×PCR Buffer 10.0µL,MgCl210.0 μ of (15mmol/L) 6.0 μ L, 10 × PCR DIG Labeling Mix
L, C2 (10.0 μm of ol/L) 4.0 μ L, C6 (10.0 μm of ol/L) 4.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, DNA profiling 4
μ L, 61 μ L of deionized water, 100 μ L of total system.PCR response procedures used are：94 DEG C of pre-degeneration 2 min, 95 DEG C of denaturation 45s, 55
DEG C annealing 45s, 68 DEG C extension 2min, 30 cycle, 4 DEG C preservation.Observe whether probe is marked as by agarose gel electrophoresis
Work(, the results are shown in Figure 1, wherein M：DL1000TM DNA marker；1：Probe band, 2：Standard PCR amplification band.
2. film-making and digestion
Detected sample is fixed through 4% paraformaldehyde, is dehydrated, and is embedded, slice.Histotomy carries out conventional dewaxing aquation, dimethylbenzene
5 min × 3, (100%) 5 min × 2 of absolute ethyl alcohol, (95%) 5 min of ethyl alcohol, (85%) 5 min of ethyl alcohol, ethyl alcohol (70%) 5
Min, (50%) 5 min of ethyl alcohol；PBS（pH=7.4）Balance 10 min, HCl（0.2 N）Room temperature handles 20 min；Proteinase K (20
μ g/mL) 37 DEG C of digestion 25 min, PBS embathe 10 min, and gradient alcohol dehydration is dried.
3. indirect in situ expands
Indirect ISPCR reaction systems used are：10×PCR buffer 5.0µL, MgCl2 (15mmol/L)4.0µL, dNTP
(2.5mmol/L) 5.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, C2/C6（10.0µmol/L）Each 2.0 μ L of primer, deionization
31 μ L of water, 50 μ L of total volume.PCR amplification program used is：94 DEG C of denaturation 2min, 95 DEG C of denaturation 1min, 55 DEG C of 1min that anneal, 68
DEG C extend 2min, 20 cycle.
4. prehybridization with hybridize
500 μ L prehybridization solutions are added in histotomy after amplification（50% deionized formamide, 4 × SSC, 10% dextran sulfate, 10
× Denhardt ' s, 250 μ g/ml transfer ribonucleic acids) 42 DEG C of prehybridization 2h in wet box, draw prehybridization solution and 500 μ L are added
Hybridization solution containing probe（2.5 ng/ μ L of concentration and probe concentration）, it is capped silication coverslip, is placed in in situ hybridization stove 95 DEG C 5 ~ 6
Target DNA and probe are denaturalized by min, then rapidly as hybridized overnight in 42 DEG C of wet box after 5 min on ice.
5. washing and antibody incubation
Remove coverslip after hybridization, 2 × SSC room temperatures 10min, 1 × SSC 42 DEG C of 10 min of 37 DEG C of 10min, 0.5 × SSC,
0.1×SSC 42℃ 10 min.After 5 min of Malaysia acid balance, 2h is closed at room temperature using sealer, on every histotomy
500 μ L sealers are added dropwise by 1:1000 4 DEG C of diluted alkali phosphatase enzyme mark anti digoxin antibodies are overnight.
6. colour developing and observation
Phosphate buffer containing Tween-20 fully washs, and draws 200 μ L drops of prepared alkaline phosphatase substrate color developing agent
Adding on tissue sections, 30 min of color development at room temperature in wet box, core fast red redyes 2 min, and gradient alcohol dehydration, dimethylbenzene is transparent,
Resinene mounting.Bluish violet or darkviolet hybridization signal is presented in positive position under light microscopic.
Fig. 4 is testing results of the indirect ISPCR to OsHV-1 in the stalwart blood clam gill.
Example IV：Indirect detections and positioning scenarios of the ISPCR to OsHV-1 in stalwart blood clam abdominal foot
1. prepared by indirect ISPCR probes
Using the DNA of OsHV-1 positive samples as template, using C2/C6 primers through PCR amplification, PCR reaction systems used are：10×
PCR Buffer 10.0µL、MgCl2(15mmol/L) 6.0 μ L, 10 × PCR DIG Labeling Mix 10.0 μ L, C2
(10.0 μm of ol/L) 4.0 μ L, C6 (10.0 μm of ol/L) 4.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, 4 μ L of DNA profiling are gone
61 μ L of ionized water, 100 μ L of total system.PCR response procedures used are：94 DEG C of 2 min of pre-degeneration, 95 DEG C of denaturation 45s, 55 DEG C are annealed
45s, 68 DEG C of extension 2min, 30 cycles, 4 DEG C of preservations.Observe whether probe marks success by agarose gel electrophoresis, as a result
As shown in Figure 1, wherein M：DL1000TM DNA marker；1：Probe band, 2：Standard PCR amplification band.
2. film-making and digestion
Detected sample is fixed through 4% paraformaldehyde, is dehydrated, and is embedded, slice.Histotomy carries out conventional dewaxing aquation, dimethylbenzene
5 min × 3, (100%) 5 min × 2 of absolute ethyl alcohol, (95%) 5 min of ethyl alcohol, (85%) 5 min of ethyl alcohol, ethyl alcohol (70%) 5
Min, (50%) 5 min of ethyl alcohol；PBS（pH=7.4）Balance 10 min, HCl（0.2 N）Room temperature handles 20 min；Proteinase K (20
μ g/mL) 37 DEG C of digestion 25 min, PBS embathe 10 min, and gradient alcohol dehydration is dried.
3. indirect in situ expands
Indirect ISPCR reaction systems used are：10×PCR buffer 5.0µL, MgCl2 (15mmol/L)4.0µL, dNTP
(2.5mmol/L) 5.0 μ L, archaeal dna polymerase (5U/ μ L) 1.0 μ L, C2/C6（10.0µmol/L）Each 2.0 μ L of primer, deionization
31 μ L of water, 50 μ L of total volume.PCR amplification program used is：94 DEG C of denaturation 2min, 95 DEG C of denaturation 1min, 55 DEG C of 1min that anneal, 68
DEG C extend 2min, 20 cycle.
4. prehybridization with hybridize
500 μ L prehybridization solutions are added in histotomy after amplification（50% deionized formamide, 4 × SSC, 10% dextran sulfate, 10
× Denhardt ' s, 250 μ g/ml transfer ribonucleic acids) 42 DEG C of prehybridization 2h in wet box, draw prehybridization solution and 500 μ L are added
Hybridization solution containing probe（2.5 ng/ μ L of concentration and probe concentration）, it is capped silication coverslip, is placed in in situ hybridization stove 95 DEG C 5 ~ 6
Target DNA and probe are denaturalized by min, then rapidly as hybridized overnight in 42 DEG C of wet box after 5 min on ice.
5. washing and antibody incubation
Remove coverslip after hybridization, 2 × SSC room temperatures 10min, 1 × SSC 42 DEG C of 10 min of 37 DEG C of 10min, 0.5 × SSC,
0.1×SSC 42℃ 10 min.After 5 min of Malaysia acid balance, 2h is closed at room temperature using sealer, on every histotomy
500 μ L sealers are added dropwise by 1:1000 4 DEG C of diluted alkali phosphatase enzyme mark anti digoxin antibodies are overnight.
6. colour developing and observation
Phosphate buffer containing Tween-20 fully washs, and draws 200 μ L drops of prepared alkaline phosphatase substrate color developing agent
Adding on tissue sections, 30 min of color development at room temperature in wet box, core fast red redyes 2 min, and gradient alcohol dehydration, dimethylbenzene is transparent,
Resinene mounting.Bluish violet or darkviolet hybridization signal is presented in positive position under light microscopic.
Fig. 5 is testing results of the indirect ISPCR to OsHV-1 in stalwart blood clam abdominal foot.
The above described is only a preferred embodiment of the present invention, being not that the invention has other forms of limitations, appoint
What those skilled in the art changed or be modified as possibly also with the technology contents of the disclosure above equivalent variations etc.
Imitate embodiment.But it is every without departing from technical solution of the present invention content, according to the technical essence of the invention to above example institute
Any simple modification, equivalent variations and the remodeling made, still fall within the protection domain of technical solution of the present invention.
Claims (3)
1. a kind of indirect in situ of oyster herpetovirus hybridizes PCR detection method, it is characterised in that：Include the following steps：
1）It is prepared by probe：Using oyster herpetovirus positive sample DNA as template, using C2/C6 primers, expands to prepare through PCR and visit
Needle；
Primer information is as follows：C2：5 '-CTCTTTACCATGAAGATACCCACC -3 ', C6：5 '-
GTGCACGGCTTACCATTTTT -3 '；
PCR reaction systems used are：10 × PCR Buffer, 10.0 6.0 μ L, 10 × PCR DIG Labeling of μ L, MgCl2
Mix 10.0 μ L, C2 4.0 μ L, C64.0 μ L, 1.0 μ L of archaeal dna polymerase, 4.0 μ L of DNA profiling, 61 μ L of deionized water, total system
100µL；
PCR response procedures used are：94 DEG C of pre-degeneration 2 min, 95 DEG C of denaturation 45s, 55 DEG C of annealing 45s, 68 DEG C of extension 2min, 30
A cycle, 4 DEG C of preservations；
2）Digestion：The digestion of specific time is carried out to tissue paraffin section de using certain density Proteinase K；
3）Indirect in situ expands：Amplification in situ is carried out to histotomy target DNA with pre- mixed PCR reaction systems；It is used indirect
Original position expands PCR reaction systems：10 × PCR buffer 5.0 μ L, MgCl24.0 μ L, dNTP5.0 μ L, 1.0 μ of archaeal dna polymerase
Each 2.0 μ L of L, C2/C6 primer, 31 μ L of deionized water, 50 μ L of total volume；
PCR amplification program used is：94 DEG C of pre-degenerations 2min, 95 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 68 DEG C of extension 2min,
20 cycles；
4）Prehybridization with hybridize：Histotomy after taking indirect in situ to expand carries out prehybridization and hybridizes；By the tissue after amplification
500 42 DEG C of prehybridization 2h in wet box of μ L prehybridization solutions are added in slice；The prehybridization solution include 50% deionized formamide, 4 ×
SSC, 10% dextran sulfate, 10 × Denhardt ' s, 250 μ g/ml transfer ribonucleic acids；
It draws prehybridization solution and the hybridization solution that 500 μ L contain probe is added, the hybridization solution concentration and probe concentration therein is 2.5 ng/ μ
L；Be capped silication coverslip, be placed in in situ hybridization stove, 95 DEG C, 5 min by target DNA and probe denaturation, then rapidly as ice
Hybridized overnight in 42 DEG C of wet box after upper 5 min；
5）Washing and antibody incubation：Histotomy after hybridization is removed into coverslip, 2 × SSC room temperatures 10min, 1 × SSC 37
DEG C 10min, 42 DEG C of 10min of 0.5 × SSC 42 DEG C of 10 min, 0.1 × SSC；
After 5 min of Malaysia acid balance, 2h is closed at room temperature using sealer, and 500 μ L sealers are added dropwise on every histotomy
By 1:1000 diluted alkali phosphatase enzyme mark anti digoxin antibodies are incubated 4 DEG C overnight；
6）Colour developing and observation：It is developed the color, is redyed, micro- sem observation, it is determined that detected to histotomy by immunoenzymatic technique
Whether sample is by oyster herpetovirus infects and infects specific histocyte position；
Phosphate buffer containing Tween-20 fully washs, and draws 200 μ L drops of prepared alkaline phosphatase substrate color developing agent
Adding on tissue sections, color development at room temperature 30min in wet box, core fast red redyes 2min, and gradient alcohol dehydration, dimethylbenzene is transparent, in
Property resin mounting；Bluish violet or darkviolet hybridization signal is presented in positive position under light microscopic.
2. the indirect in situ of oyster herpetovirus as described in claim 1 hybridizes PCR detection method, it is characterised in that：It is described
Step 2）A concentration of 20 μ g/mL of the Proteinase K used digest 25 min at 37 DEG C.
3. the indirect in situ of oyster herpetovirus as claimed in claim 2 hybridizes PCR detection method, it is characterised in that：It is described
Step 1）In MgCl2 a concentration of 15mmol/L, C2 a concentration of 10.0 μm of ol/L, C6 a concentration of 10.0 μm of ol/L, DNA is poly-
A concentration of 5U/ μ L of synthase；
The step 3）In MgCl2 a concentration of 2.5mmol/L of a concentration of 15mmol/L, dNTP, archaeal dna polymerase is a concentration of
A concentration of 10.0 μm of ol/L of 5U/ μ L, C2 a concentration of 10.0 μm of ol/L, C6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810602385.7A CN108754023B (en) | 2018-06-12 | 2018-06-12 | Indirect in-situ hybridization PCR (polymerase chain reaction) detection method of oyster herpesvirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810602385.7A CN108754023B (en) | 2018-06-12 | 2018-06-12 | Indirect in-situ hybridization PCR (polymerase chain reaction) detection method of oyster herpesvirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108754023A true CN108754023A (en) | 2018-11-06 |
| CN108754023B CN108754023B (en) | 2022-03-11 |
Family
ID=64022585
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810602385.7A Active CN108754023B (en) | 2018-06-12 | 2018-06-12 | Indirect in-situ hybridization PCR (polymerase chain reaction) detection method of oyster herpesvirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108754023B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109669040A (en) * | 2018-12-14 | 2019-04-23 | 厦门艾德生物医药科技股份有限公司 | It is a kind of for enhancing the antibody diluent and its application method of PD-L1 monoclonal antibody using effect |
| CN110734964A (en) * | 2019-09-17 | 2020-01-31 | 武汉赛维尔生物科技有限公司 | hybridization buffer solution system suitable for bacterial FISH detection and in-situ hybridization method thereof |
| CN112730829A (en) * | 2021-01-19 | 2021-04-30 | 中国水产科学研究院黄海水产研究所 | Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof |
| CN113481321A (en) * | 2021-03-24 | 2021-10-08 | 北京市水产技术推广站 | In-situ hybridization detection probe for carp edema virus and application thereof |
-
2018
- 2018-06-12 CN CN201810602385.7A patent/CN108754023B/en active Active
Non-Patent Citations (5)
| Title |
|---|
| ARZUL I,ET AL: "French scallops:a new host for Ostreid herpesvirus-1", 《VIROLOGY》 * |
| DA SILVA P M，ET AL: "Herpesvirus infection in European flat oysters Ostrea edulis obtained from brood stocks of various geographic origins and grown in Galicia (NW Spain)", 《DISEASES OF AQUATIC ORGANISMS》 * |
| SERGE CORBEIL 等: ""Development of an in situ hybridization assay for the detection ofostreid herpesvirus type 1 mRNAs in the Pacific oyster, Crassostreagigas"", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| T RENAULT 等: ""Herpes-like virus infections in hatchery-reared bivalve larvae in Europe: speci®c viral DNA detection by PCR"", 《JOURNAL OF FISH DISEASES》 * |
| 徐镔蕊,等: "原位PCR和原位杂交检测蛋鸡J亚群禽白血病病毒", 《微生物学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109669040A (en) * | 2018-12-14 | 2019-04-23 | 厦门艾德生物医药科技股份有限公司 | It is a kind of for enhancing the antibody diluent and its application method of PD-L1 monoclonal antibody using effect |
| CN110734964A (en) * | 2019-09-17 | 2020-01-31 | 武汉赛维尔生物科技有限公司 | hybridization buffer solution system suitable for bacterial FISH detection and in-situ hybridization method thereof |
| CN112730829A (en) * | 2021-01-19 | 2021-04-30 | 中国水产科学研究院黄海水产研究所 | Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof |
| CN112730829B (en) * | 2021-01-19 | 2022-03-04 | 中国水产科学研究院黄海水产研究所 | Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof |
| CN113481321A (en) * | 2021-03-24 | 2021-10-08 | 北京市水产技术推广站 | In-situ hybridization detection probe for carp edema virus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108754023B (en) | 2022-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108754023A (en) | A kind of indirect in situ hybridization PCR detection method of oyster herpetovirus | |
| CN106086242A (en) | A kind of test kit detected for Flavivirus fast typing and virus load | |
| CN110283936A (en) | A kind of African swine fever virus LAMP-HNB Visual retrieval kit | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| CN105483214A (en) | Mycobacterium tuberculosis detection kit and application thereof | |
| CN105039541A (en) | Primer and probe sequence used for LAMP-LFD detection of vibrio fluvialis and application of primer and probe sequence | |
| CN108504753A (en) | A method of detection staphylococcus aureus live bacteria in milk | |
| CN104531885B (en) | Aeromonas veronii quick detection primer, kit and application | |
| Jun-Hai et al. | Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of bacterial blight pathogen (Xanthomonas axonopodis pv. dieffenbachiae) in anthurium | |
| CN102776295A (en) | Kit and method for detecting TYLCV (tomato yellow leaf curl virus) carried by tomato seedlings | |
| CN106222298B (en) | LAMP detection kit, detection method and application of RNA virus | |
| CN110358863A (en) | A kind of primer and its application for detecting cucumber mosaic virus passionflower isolate | |
| CN101748206B (en) | Detection and identification kit of composite PCR of wheat stripe rust fungus and leaf rust fungus | |
| CN103451310B (en) | Gene chip capable of simultaneously detecting various vibrios and method for detecting vibrios | |
| CN109486973A (en) | A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique | |
| CN108456746A (en) | A method of cucumber green mottle mosaic virus is detected based on one-step method RPA technologies | |
| CN105002169A (en) | DHAV-3 fluorescent quantitation RT-LAMP detection reagent kit and application and method thereof | |
| CN107254556A (en) | Method, RPA IAC primers and kit based on RPA IAC technology examination bean mosaic virus 4s | |
| CN104862423B (en) | The visualization genetic chip and kit of porcine pseudorabies virus, pig parvoviral and porcine circovirus 2 type | |
| CN104450930B (en) | A kind of molecular detecting method of vibrio parahemolyticus and its application | |
| CN107541569A (en) | HBV DNA and cccDNA hybridization in situ detection kit in a kind of hepatic tissue | |
| CN105177165A (en) | Eriocheir sinensis Microsporidia in-situ hybridization detection probe and kit | |
| CN108660256A (en) | The Polymorphism detection kit and detection method of potato yellow dwarf virus | |
| CN103409502A (en) | Probe and kit for common pathogens detection of skin infectious granuloma | |
| Lin et al. | Development of a multiplex TaqMan real-time RT-PCR assay for simultaneous detection of Asian prunus viruses, plum bark necrosis stem pitting associated virus, and peach latent mosaic viroid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |