CN108753803B - A kind of high oleic acid peanut mutated gene AhFAD2B-814 and application - Google Patents
A kind of high oleic acid peanut mutated gene AhFAD2B-814 and application Download PDFInfo
- Publication number
- CN108753803B CN108753803B CN201810774992.1A CN201810774992A CN108753803B CN 108753803 B CN108753803 B CN 108753803B CN 201810774992 A CN201810774992 A CN 201810774992A CN 108753803 B CN108753803 B CN 108753803B
- Authority
- CN
- China
- Prior art keywords
- ahfad2b
- oleic acid
- peanut
- gene
- high oleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
A kind of high oleic acid peanut mutated gene AhFAD2B-814 and application, belong to plant molecular breeding field, the nucleotide sequence of the mutated gene AhFAD2B-814 is as shown in SEQ ID NO.1, by 1140 base compositions.The mutant nucleotide sequence of peanut high-oil mutant polynucleotides oleic acid dehydrogenase gene of the invention, mutant nucleotide sequence can be imported to the peanut varieties or strain of other common oleic acid contents using plants conventional breeding methods such as hybridization, backcrossings, improve the oleic acid content for importing AhFAD2B-814 gene mutation nucleotide sequence target variety or strain, the genetic diversity for obviously increasing high oleic acid peanut varieties (being) widens the hereditary basis of high oleic acid peanut.In high oleic acid peanut breeding, parent can be done by the peanut material that selection carries AhFAD2A mutated-genotype, keep the high oleic acid character determination of breeding progeny more purposive, and improve the frequency of occurrences of objective trait.
Description
Technical field
The invention belongs to plant molecular breeding fields, specifically, being related to high oleic acid peanut coding oleic acid dehydrogenase and can
To improve the mutated gene nucleic acid sequence and its application of oleic acid content of peanuts.
Background technique
Peanut is the important oil plant and industrial crops of China, and peanut oil is Chinese tradition edible oil and domestic edible plant
The main source of object oil.Mainly there are palmitinic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid in peanut oil
(C18:2), the fatty acid such as behenic acid (C22:0) and arachidic acid (C20:0).From the point of view of the composition of various fatty acid, unsaturated lipid
Fat acid is about 80% (wherein oleic acid 36%-67%, linoleic acid 15%-43%), and saturated fatty acid accounts for 20% (wherein palmitinic acid
6%-11%, stearic acid 2%-6%, arachidic acid 5%-7%, behenic acid 2%-3%).In peanut seed fatty acid composition and
Its content is to measure the important indicator of its quality.In terms of Oil stability, linoleic acid category polyunsaturated fatty acid, oleoyl
Residue is oxidizable and leads to grease corruption deterioration, seriously affects grease Storage period；And oleic acid molecular contains only a bivalent insatiable hunger
And key, chemical structure is relatively stable, and oxidation resistance is strong, is unlikely to deteriorate in refining, storage and frying, with common peanut
It compares, the peanut of high oleic acid content has longer shelf life.In terms of nutritive value, the quality of peanut oil disappears to peanut oil fixation
The health for taking crowd has great influence.The nutritive value of oleic acid is higher, can reduce the content of low-density lipoprotein in blood,
It maintains more effectively to protect cardiovascular and cerebrovascular, moreover it is possible to reverse inflammatory cytokine TNF-α pair beneficial to hdl level simultaneously
The inhibiting effect that insulin generates.Therefore, the important goal that oleic acid content has become peanut quality breeding is improved.
Oleic acid dehydrogenase (Δ 12FAD or FAD2) is that dehydrogenation generation is double unsaturated linoleic on the position C12 for be catalyzed oleic acid
Key enzyme, it controls oleic acid, linoleic content and its ratio (O/L).The more and more evidences of molecular biology research show
AhFAD2 is that oleic acid generates linoleic key gene, determines oleic acid and linoleic relative amount in peanut seed.Cultivar
Peanut (Arachis hypogaea) is the allotetraploid species (2n=4x=40) with genome A and genome B,
AhFAD2 is encoded jointly by 2 couples of non-equipotential homologous gene AhFAD2A and AhFAd2B being located in different genes group, they distinguish
From peanut wild species A and 1 B gene group, which is not admitted to seed specific expression gene, in common oleic acid content flower
This 2 genes or one of them energy normal expression in health product kind；And in high oleic acid kind, AhFAD2A and AhFAd2B gene
It is mutated jointly the generation for leading to high oleic acid character.
The evaluation and screening from peanut resource goes out the high oleic acid peanut of oleic acid content 79% (O/L 37) to American scientist earliest
Natural mutant F435.It is close from originating in the code area of AhFAD2A by being found to common oleic acid peanut and F435 sequence alignment
Numeral plays the discovery of 448bp base, and there are single bases to replace (G > A), makes the 150th amino acids of protein of coding by asparagus fern ammonia
Sour (D) is changed into asparagine (N), and D150 residue is absolute conservation in all FAD2, is the key that high oleic acid character
Site, mutation lead to the reduction of AhFAD2A enzymatic activity；It is risen at 441_442bp in AhFAD2B gene start codon and there is single alkali
Base is inserted into (442insA), and password is caused to be mutated, and causes the protein sequence of translation to terminate in advance, generates inactive albumen.It
Afterwards, American scientist has directly been bred as high oleic acid peanut varieties C458 and M2-225 using chemical mutagenesis, they AhFAD2A from
So on the basis of mutation (G448A), mutagenesis makes to be inserted into respectively at 665bp and 997bp after AhFAD2B gene start codon micro- again
Type inverted repeat transposable element MITE (205bp), causes peptide chain to terminate in advance, loses protein function.The above AhFAD2B mutation
Gene belongs to nonsense mutation (Nonsense mutation), keeps the albumen generated incomplete and loses the function of protogene,
GENE SOURCES as peanut high-oleic acid breeding.
In by the end of December, 2016 by, high oleic acid peanut varieties only 38 of China's incubation, foreign countries have been bred as high oleic acid kind
89.Pedigree analysis traces the high oleic acid gene source for being bred as high oleic acid kind, and the high oleic acid gene of 70% or more kind supplies
Body derives from F435.High oleic acid GENE SOURCES unification, high oleic acid kind hereditary basis relative narrowness, the heredity for having resulted in incubation are more
Sample decline, the contradiction of yield and quality and the high-quality contradiction with disease resistance become increasingly conspicuous.Currently, large area is answered in domestic production
Peanut varieties oleic acid content is universal lower (< 50%), and palmitic acid content is higher (> 11%).On the other hand, domestic flower
The oleic acid content of raw germ plasm resource is less than 70%, and maximum level only 67.2% belongs to the raw type of dragon, result dispersion, fertility
Phase is long, and utilizing status is undesirable in breeding.Therefore new germ plasm resource is excavated and created by multipath has become high oil
The task of top priority of sour peanut breeding.
Recently, American scientist identifies 2 new high oleic acid peanut natural mutant PI342664 and PI342666 again,
The 448 G > A in its gene coding region AhFAD2A mutation be previously reported identical, and AhFAD2B gene mutation C301G leads to amino
Sour H101D change belongs to new mutational site, and mutant oleic acid content is finally made to reach 79% or more.India peanut breeding man adopts
With gamma-ray and mutagenesis disease-resistant variety, obtain 2 new high oleic acid mutant (GM6-1 and GM4-3), oleic acid content 75% with
On, research finds that AhFAD2B gene occurs base replacement G1111A and amino acid G372S is caused to change, to generate high oleic acid table
Type.In addition, domestic peanut researcher obtains the new mutational site C313T of AhFAD2B gene using EMS chemical mutagenesis, cause ammonia
Base acid sequence H105Y mutation, makes oleic acid content be increased to 60% or more by 44%.But these mutant yet there are no so far
The report applied in high oleic acid peanut breeding.
In conclusion the high oleic acid Silk channel injection oleic acid content of practical application is 80% hereinafter, lack superelevation in breeding
The peanut new germ plasm of oleic acid content (at least > 80%).A small number of high oleic acid peanut materials that the country obtains are substantially in U.S.'s height
Hybridize on the basis of oleic acid peanut mutant, by intellectual property protection, China is not yet had for high oleic acid gene or material
There is the high oleic acid peanut new germ plasm of independent intellectual property right.Peanut high-oil acid gene with independent intellectual property rights is developed, is to promote
The important guarantee of China's high oleic acid peanut industryization fast development.But so far, the country is open not yet or delivers peanut
High oleic acid mutated gene and its application.
Summary of the invention
It is an object of the invention to make up the deficiency of existing patent or technology, with the height for the natural mutation generation that we study
Oleic acid peanut mutant C814T is material, provides a kind of new high oleic acid peanut AhFAD2B mutated gene nucleotide sequence,
Encode peanut body in oleic acid dehydrogenase (FAD2), the enzyme be in plant body fat acid biosynthesis pathway be catalyzed oleic acid (C18:
1) the 12nd carbon potential dehydrogenation of carbochain forms double bond, to the key enzyme of conversion of linoleic acid.It is another object of the present invention to provide one
The nucleotides sequence of kind high oleic acid Fatty Acid In Peanut dehydrogenase gene saltant type is listed in the application in peanut high-oleic acid breeding.
The present invention be realize its purpose the technical solution adopted is that:
A kind of high oleic acid peanut mutated gene AhFAD2B-814, the nucleotide sequence of the mutated gene AhFAD2B-814
As shown in SEQ ID NO.1, by 1140 base compositions；Or nucleotide sequence shown in SEQ ID NO:1 through displacement, insertion or
The nucleotide sequence of the expression identical function protein of deletion driven；Or have with nucleotide sequence shown in SEQ ID NO:1
90% or more homology and the nucleotide sequence or complementary series for expressing identical function protein.
A kind of high oleic acid peanut mutated gene AhFAD2B-814, the mutated gene AhFAD2B-814 include to have at one
Adopted base mutation: 814C > T, there are the base replacements of C814T at SEQ ID NO.1 sequence 814bp.
A kind of high oleic acid peanut mutated gene AhFAD2B-814 as described above, the protein of mutated gene coding
Sequence is made of as shown in SEQ ID NO.2 379 amino acid residues, and 272 amino acid residue of protein sequence is by histidine
(H) it is changed into tyrosine (Y).
A kind of PCR primer detecting high oleic acid peanut FAD2B mutated-genotype,
(1) the primer pair AhFAD2B- of the site the 814bp base C amplification to AhFAD2B wild type gene code area is designed
C/AhFAD2B-Ro,
AhFAD2B-C:5 '-AGTTACCATAACCTATTTGCAGCACAAAC -3 '；
AhFAD2B-Ro:5 '-GGCTTCTCTCCACAATGCTTTGTAAAC -3 '；
(2) the primer pair AhFAD2B- of the site the 814bp base T amplification to AhFAD2B mutated genes code area is designed
Fo/AhFAD2B-T,
AhFAD2B-Fo:5 '-CATATCTGCTATATCACATAGCAACTT -3 '；
AhFAD2B-T:5 '-GAATCATAGTGAGGCAATGATGCCTA -3 '；
(3) primer pair of fragment amplification of the design to AhFAD2B wild type and mutated genes including the site 814bp
AhFAD2B-Fo/AhFAD2B-Ro,
AhFAD2B-Fo:5 '-CATATCTGCTATATCACATAGCAACTT -3 '；
AhFAD2B-Ro:5 '-GGCTTCTCTCCACAATGCTTTGTAAAC -3 '.
It is including following using the PCR detection method of the PCR primer of the detection high oleic acid peanut FAD2B mutated-genotype
Step:
(1) PCR amplification:
PCR reaction system: genomic DNA template 1 μ L, 2 10 × Buffer of μ L, the 1.5 μ L MgCl of the L of μ containing 20ng/2、
2 μ L of dNTP of 2.5mM each, 0.5U each 1.0 μ L of 0.3 μ L of Taq enzyme, AhFAD2B-C and AhFAD2B-T primer,
AhFAD2B-Fo and AhFAD2B-Ro primer each 0.1 μ L, 11 μ L ddH2O；
PCR amplification program: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C of extension 1min10s, altogether
35 circulations；72 DEG C of extension 10min；
(2) electrophoresis detection: by amplified production detected through gel electrophoresis, the corresponding genotype of sample is obtained.
The PCR primer is in the high oleic acid peanut product containing the mutational site AhFAD2B homologous gene nucleotide sequence C814T
Application in kind (being) breeding.
The beneficial effects of the present invention are:
The mutant nucleotide sequence of peanut high-oil mutant polynucleotides oleic acid dehydrogenase gene of the invention, can using hybridization,
Mutant nucleotide sequence is imported the peanut varieties (being) of other common oleic acid contents by the plants conventional breeding methods such as backcrossing, is improved
Import the oleic acid content of AhFAD2B-814 gene mutation nucleotide sequence target variety (being), hence it is evident that increase high oleic acid peanut product
The genetic diversity of kind (being), widens the hereditary basis of high oleic acid peanut.In high oleic acid peanut breeding, it can be taken by selection
Peanut material with AhFAD2A mutated-genotype is parent, keeps the high oleic acid character determination of breeding progeny more purposive, and mention
The frequency of occurrences of high objective trait.
The application study of arachic acid dehydrogenase gene mutant nucleotide sequence of the invention include but are not limited to basis
The sequence signature that the present invention studies designs molecular labeling, detects the presence of peanut high-oleic acid novel mutation gene；And with the gene
Mutant nucleotide sequence carrier construction cultivates high oleic acid peanut varieties by transgenic method.
Compared with prior art, the present invention has following advantages and effect:
(1) gene of the present invention is the cultigen peanut for studying discovery, report different from the past for the first time in the world
AhFAD2B gene New-mutant.There is presently no the His272 site mutation that report shows the FAD2B from cultigen peanut,
Meeting is so that peanut generates high oleic acid phenotype.Theoretically illustrate that the regulation of oleic acid content of peanuts exists by the research to the gene
A kind of new mechanism can play a significant role from practice to improving oil crops oleic acid content, improveing oil quality.
(2) mutational site of the present invention is the peanut high-oleic acid position with independent intellectual property rights of China's recent studies on
Point has broken the situation that the peanut high-oil acid gene applied at present in China is introduced mainly by foreign countries.
(3) oleic acid content of peanuts of the mutational site instruction is higher, and AhFAD2A mutated gene and peanut of the invention are high
Oleic acid new A hFAD2B-814 mutated gene exists simultaneously, and oleic acid content is more than previous disclosed other positions of peanut up to 85%
Point or the corresponding oleic acid content of molecular labeling.
(4) it by Molecular Detection targeted mutagenesis site, precisely can efficiently screen with high oleic acid content character
Peanut varieties (are).
The present disclosure additionally applies for based on the mutated gene molecular labeling and gene functional research and peanut high-oleic acid educate
Kind and transgenic research etc..
Detailed description of the invention
Fig. 1 is common oleic acid content kind (Ji spends No. 6, oleic acid content 43.56%) peanut oil fatty acid gas chromatogram.
Fig. 2 is F435 type mutant strain (KX016, oleic acid content 79.37%) peanut oil fatty acid gas chromatogram.
Fig. 3 is novel high oleic acid mutant (HZY-2 i.e. C814T, oleic acid content 85.58%) peanut oil fatty acid gas phase color
Spectrogram.
Fig. 4 is peak figure at AhFAD2A gene sequencing partial sequence 441_442.
Fig. 5 is peak figure at AhFAD2B gene sequencing nucleic acid sequence 448bp.
Fig. 6 is peak figure at AhFAD2B gene sequencing nucleic acid sequence 814bp
Fig. 7 be Ji spend No. 6, KX016, novel high oleic acid peanut mutant C814T AhFAD2A gene coding amino acid
Sequence alignment.
Fig. 8 be Ji spend No. 6, KX016, novel high oleic acid peanut mutant C814T AhFAD2B gene coding amino acid
Sequence alignment.
Fig. 9 is the gas chromatogram of saccharomyces cerevisiae total fatty acids ingredient, negative control, empty carrier pYES2.0 transformant.
Figure 10 is the gas chromatogram of saccharomyces cerevisiae total fatty acids ingredient, positive pYES/AhFAD2B transformant.
Figure 11 is the gas chromatogram of saccharomyces cerevisiae total fatty acids ingredient, positive pYES/AhFAD2B-814 transformant.
Figure 12 is that AhFAD2 gene nucleotide mutational site special primer in the common oleic acid peanut varieties of wild type (spends 5 in Ji
Number, Ji Hua 6 and the Weihe River spend No. 18) and high oleic acid mutant (C814T) in amplification situation.
Figure 13 is the special primer of the mutational site C814T AhFAD2B-814 in the amplification being bred as in high oleic acid peanut varieties
Situation.
Wherein,
In Fig. 1-3, C16:0 is palmitinic acid, and C18:0 is stearic acid, and C18:1 is oleic acid, and C18:2 is linoleic acid, and C20:0 is
Arachidic acid, C20:1 are arachidic acid monoenoic acid, and C22:0 is behenic acid, and C24:0 is lignin acid；
In Fig. 4-6, arrow and digital representation mutation differences site and its position；
In Fig. 7-8, KX016 protein sequence is gap, terminates translation in advance because its encoding gene is there are insertion mutation；
Wild-type amino acid, the F435 type amino acid of mutating acid and corresponding gene are indicated in box, top line is consistent
Sequence, the number identified thereon are amino acid position of the amino acid residue in corresponding gene coding region；
In Fig. 9-11, C16:0 is palmitinic acid；C16:1 is palm monoenoic acid；C18:0 is stearic acid；C18:1 is oleic acid；
C18:2 is linoleic acid；C18:3 is linolenic acid；
In Figure 12, M indicates DNA molecular amount standard, segment from top to bottom as 2000,1000,750,500,250,
100bp.Number a, b, c, d, e, f, g, h respectively indicate different loading wells, the DNA profiling and primer pair that 8 loading wells use
It assembles different；The template of a and e is that Ji spends No. 5, and the template of b and f are that Ji spends No. 6, and the template of c and g are that the Weihe River spends No. 18, d and
The template of h is C814T；The primer sets used are respectively as follows: a, b, c, d for specific amplification AhFAD2A genetic fragment
AhFAD2A-Fo, AhFAD2A-Ro, AhFAD2A-G and AhFAD2A-A；E, f, g, h are specific amplification AhFAD2B genetic fragment
AhFAD2B-Fo, AhFAD2B-Ro, AhFAD2B-C, AhFAD2B-T primer combination；
In Figure 13, M indicates DNA molecular amount standard, segment from top to bottom as 2000,1000,750,500,250,
100bp；Number 1-24 respectively indicates different loading wells, wherein 1,2 be respectively that No. 6 and positive control are spent in negative control Ji
C814T mutant, 3 be H2The gene of the high oleic acid peanut varieties (being) of incubation is respectively adopted in O negative control, 4-24 loading wells
Group DNA profiling is followed successively by Ji and spends No. 11 (Ji Ke is at a turn mirror words (2013) the 2-002nd), (the state's tasting peanut of Ji Hua 13
2014005), Ji Hua 16 (peanut 2015006 is judged by state), No. 19 Ji Hua 18 (peanut 2016009 is judged by state), Ji Hua (states
Tasting peanut 2016004), Hua Yu 51 (Anhui tasting step on word the 1205005th), Hua Yu 52 (word the 1205006th is stepped in Anhui tasting), Hua Yu
(word the is stepped in Anhui tasting by 661 (Anhui tasting step on word the 1405002nd), Hua Yu 662 (word the 1305001st is stepped in Anhui tasting), Hua Yu 917
1505012), Hua Yu 951 (word the 1305019th is stepped in Anhui tasting), Hua Yu 957 (word the 1505024th is stepped in Anhui tasting), the 958 (Anhui Hua Yu
Tasting step on word the 1505025), Hua Yu 961 (word the 1305010th is stepped in Anhui tasting), Hua Yu 963 (word the 1505029th is stepped in Anhui tasting),
Agriculture 61 (Henan is examined and spends 2012001) is opened, agriculture 71 (Henan is examined and spends 2015002) is opened, opens agriculture 176 (Henan is examined and spends 2013002), opens agriculture 1715
(Henan examine spends 2014002), Henan spend 37 (Henan is examined and spends 2015011), middle spend 24 (peanuts 2015007 are judged by state).All loading wells make
Primer sets be specific amplification AhFAD2B-814 mutation AhFAD2B-Fo, AhFAD2B-Ro, AhFAD2B-C and
AhFAD2B-T。
Specific embodiment
The present invention changes the expression of oleic acid dehydrogenase (FAD2) gene according to the existing result of study of high oleic acid oil crops
Level makes a significant impact the oleic acid content of oil crop seeds.It is generally acknowledged that AhFAD2 gene is in control peanut seed
One of important candidate gene of oleic acid content height.It is carried out on the accurate evaluation of foundation of phenotype to the vast resources material of collection,
It is combined by near-infrared attribute test with gas chromatographic detection, identifies high oleic acid peanut mutant single plant；Pass through single plant
Inbreeding of more generation, offspring's separation, the homozygous lines of acquired character stable and consistent；Pass through AhFAD2A and AhFAD2B gene cloning and survey
Sequence analysis, excavates out new mutational site；By with high yield, high-quality, resistance mixing breed, specifically drawn using mutational site
Object alternatively marks, and carries out the selection of offspring's high oleic acid single plant directed tracing, obtains high oleic acid new peanut variety (being).
Technical solution of the present invention is further elaborated below with reference to embodiment and Figure of description, the following example is only
For illustrating the present invention, but it is not used to limit the scope of the invention.In embodiment unless otherwise specified, according to normal conditions or
The condition of person manufacturer specification suggestion carries out.Production firm person is not specified in agents useful for same or instrument, and being can be with market
The conventional products purchased.
Embodiment 1: the screening and purifying of high oleic acid peanut mutation single plant
By 220 parts of groundnut germplasm materials of collection and the plantation of 150 parts of germplasm of initiative in crop field, by material plant at
Row, monoseeding, selfing after ripening harvest harvest seed by single plant；2nd year each material selection, 3 single plants, thin planting is at plant
It plants in crop field, selfing single plant is harvested again according to single plant, is peeled off after seed natural air drying, (Perten) is led to using wave
DA7200 diode array near-infrared analyzer detects the content of fatty acid of each single-strain seed, filters out single plant oleic acid in plant and contains
Amount is at plant 9 of 70% or more.
It is formed using the fatty acid that U.S.'s Agilent 6890A gas chromatographicanalyzer further accurately detects these plants
And content, steps are as follows:
(1) appropriate full peanut seed is selected, grind into powder weighs about 40-50mg in 2mL centrifuge tube, is added
0.95mL chromatographically pure n-hexane, ultrasonic wave 20min take out and add 0.95mL n-hexane, are uniformly mixed, and 14000rpm is centrifuged 10min,
Take supernatant spare.
(2) 500 μ L of Aspirate supernatant is added in 2mL centrifuge tube, adds 500 μ L 0.4mol/L KOH- methanol, mixes,
During which 60 DEG C of water-bath 20min are mixed 4 times reverse.
(3) it takes out sample and is cooled to room temperature, 600 μ L 0.9%NaCl aqueous solutions are added in every pipe, mix, 14000rpm centrifugation
10min takes 300 μ L of supernatant in upper sample bottle, while 300 μ L n-hexanes are added, and mixes and carries out gas chromatographic analysis.
(4) attached FID flame ionization ditector is used, chromatographic column HP-5 5%Phenyl Methyl Siloxane:
30m × 320 μ of μ × 0.25,250 DEG C of injector temperature, column flow 0.7mL/min, split ratio 20:1.Temperature program: post case is initial
Temperature is 150 DEG C, rises to 220 DEG C with 3 DEG C/min, keeps 15min.250 DEG C of FID temperature, detector gas hydrogen 30mL/
Min, air 400mL/min, tail nitrogen blowing 25mL/min, 2.0 μ L of sample volume.
Single plant 2 of 80% or more oleic acid content are finally identified, number is HZY-1 and HZY-2 respectively.
Measure the fatty acid that common oleic acid kind Ji spends No. 5 and No. 6 and F435 type high oleic acid mutant KX016 are spent in Ji
Content, comparison result are as shown in table 1.
1 different peanut varieties of table (are) main fatty acid relative amount (%)
Seen from table 1, the oleic acid content of HZY-2 ratio HZY-1 is high by 10.14%, and than KX016, Ji Hua No. 5 numbers and Ji spends No. 6
Oleic acid content difference is high by 7.83%, 96.46% and 83.85%.Spend the rouge of No. 6, KX016 and HZY-2 in gas chromatograph test Ji
Fat sour component peak figure is as shown in Figs. 1-3.
Embodiment 2: the mutant nucleic acid sequence clone of high oleic acid arachic acid dehydrogenase gene and sequencing
(1) determine and obtain the candidate gene of peanut high-oleic acid character.
The biological approach of vegetable fatty acid synthesis is relatively clear.Existing research confirms that oleic acid biosynthesis has two
Approach: first is that using stearic acid as substrate, oleic acid is generated under stearoyl-CoA desaturase (SAD) catalysis, which is oil
The main path of acid synthesis；Second is that carbochain is further extended under acyl-CoA effect, is generated using palm monoenoic acid as substrate
Oleic acid.Oleic acid a part of synthesis, which is integrated on the carbon skeleton of triglycerides, becomes final shelf stability grease, and a part is in oleic acid
Dehydrogenation is further formed the linoleic acid with double unsaturated bonds under the action of dehydrogenase, and there are also sub-fractions to extend enzyme in carbochain
Effect is lower to generate eicosenoic acid.In addition, by obtaining high oleic acid peanut to high oleic acid oil crops and using RNAi method
Research also indicates that the expression for changing FAD2 gene can make a significant impact the oleic acid content of peanut.Therefore, can recognize
It is one of the important candidate gene for controlling oleic acid content of peanuts for peanut FAD2 gene.In turn, by cloning common oleic acid content
FAD2 gene in peanut varieties, F435 type high oleic acid strain and above-mentioned 2 excavated high oleic acid peanut single plant is verified
The difference site that may be present in FAD2 gene order HZY-1 and HZY-2.
(2) high oleic acid peanut mutant AhFAD2 gene cloning.
It is existing studies have shown that there are 2 AhFAD2 allele, i.e. AhFAD2A and AhFAD2B in Peanut genome,
Respectively from peanut A genome and 1 B gene group.Utilize AhFAD2A and AhFAD2B gene order known in ncbi database.
By the way that listed AhFAD2 gene order is compared, find the sequence identity obtained up to 98% or more, AhFAD2A and
Before the main distinction between AhFAD2B gene is the latter's initiation codon there are about 8 base deletions in the place -70bp, and should
Gene internal intronless, therefore can be designed in the different regions of gene coding region two sides and can distinguish specific amplified AhFAD2A
With the PCR primer of AhFAD2B full length gene, PCR amplification is carried out using genomic DNA as template to clone AhFAD2A and AhFAD2B
Coding sequence overall length.Its forward primer AhFAD2A-F:5 '-GATTACTGATTATTGACTTGCTTTG -3 ',
AhFAD2B-F:5 '-CAGAACCATTAGCTTTGTAGTAGTG -3 ', general reverse primer are AhFAD2-R:5 ' -
CTCTGACTATGCATCAGAACTTGT—3′。
It studies high oleic acid single plant HZY-1 and HZY-2, KX016 and Ji that the material used is above-mentioned excavation and spends No. 6.Using
CTAB method extracts seedling leaves genomic DNA, according to the operation of Murray and Thompson (1980) and makees to simplify, step is such as
Under:
(1) in 2mL centrifuge tube, the 2%CTAB buffer of 800 μ L and the beta -mercaptoethanol of 30 μ L, 65 DEG C of preheatings are added.
(2) take young leaflet tablet 1-2g, it is clean with distilled water flushing, then with sterilizing ddH2O is rinsed 2 times, is put into pre- through liquid nitrogen
In cold mortar.Liquid nitrogen grinding is added to powdered, with clean sterilizing stainless steel spoon transfer of powders into the centrifuge tube of preheating,
Total volume reaches 1mL, after mixing well on turbula shaker, is placed in 65 DEG C of water-baths and keeps the temperature 30-60min, frequently gently
Rotate centrifuge tube for several times.
(3) 13000rpm is centrifuged 15min under the conditions of 4 DEG C, and Aspirate supernatant is into another new centrifuge tube.
(4) 3 μ L RNase (10mg/mL), 37 DEG C of heat preservation 30-60min are added.
(5) isometric chloroform/isoamyl alcohol (24:1) is added, is gently mixed by inversion 10min, 13000rpm is centrifuged at 4 DEG C
10min moves supernatant into another new centrifuge tube.
(6) isometric chloroform/isoamyl alcohol (24:1) is added in supernatant again, is lightly mixed by inversion 10min, 4
13000rpm is centrifuged 10min at DEG C, moves supernatant into another new centrifuge tube.
(7) the 3M NaAc (4 DEG C pre-cooling) of 1/10 volume is added, after mixing gently, be added 2 times of volumes 100% ethyl alcohol or
0.7 times of volume isopropanol (- 20 DEG C of pre-coolings), it may appear that flocculent deposit, -20 DEG C of placement 30-60min or -80 DEG C of placement 10min,
12000rpm is centrifuged 10-15min, recycling DNA precipitating.
(8) precipitating is cleaned 2 times with 70% ethyl alcohol, appropriate sterilizing ddH is dissolved in after drying2In O or TE, 37 DEG C of placement 20-
30min is completely dissolved DNA precipitating.
(9) genomic DNA integrality is detected with 0.8% agarose gel electrophoresis.Utilize EpochTM Microplate
Spectrophotometer detects genomic DNA concentration and quality.
(10) 5 μ L stostes are taken out, are uniformly diluted to 20ng/ μ L as working solution.
Using the peanut genome of extraction as template, PCR is carried out using the primer pair of design and clones 4 peanut materials
AhFAD2A and AhFAD2B gene.By Beijing Quanshijin Biotechnology Co., Ltd TransStart FastPfu DNA
Polymerase specification configures 20 μ L PCR reaction systems: 2 × PCR Mix 10 μ L, forward and reverse each 1 μ L of primer, genome
DdH is added in 1 μ L of DNA profiling2O to 20 μ L.In Bio-Rad T100TMIt is expanded in PCR instrument, expands the anti-of AhFAD2A gene
Answer program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 1min10s, totally 30 recycle；72
DEG C extend 10min.The annealing temperature for expanding AhFAD2B gene is 50 DEG C, the same AhFAD2A of other programs.
Amplified production is separated with 1% agarose gel electrophoresis, using Omega E.Z.N.A.Gel Extraction Kit
DNA fragmentation recycling and purifying are carried out, operating procedure is carried out by kit operating instruction.With putting down for Beijing Tiangeng biotech company
After end adds " A " reaction kit progress PCR product that " A " is added to react, it is connected to gene clone carrier pMD19-T Simple
Vector (is purchased from Dalian TaKaRa Bioisystech Co., Ltd), the heat-shock transformed Escherichia coli of connection product (E.coli) competence
Cell Trans5 α Chemically Competent Cell (is purchased from Beijing Quanshijin Biotechnology Co., Ltd).Added with
IPTG, X-Gal, ampicillin Amp LB solid medium on carry out blue hickie screening, identify positive single colonie through PCR, often
A each 30 positive colonies of picking of peanut material send Hua Da Gene science Services Co., Ltd to be sequenced.
(3) peanut AhFAD2 Homologous gene sequences are analyzed.
Sequencing fragment uses Lasergene Seqman Pro (DNAStar) (http://www.DNAStar.com) software
It is assembled, finally obtains 120 full length gene sequences.Sequence analysis is carried out using 10 software of Geneious Pro.It selects
Common oleic acid peanut varieties Ji spends No. 6 Homologous gene sequences as reference sequences, and comparison result is as Figure 4-Figure 6, shows 3
Base replacement G > occurs at the 448bp of code area for the AhFAD2A gene of high oleic acid peanut material HZY-1 and HZY-2, KX016
A makes corresponding the 150th residue of protein sequence be changed into asparagine (N) by aspartic acid (D).AhFAD2B gene is in 3 height
Candidate difference site performance is different in oleic acid material, and wherein KX016 and HZY-1 is after initiation codon between 441bp and 442bp
It is inserted into single base A (441_442insA), causes frameshift mutation, reading frame is made termination codon occur for 495 after initiation codon
Son；And single base replacement C > T occurs at the 814bp of code area for the mutational site of HZY-2, makes corresponding protein sequence
272 residues are changed into tyrosine (Tyr, Y) by histidine (His, H), therefore the mutated gene is named as AhFAD2B-814,
The high oleic acid peanut mutant HZY-2 for carrying the gene is named as C814T.
AhFAD2B-814 site mutation causes the position of amino acid mutation as Figure 7-8.Peanut AhFAD2B gene is non-
Often conservative, other than above-mentioned difference site, other nucleotide sequences of the surveyed peanut material gene do not have difference.
Embodiment 3: expression and functional analysis of the high oleic acid peanut AhFAD2B novel mutation gene in saccharomyces cerevisiae
Above-mentioned peanut AhFAD2 gene category endoplasmic reticulum oleic acid dehydrogenase, host's first choice of functional analysis is yeast, because
Electron transport system needed for containing such dehydrogenase in yeast and suitable membrane environment, and saccharomyces cerevisiae (Saccharomyces
Cerevisiae) due to lacking Δ 12 (ω -6) and omega-fatty acid dehydrogenase, endogenous polyunsaturated fatty acid cannot be generated, carefully
Intracellular fatty acid ingredient is simple, is the optimal expression system of Exogenous fatty dehydrogenase gene.INVScI/pYES2.0 is normal
Express the Saccharomyces Serevisiae Expression System of Exogenous fatty acidohydrogenase.
According to the multiple cloning sites of saccharomyces cerevisiae expression pYES2.0, respectively primer 5 ' end introduce KpnI and
The restriction enzyme site of EcoRI designs AhFAD2 gene specific primer, wherein forward primer pF1:5 '-
GGTACCATGGGAGCTGGAGGGC -3 ', reverse primer pR1:5 '-GAATTCTCAGAACTTGTTCTTGTAC -3 '.Using
The target gene monoclonal bacterium solution of acquisition is template, with pF1-pR1 primer pair PCR amplification target gene code area, reaction system:
DdH is added in 2 × PCR Mix 10 μ L, forward and reverse each 1 μ L of primer, 1 μ L of DNA profiling bacterium solution2O to 20 μ L.Amplification program are as follows: 94
DEG C initial denaturation 5min；94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 30 recycle；72 DEG C of extension 5min.Amplification
It after product purification, digests through restriction enzyme KpnI and EcoRI, is connect with through the postdigestive pYES2.0 of same enzyme, respectively structure
Build up Yeast expression carrier pYES2/AhFAD2A and pYES2/AhFAD2B.The carrier of building is correct through sequencing and digestion verification
It is inserted into pYES2.0.In addition, using pYES2.0 empty carrier as negative control, by connection product and negative control vector plasmid each 10
μ L is added to INVScI saccharomycete (MAT α his3- Δ 1leu2trp1-289ura3-52, the Invitrogen company) sense prepared
It by state cell, mixes, stands 5min on ice, 30 DEG C of recovery 2-3h of sorbierite of 1mL pre-cooling, centrifugation is added in 1500V electrotransformation
It is coated with the MD plate containing 0.05%His and 0.01%Trp and Leu, 30 DEG C of culture 3d afterwards.The positive monoclonal of inoculated identification is extremely
In MD (containing 0.05%His and 0.01%Trp and Leu) culture medium, 30 DEG C are incubated overnight.Strain inoculated will be incubated overnight to arrive
In MD culture medium of the 50mL containing 2% galactolipin in 250mL triangular flask, the method with reference to shown in Invitrogen company operation manual
OD600 is set to reach 0.4.Under the conditions of 30 DEG C and 120rpm after Fiber differentiation 72h, 10min is centrifuged with 2000 × g, discards supernatant liquid,
It is washed with deionized 2 times, then washs 2 times with petroleum ether-ether (1:1) and remove the fatty acid adhered on thallus.By cell
1M methanolic hydrochloric acid is added after freeze-drying, isometric petroleum ether-ether (1:1) is added after 80 DEG C of reaction 3h.Using gas-chromatography
Method analyzes sample fatty acid composition and content.
The sub- fatty acid compositional analysis of 2 Saccharomyces cerevisiae transformant of table
Fig. 9-11 be separate sources peanut AhFAD2 gene expressed in saccharomyces cerevisiae, cause yeast body fat acid at
Divide the gas chromatographic analysis figure with changes of contents.All have C16:2's and C18:2 in the fatty acid chromatogram of positive transformant
Specific fats acid peak, and illustrate this then without this 2 specific fats acid peaks in the chromatography of negative control pYES2.0 transformant
A little FAD2 are provided with oleic acid dehydrogenase function, but peanut AhFAD2A and AhFAD2B saltant type and wild type in yeast system
Gene encoding enzyme catalysis generates linoleic amount and has differences, and specific value is as shown in table 2, wherein transformant pYES2/
The linoleic acid content of AhFAD2B-814 is only the 50.5% and 46.5% of wild type AhFAD2A and AhFAD2B gene transformants,
Reduce by 3.82% and 24.30% respectively than F435 type AhFAD2A and AhFAD2B mutated gene transformant linoleic acid content.In addition,
Desaturation rate is to measure the important indicator of dehydrogenase activity, desaturation rate (%)=product assay/(product assay+substrate content)
× 100%.In this research wild type AhFAD2A and AhFAD2B, F435 saltant type AhFAD2A-448 and AhFAD2B-442 and
In the yeast transformant of novel mutation AhFAD2B-814 gene the dehydrogenation desaturation rate of C18:1 be respectively 20.20%,
21.35%, 10.32%, 13.49%, 9.50%, illustrate the saltant type AhFAD2B dehydrogenase activity of the coding of AhFAD2B-814
It is minimum.Therefore, the novel high oleic acid peanut mutant C814 mutated gene AhFAD2B-814 that we study is reducing oleic acid to Asia
Even more important effect is played in the catalytic activity of oleic acid.
Embodiment 4: the correlation analysis in high oleic acid the peanut mutational site mutant C814T and high oleic acid content
(1) building of oleic acid content F2 segregating population and the measurement of group's single plant oleic acid content.
By the high oleic acid peanut mutant C814T that will be excavated and common oleic acid content mixing breed, offspring is selfed
Obtain F2 trait segregation single plant.Specifically: it is male parent that high oleic acid mutant C814T is utilized in peanut florescence in June, 2015, point
Do not spend No. 6 with common oleic acid content kind Ji and the Weihe River spend No. 18 to assemble cross combination, using set fossil fragments hybridization pollination technology into
Row sexual hybridization, current year 10 months at the beginning of harvest allocarpy (F0), obtain the hybrid seed of different genetic backgrounds, " Ji spend No. 6 ×
C814T " combination obtains 26 allocarpies (44 seeds), and " spending No. 18 × C814T in the Weihe River " combination obtains 43 allocarpy (71 kinds
Son).In May, 2016 3502 farm peanut breeding base of Shijiazhuang Luquan area plant F1, monoseeding, self propagated,
Puppet hybrid strain is eliminated, subassembly is harvested by single plant after mid-September current year is mature, and any selection is not done, is dried respectively, 2 combinations point
It Huo get not 38 and 62 single plants.Plant F1 single-strain seed in May, 2017 respectively by plant, monoseeding is not done any after mature
Selection is still harvested by single plant, and 2 combinations obtain 1071 and 1835 single plants respectively.
After 2 cross combination F2 single plant pods are peeled off, the full seed benevolence of each single plant is chosen respectively, using DA7200 near-infrared
Its content of fatty acid of analyzer small sample looping test.Group F2 single plant oleic acid content test result is as shown in table 3.
Table 3 " spending No. 6 × C814T in Ji " (F2-A) and " spending No. 18 × C814T in the Weihe River " (F2-B) F2 single plant oleic acid content
(2) new mutation site and oleic acid content relevance verification
According to group's test result, the individual of two kinds of extreme phenotypes of high level and low value is selected from above 2 groups respectively
Phenotype group is formed, that is, selects highest single plant (oleic acid content is 80% or more) building in respective combination of 10 oleic acid contents
High oleic acid phenotype group chooses 10 minimum single plants of oleic acid content (oleic acid content is below 43%) and forms low oleic acid phenotype
Group.It takes 5 to germinate in incubator at random from the single-strain seed of selection respectively and obtains single-strain blade, mix blade by single plant
It is ground in liquid nitrogen, genomic DNA is extracted using modified CTAB method, with primer pair AhFAD2A-F/AhFAD2-R and AhFAD2B-F/
AhFAD2-R carries out AhFAD2A the and AhFAD2B gene order of each single plant of PCR amplification, and it is complete that cloning and sequencing obtains gene coding region
Long sequence.
The sequence of acquisition is compared, as a result, it has been found that, in the high oleic acid phenotype group single plant of 2 different genetic backgrounds and low
Occur identical difference site, the i.e. position 448bp of the AhFAD2A gene of high oleic acid phenotype group single plant in oleic acid phenotype group single plant
Point is A, and is G at the site 448bp of the AhFAD2A gene of low oleic acid phenotype group single plant；High oleic acid phenotype group single plant
The site 814bp of AhFAD2B gene is T, and is at the site 814bp of the AhFAD2B gene of low oleic acid phenotype group single plant
C.It can be seen that the T in 814 site of A and AhFAD2B gene in the site high oleic acid phenotype group AhFAD2A gene 448bp is high level
The high level genotype of phenotype group, and low oleic acid phenotype group does not have the genotype.It to sum up analyzes, AhFAD2B gene C 814T is
The specific mutation sites of high oleic acid single plant.
The special primer exploitation and application in the mutational site embodiment 5:AhFAD2B-814
For the relationship of precise Identification C814T mutant AhFAD2B gene mutation site and high oleic acid character, we according to
There are the sequence signature in 2 mutational sites in AhFAD2A and AhFAD2B gene order, 2 genes of detection respectively have been designed and developed
The special primer in group homologous gene mutational site accurately to carry out genotype identification.
The primer for detecting AhFAD2A gene G448A mutation of design is as follows:
AhFAD2A-Fo:5 '-AGTGAGAATGCAGCCTTGGATG -3 '
AhFAD2A-Ro:5 '-TGTGAGTGTGATGAAGAGGGAG -3 '
AhFAD2A-A:5 '-ACCGGTTCCCTCGACCTCA -3 '
AhFAD2A-G:5 '-GGTTTTGGGACAAACACTTCTTC -3 '
The primer for detecting AhFAD2B gene C 814T mutation of design is as follows:
AhFAD2B-Fo:5 '-CATATCTGCTATATCACATAGCAACTT -3 '
AhFAD2B-Ro:5 '-GGCTTCTCTCCACAATGCTTTGTAAAC -3 '
AhFAD2B-C:5 '-AGTTACCATAACCTATTTGCAGCACAAAC -3 '
AhFAD2B-T:5 '-GAATCATAGTGAGGCAATGATGCCTA -3 '
Wherein AhFAD2A-Fo/AhFAD2A-G primer pair can the site 448bp alkali to peanut AhFAD2A wild type gene
Base G carries out specific PCR amplification, amplified fragments 210bp；AhFAD2A-A/AhFAD2A-Ro primer pair can be mutated AhFAD2A
The site the 448bp base A of type gene carries out specific PCR amplification, amplified fragments 120bp；AhFAD2A-Fo/AhFAD2A-Ro draws
Object pairing energy carries out specific PCR amplification to the segment of AhFAD2A wild type and mutated genes including the site 448bp, expands
Increasing segment is 267bp, which actually plays the role of positive control, can reduce the amplification of non-specific PCR product and draw
Object dimer is formed.The genomic DNA template 1 μ L of pcr amplification reaction system 20 μ L: the L containing μ containing 20ng/, 2 μ L 10 ×
Buffer、1.5μL MgCl2, dNTP2 μ L of 2.5mM each, 0.5U 0.3 μ L of Taq enzyme, AhFAD2A-A and AhFAD2A-G
Each 1.0 μ L of primer, AhFAD2A-Fo and AhFAD2A-Ro primer each 0.1 μ L, 11 μ L ddH2O.The above amplification AhFAD2A gene
The response procedures of specific fragment are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C of extension 1min10s,
Totally 35 circulations；72 DEG C of extension 10min.Amplification AhFAD2B gene specific mutational site primer is equally assembled, wherein AhFAD2B-
C/AhFAD2B-Ro primer pair can the site 814bp base C to AhFAD2B wild type gene carry out specific PCR amplification, expand piece
Section is 280bp；AhFAD2B-Fo/AhFAD2B-T primer pair can the site 814bp base T to peanut AhFAD2B mutated genes
Carry out specific PCR amplification, amplified fragments 145bp；AhFAD2B-Fo/AhFAD2B-Ro primer pairing energy is wild to AhFAD2B
The segment of type and mutated genes including the site 814bp carries out specific PCR amplification, amplified fragments 371bp, as the positive
Control.PCR reaction system is same as above, but primer pair uses a fragment-specific primer of the present invention.It is special to expand AhFAD2B gene
The response procedures of heteroleptic are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C of extension 1min10s, altogether
35 circulations；72 DEG C of extension 10min.
The 3 pairs of primer pairs separately constituted with 4 primer strands of above-mentioned amplification A genome and 1 B gene group can be anti-in 1 PCR
It is expanded in answering (nest-type PRC), amplified production detected through gel electrophoresis, that 2 bands occur is homozygous (G/G, A/A, C/C
Or T/T), that 3 bands occur is heterozygous (G/A or C/T).
As Ji that Figure 12 is the tool wild type AhFAD2 of the common oleic acid content of above 6 pairs of primer pairs spend No. 5, Ji Hua 6 and
Spend the result of No. 18 and high oleic acid mutant C814T genomic DNA progress PCR amplifications in the Weihe River.In figure 12 it can be seen that
AhFAD2A-Fo/AhFAD2A-G and AhFAD2B-C/AhFAD2B-Ro primer pair is only capable of expanding shaping to wild type (spending No. 6 in Ji)
Band shows that it is respectively G and C base at the site 448bp of AhFAD2A and the site 814bp of AhFAD2B；AhFAD2A-A/
AhFAD2A-Ro and AhFAD2B-Fo/AhFAD2B-T primer pair is only capable of to band at saltant type (C814T) amplification, show its
It is respectively A and T base at the site 448bp of AhFAD2A and the site 814bp of AhFAD2B；AhFAD2A-Fo/AhFAD2A-Ro
With AhFAD2B-Fo/AhFAD2B-Ro primer pair as positive control, band can be amplified in all material.To sum up table
It is bright, compared with the common oleic acid content peanut varieties of wild type, with special at 814bp in high oleic acid mutant 1 B gene group
There are T bases at point.We, which successfully have developed, as a result, is directed to containing AhFAD2B-814 novel mutation site and exists simultaneously
The high oleic acid peanut genotype of AhFAD2A-448 mutation detects special primer.
Using the above-mentioned primer pair for mutational site, large-scale molecular has been carried out to the genotype of F2 group single plant
Identification, therefrom identifies single plant 75 (F2-A) and 128 (F2-B) of specific site homozygosis.Through Chi-square Test, meet 2 pairs it is hidden
Property gene control Heredity, i.e., F2 double recessive homozygote (aabb) segregation ratio be 15:1.
The primer pair can be used for Large-scale Screening high oleic acid single plant, while can also gather microarray gel electrophoresis technology, make
Detection efficiency improves, and realizes the high-throughput detection of base mutation, greatly improves the accuracy of high oleic acid peanut breeding Characters Identification,
Accelerate breeding process, provides reliable technological means for molecular marker assisted selection high oleic acid filial generation.
Embodiment 6: the verifying of filial generation single plant Genotyping and oleic acid content
Contained using the common oleic acid that the site gene 448bp AhFAD2A and the site AhFAD2B gene 814bp are wild type
Amount peanut varieties Ji spends No. 5 to assemble cross combination " spending No. 5 × C814T in Ji " with novel high oleic acid peanut mutant C814T, uses
The method of pedigree method selection and strange land south numerous added-generation obtains F3:4 progeny population, which includes 602 single plants.Using near-infrared
Spectrometer measures the fatty acid relative amount of single plant full seed, extracts single plant genomic DNA using CTAB method, is set using above-mentioned
8 primer sets for oleic acid dehydrogenase gene mutational site of meter carry out PCR amplification with 6 pairs of primer pairs, according to amplification
Banding pattern determines AhFAD2A the and AhFAD2B genotype of single plant.Genotype is compared with oleic acid content and is listed in table 4.
By 4 result of table it was found that (1) is under the various backgrounds of AhFAD2A, the mutational site AhFAD2B-814 is oily with height
Acid shape is highly relevant, as under aa background AhFAD2B genotype from BB, Bb to bb, oleic acid content respectively from 40.83%,
50.59% increases 66.39%；(2) under same AhFAD2A background, the mutational site AhFAD2B-814 homozygote single plant oleic acid contains
Amount is greater than heterozygote oleic acid content, and the homozygote single plant oleic acid content that the site is not mutated is minimum；(3) AhFAD2A and
The mutational site AhFAD2B combined influence oleic acid content, with increasing for mutational site (base) number, oleic acid content also mentions therewith
The oleic acid of height, no mutation wild type (AA:BB) oleic acid content 34.81%, 1 base mutation (Aa:BB or AA:Bb) genotype contains
Amount average out to 35.79%, the oleic acid content average out to 41.40% of 2 base mutation (aa:BB, Aa:Bb or AA:bb) genotype,
The oleic acid content average out to 51.08% of 3 base mutation (aa:Bb or Aa:bb) genotype, all mutation (aa:bb) of 4 bases
Oleic acid content be 66.39%；(4) under the background that AhFAD2A or AhFAD2B have a side to mutate, AhFAD2B-814 is prominent
Become and the increase rate of oleic acid content be mutated higher than AhFAD2A-448, i.e., AA:bb genotype (oleic acid content 41.72%) is than aa:
High 2.19%, the AA:Bb genotype (36.42%) of BB genotype (40.83%) oleic acid content is compared with Aa:BB genotype (35.16%)
Oleic acid content is high by 3.57%.
The above result shows that the PCR genotyping result of AhFAD2B and oleic acid content variation are consistent, this hair is further demonstrated
Oleic acid content effect is obvious, and the mutational site the AhFAD2B-814 special primer of exploitation can to improving for the bright nucleotide site
To be used to refer to peanut high-oil acid content character.
Table 4 " spending No. 5 × C814T in Ji " offspring's single plant AhFAD2 gene nucleotide mutational site and oleic acid content correlation
Note: A and B respectively indicates AhFAD2A and AhFAD2B wild-type genotype；A and b respectively indicate AhFAD2A and
AhFAD2B mutated-genotype.
Embodiment 7: specificity analysis of the novel mutation site in existing high oleic acid peanut varieties
In order to confirm whether the mutational site AhFAD2B-814 has specificity in other peanut varieties, we are to come from
The genomic DNA of the high oleic acid kind of national difference peanut breeding unit breeding is template, is directed to the specific nucleotide with exploitation
The special primer in acid mutation site carries out PCR.In amplification procedure, No. 6 and H are spent with Ji2O is negative control, with mutant
C814T is positive control, and reaction system and reaction condition is arranged, and obtains expected amplification, as shown in figure 13.Show selecting
Do not occur the mutational site AhFAD2B-814 of the present invention in the 21 high oleic acid peanut varieties selected, further demonstrates this
It invents mutational site and is different from classical F435 type mutation, there is specificity.
SEQUENCE LISTING
<110>Food and Oil Crops Inst., Hebei Agriculture and Forestry Academy
<120>a kind of high oleic acid peanut mutated gene AhFAD2B-814 and application
<160> 15
<170> PstentIn version 3.5
<210> 1
<211> 1323
<212> DNA
<213> Arachis hypogaea
<400> 1
acggccgcca gtgtgctgga attgcccttc agaaccatta gctttgtagt agtgcaaagt 60
gctaactctt tctttctaca ttggtaacag gagctttaac aacacaacaa tgggagctgg 120
agggcgtgtc actaagattg aagctcaaaa gaagcctctt tcaagggttc cacattcaaa 180
ccctccattc agtgttggcc aactcaagaa agcaattcca ccacattgct ttgaacgttc 240
tcttttcata tcattctcat atgttgtcta tgatctctta atggcctact tactcttcta 300
cattgccacc acttatttcc acaagcttcc atacccattt tccttccttg cttggccaat 360
ctattgggcc atccaaggct gcattctcac cggtgtttgg gtgattgctc atgagtgtgg 420
ccaccatgcc ttcagcaagt accaacttgt tgatgacatg gttggtttga cccttcactc 480
ttgtctatta gttccttatt tctcatggaa aatcagccac cgccgccacc actccaacac 540
aggttccctc gaccgcgacg aagtgtttgt cccgaaacca aaatcaaagg tatcatggta 600
taacaagtac atgaacaatc caccagggag ggctatttcc cttttcatca cactcacact 660
aggatggccc ttgtacttgg ccttcaatgt ttctggcaga ccctatgata gatttgcaag 720
ccactatgac ccttatgctc ccatatactc taacagggaa aggcttctaa tttatgtctc 780
agattcatct gtctttgctg taacatatct gctatatcac atagcaactt tgaaaggttt 840
gggttgggtg gtatgtgttt atggggtgcc attgctcatt gtgaatgggt ttctagttac 900
cataacctat ttgcagcaca catatgcatc attgcctcac tatgattcat ccgaatggga 960
ctggttaaga ggagcattgg caacagtgga cagagattat gggatactga ataaggcatt 1020
tcatcatata actgatacgc atgtggctca tcatttgttc tcaacaatgc ctcattacca 1080
tgcaatggaa gcaaccaatg caataaagcc aatattgggt gattactacc aatttgatgg 1140
caccccagtt tacaaagcat tgtggagaga agccaaagag tgcctctatg tggagccaga 1200
tgatggagct tctcagaagg gtgtttattg gtacaagaac aagttctgat gcatagtcag 1260
agaagggcaa ttctgcagat atccatcaca ctggcggccg ctcgagcatg catctagagg 1320
gcc 1323
<210> 2
<211> 379
<212> PRT
<400> 2
Met Gly Ala Gly Gly Arg Val Thr Lys Ile Glu Ala Gln Lys Lys Pro
1 5 10 15
Leu Ser Arg Val Pro His Ser Asn Pro Pro Phe Ser Val Gly Gln Leu
20 25 30
Lys Lys Ala Ile Pro Pro His Cys Phe Glu Arg Ser Leu Phe Ile Ser
35 40 45
Phe Ser Tyr Val Val Tyr Asp Leu Leu Met Ala Tyr Leu Leu Phe Tyr
50 55 60
Ile Ala Thr Thr Tyr Phe His Lys Leu Pro Tyr Pro Phe Ser Phe Leu
65 70 75 80
Ala Trp Pro Ile Tyr Trp Ala Ile Gln Gly Cys Ile Leu Thr Gly Val
85 90 95
Trp Val Ile Ala His Glu Cys Gly His His Ala Phe Ser Lys Tyr Gln
100 105 110
Leu Val Asp Asp Met Val Gly Leu Thr Leu His Ser Cys Leu Leu Val
115 120 125
Pro Tyr Phe Ser Trp Lys Ile Ser His Arg Arg His His Ser Asn Thr
130 135 140
Gly Ser Leu Asp Arg Asp Glu Val Phe Val Pro Lys Pro Lys Ser Lys
145 150 155 160
Val Ser Trp Tyr Asn Lys Tyr Met Asn Asn Pro Pro Gly Arg Ala Ile
165 170 175
Ser Leu Phe Ile Thr Leu Thr Leu Gly Trp Pro Leu Tyr Leu Ala Phe
180 185 190
Asn Val Ser Gly Arg Pro Tyr Asp Arg Phe Ala Ser His Tyr Asp Pro
195 200 205
Tyr Ala Pro Ile Tyr Ser Asn Arg Glu Arg Leu Leu Ile Tyr Val Ser
210 215 220
Asp Ser Ser Val Phe Ala Val Thr Tyr Leu Leu Tyr His Ile Ala Thr
225 230 235 240
Leu Lys Gly Leu Gly Trp Val Val Cys Val Tyr Gly Val Pro Leu Leu
245 250 255
Ile Val Asn Gly Phe Leu Val Thr Ile Thr Tyr Leu Gln His Thr Tyr
260 265 270
Ala Ser Leu Pro His Tyr Asp Ser Ser Glu Trp Asp Trp Leu Arg Gly
275 280 285
Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile Leu Asn Lys Ala Phe
290 295 300
His His Ile Thr Asp Thr His Val Ala His His Leu Phe Ser Thr Met
305 310 315 320
Pro His Tyr His Ala Met Glu Ala Thr Asn Ala Ile Lys Pro Ile Leu
325 330 335
Gly Asp Tyr Tyr Gln Phe Asp Gly Thr Pro Val Tyr Lys Ala Leu Trp
340 345 350
Arg Glu Ala Lys Glu Cys Leu Tyr Val Glu Pro Asp Asp Gly Ala Ser
355 360 365
Gln Lys Gly Val Tyr Trp Tyr Lys Asn Lys Phe
370 375
<210> 3
<211> 27
<212> DNA
<213> Arachis hypogaea
<400> 3
catatctgct atatcacata gcaactt 27
<210> 4
<211> 27
<212> DNA
<213> Arachis hypogaea
<400> 4
ggcttctctc cacaatgctt tgtaaac 27
<210> 5
<211> 29
<212> DNA
<213> Arachis hypogaea
<400> 5
agttaccata acctatttgc agcacaaac 29
<210> 6
<211> 26
<212> DNA
<213> Arachis hypogaea
<400> 6
gaatcatagt gaggcaatga tgccta 26
<210> 7
<211> 22
<212> DNA
<213> Arachis hypogaea
<400> 7
agtgagaatg cagccttgga tg 22
<210> 8
<211> 22
<212> DNA
<213> Arachis hypogaea
<400> 8
tgtgagtgtg atgaagaggg ag 22
<210> 9
<211> 19
<212> DNA
<213> Arachis hypogaea
<400> 9
accggttccc tcgacctca 19
<210> 10
<211> 23
<212> DNA
<213> Arachis hypogaea
<400> 10
ggttttggga caaacacttc ttc 23
<210> 11
<211> 25
<212> DNA
<213> Arachis hypogaea
<400> 11
gattactgat tattgacttg ctttg 25
<210> 12
<211> 25
<212> DNA
<213> Arachis hypogaea
<400> 12
cagaaccatt agctttgtag tagtg 25
<210> 13
<211> 24
<212> DNA
<213> Arachis hypogaea
<400> 13
ctctgactat gcatcagaac ttgt 24
<210> 14
<211> 22
<212> DNA
<213> Arachis hypogaea
<400> 14
ggtaccatgg gagctggagg gc 22
<210> 15
<211> 25
<212> DNA
<213> Arachis hypogaea
<400> 15
gaattctcag aacttgttct tgtac 25
Claims (6)
1. a kind of high oleic acid peanut mutated gene AhFAD2B-814, which is characterized in that the mutated gene AhFAD2B-814's
Nucleotide sequence is as shown in SEQ ID NO.1, by 1323 base compositions.
2. a kind of high oleic acid peanut mutated gene AhFAD2B-814 according to claim 1, which is characterized in that described
Mutated gene AhFAD2B-814 includes ariyoshi base mutation at one: 814C > T, in SEQ ID NO.1 sequential coding area 814bp
There are the base replacements of C814T at place.
3. a kind of protein of high oleic acid peanut mutated gene AhFAD2B-814 coding as claimed in claim 1 or 2, special
Sign is that the protein sequence of mutated gene coding is made of, the egg as shown in SEQ ID NO.2 379 amino acid residues
272 amino acid residue of white matter sequence is changed into tyrosine (Y) by histidine (H).
4. a kind of PCR primer for detecting high oleic acid peanut FAD2B mutated-genotype, it is characterised in that:
(1) the primer pair AhFAD2B-C/ of the site the 814bp base C amplification to AhFAD2B wild type gene code area is designed
AhFAD2B-Ro,
AhFAD2B-C:5 '-AGTTACCATAACCTATTTGCAGCACAAAC -3 '；
AhFAD2B-Ro:5 '-GGCTTCTCTCCACAATGCTTTGTAAAC -3 '；
(2) the primer pair AhFAD2B-Fo/ of the site the 814bp base T amplification to AhFAD2B mutated genes code area is designed
AhFAD2B-T,
AhFAD2B-Fo:5 '-CATATCTGCTATATCACATAGCAACTT -3 '；
AhFAD2B-T:5 '-GAATCATAGTGAGGCAATGATGCCTA -3 '；
(3) primer pair of fragment amplification of the design to AhFAD2B wild type and mutated genes including the site 814bp
AhFAD2B-Fo/AhFAD2B-Ro,
AhFAD2B-Fo:5 '-CATATCTGCTATATCACATAGCAACTT -3 '；
AhFAD2B-Ro:5 '-GGCTTCTCTCCACAATGCTTTGTAAAC -3 '.
5. a kind of detection side PCR using the PCR primer for detecting high oleic acid peanut FAD2B mutated-genotype described in claim 4
Method, which comprises the following steps:
(1) PCR amplification:
PCR reaction system: genomic DNA template 1 μ L, 2 10 × Buffer of μ L, the 1.5 μ L MgCl of the L of μ containing 20ng/2、2.5mM
DNTP2 μ L of each, each 1.0 μ L of 0.3 μ L of Taq enzyme, AhFAD2B-C and AhFAD2B-T primer, the AhFAD2B-Fo of 0.5U and
AhFAD2B-Ro primer each 0.1 μ L, 11 μ L ddH2O；
PCR amplification program: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C of extension 1min10s, totally 35
Circulation；72 DEG C of extension 10min；
(2) electrophoresis detection: by amplified production detected through gel electrophoresis, the corresponding genotype of sample is obtained.
6. PCR primer described in claim 4 is in the height oil containing the mutational site AhFAD2B homologous gene nucleotide sequence C814T
Application in sour peanut varieties breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810774992.1A CN108753803B (en) | 2018-07-16 | 2018-07-16 | A kind of high oleic acid peanut mutated gene AhFAD2B-814 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810774992.1A CN108753803B (en) | 2018-07-16 | 2018-07-16 | A kind of high oleic acid peanut mutated gene AhFAD2B-814 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108753803A CN108753803A (en) | 2018-11-06 |
| CN108753803B true CN108753803B (en) | 2019-04-23 |
Family
ID=63973883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810774992.1A Expired - Fee Related CN108753803B (en) | 2018-07-16 | 2018-07-16 | A kind of high oleic acid peanut mutated gene AhFAD2B-814 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108753803B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109593876A (en) * | 2019-01-25 | 2019-04-09 | 河北省农林科学院粮油作物研究所 | The KASP label serotype specific primer group and its application of high throughput detection AhFAD2B gene mutation site |
| CN110923354B (en) * | 2019-12-13 | 2022-07-01 | 山东省花生研究所 | Method for detecting high-oleic-acid peanuts and application thereof |
| CN111944828B (en) * | 2020-07-14 | 2022-05-24 | 深圳大学 | Preparation method of peanut mutant, peanut mutant gene, protein coded by peanut mutant gene and application of peanut mutant gene |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003060092A2 (en) * | 2002-01-14 | 2003-07-24 | Brookhaven Science Associates, Llc | Modified fatty acid hydroxylase protein and genes |
| CN103525931A (en) * | 2013-10-16 | 2014-01-22 | 山东省花生研究所 | Peanut high-oleic-acid character gene selection method |
| CN104328198A (en) * | 2014-11-14 | 2015-02-04 | 河南省农业科学院 | Primer for detecting mutant genotypes of FAD2A and FAD2B genetic loci of high oleic acid peanuts and PCR detection method of primer |
| CN105385778A (en) * | 2015-12-26 | 2016-03-09 | 山东省农业科学院生物技术研究中心 | Primers and method for detecting SNP gene typing of AhFAD2B genes of peanuts in high throughput |
-
2018
- 2018-07-16 CN CN201810774992.1A patent/CN108753803B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003060092A2 (en) * | 2002-01-14 | 2003-07-24 | Brookhaven Science Associates, Llc | Modified fatty acid hydroxylase protein and genes |
| CN103525931A (en) * | 2013-10-16 | 2014-01-22 | 山东省花生研究所 | Peanut high-oleic-acid character gene selection method |
| CN104328198A (en) * | 2014-11-14 | 2015-02-04 | 河南省农业科学院 | Primer for detecting mutant genotypes of FAD2A and FAD2B genetic loci of high oleic acid peanuts and PCR detection method of primer |
| CN105385778A (en) * | 2015-12-26 | 2016-03-09 | 山东省农业科学院生物技术研究中心 | Primers and method for detecting SNP gene typing of AhFAD2B genes of peanuts in high throughput |
Non-Patent Citations (1)
| Title |
|---|
| ACCESSION NO:JN544190，Mutant Arachis hypogaea strain E248312 delta12 fatty acid desaturase (FAD2B) gene,complete cds;Wang,C.T等;《Genbank》;20111226;REFERENCE、FEATURES和ORIGIN部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108753803A (en) | 2018-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220177903A1 (en) | Elite event canola ns-b50027-4 | |
| Qu et al. | Genome-wide association mapping and Identification of candidate genes for fatty acid composition in Brassica napus L. using SNP markers | |
| Gehringer et al. | Genetic mapping of agronomic traits in false flax (Camelina sativa subsp. sativa) | |
| Flint-Garcia | Genetics and consequences of crop domestication | |
| CN105475117B (en) | The method of the composition and the generation seed of soya seeds and oil | |
| CN101688220B (en) | Brassica plants comprising mutation acyl group ACP thioesterase allele | |
| CN108753803B (en) | A kind of high oleic acid peanut mutated gene AhFAD2B-814 and application | |
| CN107580629B (en) | Brassica events LBFLFK and LBFDAU and methods for detection thereof | |
| CN109661458A (en) | Inbreeding transgene rape strain NS-B50027-4 and its seed | |
| US7423198B2 (en) | High oleic acid Brassica juncea | |
| JPWO2010150901A1 (en) | Mutants that increase oleic acid content in soybean oil and its causative genes | |
| CN101065013B (en) | Oil with reduced saturation levels of fatty acids | |
| CN102146472B (en) | Four-primer marking method for identifying different genotypes of rice dark endosperm mutator gene Wx-mq | |
| Zhan et al. | Association of clubroot resistance locus PbBa8. 1 with a linkage drag of high erucic acid content in the seed of the European turnip | |
| CN113151529A (en) | InDel marker for identifying radish flower color control gene and application thereof | |
| Jasinski et al. | Natural variation in seed very long chain fatty acid content is controlled by a new isoform of KCS18 in Arabidopsis thaliana | |
| CN102016046A (en) | Compositions and methods for differential regulation of fatty acid unsaturation in membrane lipids and seed oil | |
| Song et al. | Evaluation of genetic diversity and comparison of biochemical traits of soybean (Glycine max L.) germplasm collections | |
| Kato et al. | The effect of stem growth habit on single seed weight and seed uniformity in soybean (Glycine max (L.) Merrill) | |
| EP2828406A1 (en) | Molecular markers for low palmitic acid content in sunflower (helianthus annus), and methods of using the same | |
| CA2831271C (en) | The isolation and use of fad2 and fae1 from camelina | |
| Karim et al. | Marker-assisted selection of low erucic acid quantity in short duration Brassica rapa | |
| CN106282206A (en) | The nucleotide mutant site of instruction Semen Brassicae campestris high gas oil ratio content | |
| CN100381567C (en) | Soybean diglyceride acyltransferase, its coding gene and use | |
| CN114599224B (en) | Mustard line NUBJ1207 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190423 Termination date: 20210716 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |