CN108753803A

CN108753803A - A kind of high oleic acid peanut mutator AhFAD2B-814 and application

Info

Publication number: CN108753803A
Application number: CN201810774992.1A
Authority: CN
Inventors: 陈四龙; 李玉荣; 刘义杰; 王瑾; 程增书; 宋亚辉; 张朋娟
Original assignee: Institute of Grain and Oil Crops of Hebei Academy of Agriculture and Forestry Sciences
Current assignee: Institute of Grain and Oil Crops of Hebei Academy of Agriculture and Forestry Sciences
Priority date: 2018-07-16
Filing date: 2018-07-16
Publication date: 2018-11-06
Anticipated expiration: 2038-07-16
Also published as: CN108753803B

Abstract

A kind of high oleic acid peanut mutator AhFAD2B-814 and application, belong to plant molecular breeding field, the nucleotide sequence of the mutator AhFAD2B-814 is as shown in SEQ ID NO.1, by 1140 base compositions.The mutant nucleotide sequence of the peanut high-oil mutant polynucleotides oleic acid dehydrogenase gene of the present invention, it can apply the plants conventional breeding methods such as hybridization, backcrossing that mutant nucleotide sequence is imported to the peanut varieties or strain of other common oleic acid contents, improve the oleic acid content for importing AhFAD2B-814 gene mutation nucleotide sequence target varieties or strain, the genetic diversity for obviously increasing high oleic acid peanut varieties (being) widens the hereditary basis of high oleic acid peanut.In high oleic acid peanut breeding, the peanut material that AhFAD2A mutated-genotypes can be carried by selection is parent, keeps the high oleic acid character determination of breeding progeny more purposive, and improve the frequency of occurrences of objective trait.

Description

A kind of high oleic acid peanut mutator AhFAD2B-814 and application

Technical field

The invention belongs to plant molecular breeding fields, specifically, being related to high oleic acid peanut coding oleic acid dehydrogenase and can To improve mutator nucleic acid sequence and its application of oleic acid content of peanuts.

Background technology

Peanut is the important oil plant and industrial crops of China, and peanut oil is Chinese tradition edible oil and domestic edible plant The main source of object oil.Mainly there is palmitic acid (C16 in peanut oil:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), behenic acid (C22:And arachidic acid (C20 0):0) aliphatic acid such as.From the point of view of the composition of various aliphatic acid, unsaturated lipid Fat acid is about 80% (wherein oleic acid 36%-67%, linoleic acid 15%-43%), and saturated fatty acid accounts for 20% (wherein palmitic acid 6%-11%, stearic acid 2%-6%, arachidic acid 5%-7%, behenic acid 2%-3%).In peanut seed aliphatic acid composition and Its content is to weigh the important indicator of its quality.In terms of Oil stability, linoleic acid category polyunsaturated fatty acid, oleoyl Residue is oxidizable and leads to grease corruption deterioration, seriously affects grease Storage period；And oleic acid molecular is containing only there are one bivalent insatiable hungers And key, chemical constitution are relatively stablized, oxidation resistance is strong, is unlikely to deteriorate in refining, storage and frying, with common peanut It compares, the peanut of high oleic acid content has longer shelf life.In terms of nutritive value, the quality of peanut oil disappears to peanut oil fixation The health for taking crowd has great influence.The nutritive value of oleic acid is higher, can reduce the content of low-density lipoprotein in blood, It maintains, beneficial to hdl level, more effectively to protect cardiovascular and cerebrovascular, moreover it is possible to reverse inflammatory cytokine TNF-α pair simultaneously The inhibiting effect that insulin generates.Therefore, the important goal that oleic acid content has become peanut quality breeding is improved.

Oleic acid dehydrogenase (Δ 12FAD or FAD2) is that dehydrogenation generation is double unsaturated linoleic on the positions C12 of catalysis oleic acid Key enzyme, it controls oleic acid, linoleic content and its ratio (O/L).The more and more evidences of molecular biology research show AhFAD2 is that oleic acid generates linoleic key gene, determines oleic acid and linoleic relative amount in peanut seed.Cultigen Peanut (Arachis hypogaea) is the allotetraploid species (2n=4x=40) for having genome A and genome B, AhFAD2 is encoded jointly by the non-equipotential homologous gene AhFAD2A and AhFAd2B of 2 couple in different genes group, they distinguish From peanut wild species A and 1 B gene group, which is not admitted to seed specific expression gene, is spent in common oleic acid content This 2 genes or one of them energy normal expression in health product kind；And in high oleic acid kind, AhFAD2A and AhFAd2B genes Being mutated jointly leads to the generation of high oleic acid character.

The evaluation and screening from peanut resource goes out the high oleic acid peanut of oleic acid content 79% (O/L 37) to American scientist earliest Natural mutant F435.It is close from originating in the code area of AhFAD2A by being found to common oleic acid peanut and F435 sequence alignments Numeral plays 448bp bases and finds that there are single bases to replace (G > A), makes the 150th amino acids of protein of coding by asparagus fern ammonia Sour (D) is changed into asparagine (N), and D150 residues are absolute conservations in all FAD2, are the key that high oleic acid characters Site, mutation lead to the reduction of AhFAD2A enzymatic activitys；It is risen at 441_442bp in AhFAD2B gene start codons and there is single alkali Base is inserted into (442insA), and password is caused to be mutated, and causes the protein sequence of translation to terminate in advance, generates inactive albumen.It Afterwards, American scientist has directly been bred as high oleic acid peanut varieties C458 and M2-225 using mutagenesis, they AhFAD2A from So on the basis of mutation (G448A), mutagenesis makes to be inserted into respectively at 665bp and 997bp after AhFAD2B gene start codons micro- again Type inverted repeat transposable element MITE (205bp), causes peptide chain to terminate in advance, protein function is made to lose.The above AhFAD2B mutation Gene belongs to nonsense mutation (Nonsense mutation), keeps the albumen of generation incomplete and loses the function of protogene, As the GENE SOURCES of peanut high-oleic acid breeding.

In by the end of December, 2016 by, the high oleic acid peanut varieties only 38 that China is bred as, foreign countries have been bred as high oleic acid kind 89.Pedigree analysis traces the high oleic acid gene source for being bred as high oleic acid kind, and the high oleic acid gene of 70% or more kind supplies Body derives from F435.High oleic acid GENE SOURCES unification, high oleic acid kind hereditary basis relative narrowness, the heredity for having resulted in incubation are more Sample declines, and the contradiction of yield and quality and the high-quality contradiction with disease resistance become increasingly conspicuous.Currently, large area is answered in domestic production Peanut varieties oleic acid content is universal relatively low (< 50%), and palmitic acid content is higher (> 11%).On the other hand, domestic flower The oleic acid content of raw germ plasm resource is less than 70%, and maximum level only 67.2% belongs to the raw type of dragon, result dispersion, fertility Phase is long, and utilizing status is undesirable in breeding.Therefore new germ plasm resource is excavated and created by multipath has become high oil The task of top priority of sour peanut breeding.

Recently, American scientist identifies 2 new high oleic acid peanut natural mutant PI342664 and PI342666 again, The G > A mutation of its gene coding region AhFAD2A 448 be previously reported identical, and AhFAD2B gene mutations C301G leads to amino Sour H101D changes belong to new mutational site, and mutant oleic acid content is finally made to reach 79% or more.India peanut breeding man adopts With gamma-ray and mutagenesis disease-resistant variety, obtain 2 new high oleic acid mutant (GM6-1 and GM4-3), oleic acid content 75% with On, research finds that AhFAD2B genes occur base replacement G1111A and amino acid G372S is caused to change, to generate high oleic acid table Type.In addition, domestic peanut researcher obtains the new mutational site C313T of AhFAD2B genes using EMS mutagenesises, cause ammonia The H105Y mutation of base acid sequence, make oleic acid content be increased to 60% or more by 44%.But these mutant yet there are no so far The report applied in high oleic acid peanut breeding.

In conclusion the high oleic acid Silk channel injection oleic acid content of practical application is 80% hereinafter, lack superelevation in breeding The peanut new germ plasm of oleic acid content (at least > 80%).A small number of high oleic acid peanut materials that the country obtains are substantially in U.S.'s height Hybridize on the basis of oleic acid peanut mutant, by intellectual property protection, China is not yet had for high oleic acid gene or material There is the high oleic acid peanut new germ plasm of independent intellectual property right.The peanut high-oil acid gene with independent intellectual property right is developed, is to promote The important guarantee of China's high oleic acid peanut industryization fast development.But so far, the country is open not yet or delivers peanut High oleic acid mutator and its application.

Invention content

It is an object of the invention to make up the deficiency of existing patent or technology, with the height for the natural mutation generation that we study Oleic acid peanut mutant C814T is material, provides a kind of new high oleic acid peanut AhFAD2B mutator nucleotide sequences, Oleic acid dehydrogenase (FAD2) in peanut body is encoded, which is that oleic acid (C18 is catalyzed in plant body fat acid biosynthesis pathway: 1) the 12nd carbon potential dehydrogenation of carbochain forms double bond, to the key enzyme of conversion of linoleic acid.It is another object of the present invention to provide one The nucleotides sequence of kind high oleic acid Fatty Acid In Peanut dehydrogenase gene saltant type is listed in the application in peanut high-oleic acid breeding.

The present invention be realize its purpose the technical solution adopted is that：

A kind of high oleic acid peanut mutator AhFAD2B-814, the nucleotide sequence of the mutator AhFAD2B-814 As shown in SEQ ID NO.1, by 1140 base compositions；Or SEQ ID NO:Nucleotide sequence shown in 1 through displacement, be inserted into or The nucleotide sequence of the expression identical function protein of deletion driven；Or with SEQ ID NO:Nucleotide sequence shown in 1 has 90% or more homology and the nucleotide sequence or complementary series for expressing identical function protein.

A kind of high oleic acid peanut mutator AhFAD2B-814, the mutator AhFAD2B-814 include to have at one Adopted base mutation：814C > T, there are the base replacements of C814T at SEQ ID NO.1 sequences 814bp.

A kind of high oleic acid peanut mutator AhFAD2B-814 as described above, the protein of mutator coding Sequence is made of as shown in SEQ ID NO.2 379 amino acid residues, and 272 amino acid residue of protein sequence is by histidine (H) it is changed into tyrosine (Y).

A kind of PCR primer of detection high oleic acid peanut FAD2B mutated-genotypes,

(1) primer pair AhAFD2B-C/ of the design to the sites the 814bp base C amplifications of AhFAD2B wild type genes AhFAD2B-Ro,

AhAFD2B-C：5′—AGTTACCATAACCTATTTGCAGCACAAAC—3′；

AhFAD2B-Ro：5′—GGCTTCTCTCCACAATGCTTTGTAAAC—3′；

(2) primer pair AhFAD2B-Fo/ of the design to the sites the 814bp base T amplifications of AhFAD2B wild type genes AhFAD2B-T,

AhFAD2B-Fo：5′—CATATCTGCTATATCACATAGCAACTT—3′；

AhFAD2B-T：5′—GAATCATAGTGAGGCAATGATGCCTA—3′；

(3) primer pair of fragment amplification of the design to AhFAD2B wild types and mutated genes including the sites 814bp AhAFD2B-Fo/AhFAD2B-Ro,

AhFAD2B-Fo：5′—CATATCTGCTATATCACATAGCAACTT—3′；

AhFAD2B-Ro：5′—GGCTTCTCTCCACAATGCTTTGTAAAC—3′.

It is including following using the PCR detection method of the PCR primer of the detection high oleic acid peanut FAD2B mutated-genotypes Step：

(1) PCR amplification：

PCR reaction systems：Containing 1 μ L genomic DNA templates (20ng/ μ L), 2 10 × Buffer of μ L, 1.5 μ L MgCl2,2 μ L dNTP (2.5mM each), 0.3 μ L Taq enzymes (0.5U), each 1.0 μ L of AhFAD2B-C and AhFAD2B-T primers, AhFAD2B- Fo and AhFAD2B-Ro primers each 0.1 μ L, 11 μ L ddH2O；

PCR amplification program：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C of extension 1min10s, altogether 35 cycles；72 DEG C of extension 10min；

(2) electrophoresis detection：By amplified production detected through gel electrophoresis, the corresponding genotype of sample is obtained.

The PCR primer is in the high oleic acid peanut product containing the mutational sites AhFAD2B homologous gene nucleotide sequence C814T Application in kind (being) selection and breeding.

The beneficial effects of the invention are as follows：

The present invention peanut high-oil mutant polynucleotides oleic acid dehydrogenase gene mutant nucleotide sequence, can apply hybridization, Mutant nucleotide sequence is imported the peanut varieties or strain of other common oleic acid contents by the plants conventional breeding methods such as backcrossing, is carried Height imports AhFAD2B-814 gene mutation nucleotide sequence target varieties or the oleic acid content of strain, hence it is evident that increases high oleic acid flower The genetic diversity of health product kind (being), widens the hereditary basis of high oleic acid peanut.In high oleic acid peanut breeding, choosing can be passed through The peanut material for selecting carrying AhFAD2A mutated-genotypes is parent, keeps the high oleic acid character determination of breeding progeny more purposive, And improve the frequency of occurrences of objective trait.

The application study of the arachic acid dehydrogenase gene mutant nucleotide sequence of the present invention include but are not limited to basis The sequence signature that the present invention studies designs molecular labeling, detects the presence of peanut high-oleic acid novel mutation gene；And with the gene Mutant nucleotide sequence carrier construction cultivates high oleic acid peanut varieties by transgenic method.

Compared with prior art, the present invention has following advantages and effect：

(1) gene of the present invention be study for the first time in the world discovery, report different from the past cultigen peanut AhFAD2B gene New-mutants.There is presently no the His272 site mutations that report shows the FAD2B from cultigen peanut, Peanut can be made to generate high oleic acid phenotype.By illustrating that the regulation and control of oleic acid content of peanuts exist in theory to the research of the gene A kind of new mechanism can play a significant role from practice to improving oil crops oleic acid content, improveing oil quality.

(2) mutational site of the present invention is the peanut high-oleic acid position with independent intellectual property right of China's recent studies on Point has broken the situation that the peanut high-oil acid gene applied at present in China is introduced mainly by foreign countries.

(3) the oleic acid content of peanuts higher of the mutational site instruction, AhFAD2A mutators and the peanut of the present invention are high Oleic acid new A hFAD2B-814 mutators exist simultaneously, and oleic acid content is more than previous disclosed other positions of peanut up to 85% Point or the corresponding oleic acid content of molecular labeling.

(4) it by Molecular Detection targeted mutagenesis site, precisely can efficiently screen with high oleic acid content character Peanut varieties (are).

The present disclosure additionally applies for based on the mutator molecular labeling and gene functional research and peanut high-oleic acid educate Kind and transgenic research etc..

Description of the drawings

Fig. 1 is common oleic acid content kind (Ji spends No. 6, oleic acid content 43.56%) peanut oil fatty acid gas chromatogram.

Fig. 2 is F435 types mutant strain (KX016, oleic acid content 79.37%) peanut oil fatty acid gas chromatogram.

Fig. 3 is novel high oleic acid mutant (HZY-2 i.e. C814T, oleic acid content 85.58%) peanut oil fatty acid gas phase color Spectrogram.

Fig. 4 is peak figure at AhFAD2A gene sequencing partial sequences 441_442.

Fig. 5 is peak figure at AhFAD2B gene sequencing nucleic acid sequences 448bp.

Fig. 6 is peak figure at AhFAD2B gene sequencing nucleic acid sequences 814bp

Fig. 7 is that No. 6, the amino acid of the AhFAD2A gene codes of KX016, novel high oleic acid peanut mutant C814T are spent in Ji Sequence alignment.

Fig. 8 is that No. 6, the amino acid of the AhFAD2B gene codes of KX016, novel high oleic acid peanut mutant C814T are spent in Ji Sequence alignment.

Fig. 9 is the gas chromatogram of saccharomyces cerevisiae total fatty acids ingredient, negative control, empty carrier pYES2.0 transformants.

Figure 10 is the gas chromatogram of saccharomyces cerevisiae total fatty acids ingredient, positive pYES/AhFAD2B transformants.

Figure 11 is the gas chromatogram of saccharomyces cerevisiae total fatty acids ingredient, positive pYES/AhFAD2B-814 transformants.

Figure 12 is that AhFAD2 gene nucleotides mutational site special primer (spends 5 in Ji in the common oleic acid peanut varieties of wild type Number, Ji spends No. 6 and the Weihe River spends No. 18) and high oleic acid mutant (C814T) in amplification situation.

Figure 13 is amplification of the special primer of the mutational sites C814T AhFAD2B-814 in being bred as high oleic acid peanut varieties Situation.

Wherein,

In Fig. 1-3, C16:0 is palmitic acid, C18:0 is stearic acid, C18:1 is oleic acid, C18:2 be linoleic acid, C20:0 is Arachidic acid, C20:1 is arachidic acid monoenoic acid, C22:0 is behenic acid, C24:0 is lignin acid；

In Fig. 4-6, arrow and digital representation mutation differences site and its position；

In Fig. 7-8, KX016 protein sequences are gap, and translation is terminated in advance because its encoding gene is there are insertion mutation； Wild-type amino acid, the F435 type amino acid of mutating acid and corresponding gene are indicated in box, top line is consistent Sequence, the number identified thereon are amino acid position of the amino acid residue in corresponding gene coding region；

In Fig. 9-11, C16:0 is palmitic acid；C16:1 is palm monoenoic acid；C18:0 is stearic acid；C18:1 is oleic acid； C18:2 be linoleic acid；C18:3 be leukotrienes；

In Figure 12, M indicates DNA molecular amount standard, segment from top to bottom as 2000,1000,750,500,250, 100bp.Number a, b, c, d, e, f, g, h indicate different loading wells respectively, the DNA profiling and primer pair that 8 loading wells use It assembles different；The template of a and e is that Ji spends No. 5, and the template of b and f is that Ji spends No. 6, and the template of c and g is that the Weihe River spends No. 18, d and The template of h is C814T；The primer sets of use are respectively：A, b, c, d are specific amplification AhFAD2A genetic fragments AhFAD2A-Fo, AhFAD2A-Ro, AhFAD2A-G and AhAFD2A-A；D, e, f, g are specific amplification AhFAD2B genetic fragments AhFAD2B-Fo, AhFAD2B-Ro, AhAFD2B-C, AhFAD2B-T primer combination；

In Figure 13, M indicates DNA molecular amount standard, segment from top to bottom as 2000,1000,750,500,250, 100bp；Number 1-24 indicates different loading wells respectively, wherein 1,2 be respectively that No. 6 and positive control are spent in negative control Ji C814T mutant, 3 be H2O negative controls, and the gene of the high oleic acid peanut varieties (being) of incubation is respectively adopted in 4-24 loading wells Group DNA profiling is followed successively by Ji and No. 11 (Ji Ke is at a turn mirror words (2013) the 2-002nd), Ji is spent to spend No. 13 (state's tasting peanuts 2014005), Ji spends No. 16 (peanut 2015006 is judged by state), Ji that No. 18 (peanut 2016009 is judged by state), Jis is spent to spend No. 19 (states Tasting peanut 2016004), flower educates 51 (word the 1205005th is stepped in Anhui tasting), flower educates 52 (word the 1205006th is stepped in Anhui tasting), Hua Yu 662 (word the 1305001st is stepped in Anhui tasting) are educated in 661 (Anhui tasting step on word the 1405002nd), flower, flower educates 917 (word the is stepped in Anhui tasting 1505012), flower educates 951 (word the 1305019th is stepped in Anhui tasting), flower educates 957 (word the 1505024th is stepped in Anhui tasting), flower educates 958 (Anhui Tasting step on word the 1505025), flower educates 961 (word the 1305010th is stepped in Anhui tasting), flower educates 963 (word the 1505029th is stepped in Anhui tasting), Agriculture 61 (Henan is examined and spends 2012001) is opened, agriculture 71 (Henan is examined and spends 2015002) is opened, opens agriculture 176 (Henan is examined and spends 2013002), opens agriculture 1715 (Henan examine spends 2014002), Henan spend 37 (Henan is examined and spends 2015011), middle spend 24 (peanuts 2015007 are judged by state).All loading wells make Primer sets be specific amplification AhFAD2B-814 mutation AhFAD2B-Fo, AhFAD2B-Ro, AhAFD2B-C and AhFAD2B-T。

Specific implementation mode

The present invention changes the expression of oleic acid dehydrogenase (FAD2) gene according to the existing result of study of high oleic acid oil crops Level makes a significant impact the oleic acid content of oil crop seeds.It is generally acknowledged that AhFAD2 genes are in control peanut seed One of important candidate gene of oleic acid content height.It is carried out on the accurate evaluation of foundation of phenotype in the vast resources material to collection, It is combined with gas chromatographic detection by near-infrared attribute test, identifies high oleic acid peanut mutant single plant；Pass through single plant Inbreeding of more generation, offspring's separation, the homozygous lines of acquired character stable and consistent；Pass through AhFAD2A and AhFAD2B gene clonings and survey Sequence is analyzed, and new mutational site is excavated out；By with high yield, high-quality, resistance mixing breed, specifically drawn using mutational site Object alternatively marks, and carries out the selection of offspring's high oleic acid single plant directed tracing, obtains high oleic acid new peanut variety (being).

Technical scheme of the present invention is further elaborated with reference to embodiment and Figure of description, the following example is only For illustrating the present invention, but it is not used to limit the scope of the present invention.In embodiment unless otherwise specified, according to normal condition or The condition of person manufacturer specification suggestion carries out.Production firm person is not specified in agents useful for same or instrument, and being can be with market The conventional products purchased.

Embodiment 1：High oleic acid peanut is mutated the screening and purifying of single plant

By 220 parts of groundnut germplasm materials of collection and the plantation of 150 parts of germplasm of initiative in crop field, by material plant at Row, monoseeding, selfing after ripening harvest harvest seed by single plant；2nd year each material selection, 3 single plants, thin planting is at plant It plants in crop field, selfing single plant is harvested again according to single plant, is peeled off after seed natural air drying, (Perten) is led to using wave DA7200 diode array near-infrared analyzers detect the content of fatty acid of each single-strain seed, filter out single plant oleic acid in plant and contain Amount 70% or more plant 9.

The aliphatic acid that these plants are further accurately detected using U.S.'s Agilent 6890A gas chromatographicanalyzers is formed And content, steps are as follows：

(1) appropriate full peanut seed is selected, grind into powder weighs about 40-50mg in 2mL centrifuge tubes, is added 0.95mL chromatographically pure n-hexanes, ultrasonic wave 20min take out and add 0.95mL n-hexanes, are uniformly mixed, and 14000rpm centrifuges 10min, Take supernatant spare.

(2) 500 μ L of Aspirate supernatant are added in 2mL centrifuge tubes, add 500 μ L 0.4mol/L KOH- methanol, mixing, 60 DEG C of water-bath 20min, during which mixing is 4 times reverse.

(3) it takes out sample and is cooled to room temperature, often 600 μ L 0.9%NaCl aqueous solutions, mixing, 14000rpm centrifugations is added in pipe 10min takes 300 μ L of supernatant in upper sample bottle, while 300 μ L n-hexanes are added, and mixing carries out gas chromatographic analysis.

(4) attached FID flame ionization ditectors, chromatographic column HP-5 5%Phenyl Methyl Siloxane are used： The μ of μ × 0.25 of 30m × 320,250 DEG C, column flow 0.7mL/min of injector temperature, split ratio 20:1.Temperature program：Post case is initial Temperature is 150 DEG C, rises to 220 DEG C with 3 DEG C/min, keeps 15min.250 DEG C of FID temperature, detector gas hydrogen 30mL/ Min, air 400mL/min, tail nitrogen blowing 25mL/min, 2.0 μ L of sample size.

The final single plant 2 for identifying 80% or more oleic acid content, number is HZY-1 and HZY-2 respectively.

Measure the aliphatic acid that common oleic acid kind Ji spends No. 5 and No. 6 and F435 type high oleic acid mutant KX016 are spent in Ji Content, comparison result are as shown in table 1.

1 different peanut varieties of table (are) main fatty acid relative amount (%)

By table 1 as it can be seen that the oleic acid content of HZY-2 ratios HZY-1 is high by 10.14%, spends No. 5 than KX016, Ji and Ji spends No. 6 Oleic acid content difference is high by 7.83%, 96.46% and 83.85%.Spend No. 6, the fat of KX016 and HZY-2 in gas chromatograph test Ji Fat sour component peak figure is as shown in Figs. 1-3.

Embodiment 2：The mutant nucleic acid sequence of high oleic acid arachic acid dehydrogenase gene is cloned and sequencing

(1) determine and obtain the candidate gene of peanut high-oleic acid character.

The biological approach of vegetable fatty acid synthesis is more clear.Existing research confirms that oleic acid biosynthesis has two Approach：First, using stearic acid as substrate, oleic acid is generated under stearoyl-CoA desaturases (SAD) catalysis, which is oil The main path of acid synthesis；Second is that using palm monoenoic acid as substrate, carbochain is further extended under acyl-CoA effects, is generated Oleic acid.An oleic acid part for synthesis, which is attached on the carbon skeleton of triglycerides, becomes final shelf stability grease, and a part is in oleic acid Dehydrogenation is further formed the linoleic acid with double unsaturated bonds under the action of dehydrogenase, and also sub-fraction extends enzyme in carbochain Effect is lower to generate eicosenoic acid.In addition, by obtaining high oleic acid peanut to high oleic acid oil crops and using RNAi methods Research also indicates that the oleic acid content of peanut can be made a significant impact by changing the expression of FAD2 genes.Therefore, can recognize It is one of the important candidate gene for controlling oleic acid content of peanuts for peanut FAD2 genes.In turn, by cloning common oleic acid content FAD2 genes in peanut varieties, F435 type high oleic acid strains and above-mentioned 2 excavated high oleic acid peanut single plant are verified The difference sites that may be present in FAD2 gene orders HZY-1 and HZY-2.

(2) high oleic acid peanut mutant AhFAD2 gene clonings.

It is existing studies have shown that there are 2 AhFAD2 allele, i.e. AhFAD2A and AhFAD2B in Peanut genome, Respectively from peanut A genomes and 1 B gene group.Utilize known AhFAD2A and AhFAD2B gene orders in ncbi database. By the way that listed AhFAD2 gene orders are compared, find the sequence identity obtained up to 98% or more, AhFAD2A and Before the main distinction between AhFAD2B genes is the latter's initiation codon there are about 8 base deletions in the places -70bp, and should Gene internal intronless, therefore can be designed in the different regions of gene coding region both sides and can distinguish specific amplified AhFAD2A With the PCR primer of AhFAD2B full length genes, PCR amplification is carried out using genomic DNA as template to clone AhFAD2A and AhFAD2B Coding sequence overall length.Its forward primer AhFAD2A-F：5 '-GATTACTGATTATTGACTTGCTTTG -3 ', AhFAD2B-F：5 '-CAGAACCATTAGCTTTGTAGTAGTG -3 ', general reverse primer are AhFAD2-R：5′— CTCTGACTATGCATCAGAACTTGT—3′。

It studies high oleic acid single plant HZY-1 and HZY-2, KX016 and Ji that the material used is above-mentioned excavation and spends No. 6.Using CTAB methods extract seedling leaves genomic DNA, according to the operation of Murray and Thompson (1980) and make to simplify, step is such as Under：

(1) in 2mL centrifuge tubes, the beta -mercaptoethanol of the 2%CTAB buffer solutions and 30 μ L of 800 μ L, 65 DEG C of preheatings are added.

(2) young leaflet tablet 1-2g is taken, it is clean with distilled water flushing, then rinsed 2 times with sterilizing ddH2O, it is put into pre- through liquid nitrogen In cold mortar.Liquid nitrogen grinding is added to powdered, in clean sterilizing stainless steel spoon transfer of powders to the centrifuge tube of preheating, Total volume reaches 1mL, after being mixed well on turbula shaker, is positioned in 65 DEG C of water-baths and keeps the temperature 30-60min, frequently gently Rotate centrifuge tube for several times.

(3) 13000rpm centrifuges 15min under the conditions of 4 DEG C, in Aspirate supernatant to another new centrifuge tube.

(4) 3 μ L RNase (10mg/mL), 37 DEG C of heat preservation 30-60min are added.

(5) isometric chloroform/isoamyl alcohol (24 is added:1) mixing 10min, is gently overturned, 13000rpm is centrifuged at 4 DEG C 10min is moved in supernatant to another new centrifuge tube.

(6) isometric chloroform/isoamyl alcohol (24 is added in supernatant again:1) mixing 10min, is lightly overturned, 4 13000rpm centrifuges 10min at DEG C, moves in supernatant to another new centrifuge tube.

(7) the 3M NaAc (4 DEG C precooling) of 1/10 volume are added, gently after mixing, be added 2 times of volumes 100% ethyl alcohol or 0.7 times of volume isopropanol (- 20 DEG C of precoolings), it may appear that flocculent deposit, -20 DEG C are placed 30-60min or -80 DEG C of placement 10min, 12000rpm centrifuges 10-15min, recycling DNA precipitations.

(8) it cleans precipitation 2 times with 70% ethyl alcohol, is dissolved in after drying in appropriate sterilizing ddH2O or TE, 37 DEG C of placement 20- 30min makes DNA precipitations be completely dissolved.

(9) genomic DNA integrality is detected with 0.8% agarose gel electrophoresis.Utilize EpochTM Microplate Spectrophotometer detects genomic DNA concentration and quality.

(10) 5 μ L stostes are taken out, are uniformly diluted to 20ng/ μ L as working solution.

Using the peanut genome of extraction as template, PCR 4 peanut materials of clone are carried out using the primer pair of design AhFAD2A and AhFAD2B genes.By Beijing Quanshijin Biotechnology Co., Ltd TransStart FastPfu DNA Polymerase specifications configure 20 μ L PCR reaction systems：2 × PCR Mix 10 μ L, forward and reverse each 1 μ L of primer, genome DdH2O to 20 μ L is added in 1 μ L of DNA profiling.In Bio-Rad T100^TMIt is expanded in PCR instrument, expands the anti-of AhFAD2A genes The program is answered to be：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 1min10s, totally 30 recycle；72 DEG C extend 10min.The annealing temperature for expanding AhFAD2B genes is 50 DEG C, the same AhFAD2A of other programs.

Amplified production is detached with 1% agarose gel electrophoresis, using Omega E.Z.N.A.Gel Extraction Kit DNA fragmentation recycling and purifying are carried out, operating procedure is carried out by kit operating instruction.With putting down for Beijing Tiangeng biotech company After end adds " A " reaction kit progress PCR product that " A " is added to react, it is connected to gene clone carrier pMD19-T Simple Vector (is purchased from Dalian TaKaRa Bioisystech Co., Ltd), the heat-shock transformed Escherichia coli of connection product (E.coli) competence Cell Trans5 α Chemically Competent Cell (are purchased from Beijing Quanshijin Biotechnology Co., Ltd).Added with IPTG, X-Gal, ampicillin Amp LB solid mediums on carry out blue hickie screening, identify positive single bacterium colony through PCR, often A each 30 positive colonies of picking of peanut material send Hua Da Gene science Services Co., Ltd to be sequenced.

(3) peanut AhFAD2 Homologous gene sequences are analyzed.

Segment is sequenced and uses Lasergene Seqman Pro (DNAStar) (http://www.DNAStar.com) software It is assembled, finally obtains 120 full length gene sequences.Sequence analysis is carried out using 10 softwares of Geneious Pro.It selects Common oleic acid peanut varieties Ji spends No. 6 Homologous gene sequences to be used as and refers to sequence, and comparison result is as Figure 4-Figure 6, shows 3 Base replacement G > occur at the 448bp of code area for the AhFAD2A genes of high oleic acid peanut material HZY-1 and HZY-2, KX016 A makes the 150th residue of corresponding protein sequence be changed into asparagine (N) by aspartic acid (D).AhFAD2B genes are in 3 height Performance difference in candidate difference site in oleic acid material, wherein KX016 and HZY-1 are after initiation codon between 441bp and 442bp It is inserted into single base A (441_442insA), frameshift mutation is caused, reading frame is made termination codon occur for 495 after initiation codon Son；And single base replacement C > T occur at the 814bp of code area for the mutational site of HZY-2, make corresponding protein sequence 272 residues are changed into tyrosine (Tyr, Y) by histidine (His, H), therefore the mutator is named as AhFAD2B-814, The high oleic acid peanut mutant HZY-2 for carrying the gene is named as C814T.

AhFAD2B-814 site mutations cause the position of amino acid mutation as Figure 7-8.Peanut AhFAD2B genes are non- Often conservative, other than above-mentioned difference site, other nucleotide sequences of the surveyed peanut material gene do not have difference.

Embodiment 3：Expression and functional analysis of the high oleic acid peanut AhFAD2B novel mutation genes in saccharomyces cerevisiae

Above-mentioned peanut AhFAD2 genes category endoplasmic reticulum oleic acid dehydrogenase, host's first choice of functional analysis is yeast, because In yeast containing needed for such dehydrogenase electron transport system and suitable membrane environment, and saccharomyces cerevisiae (Saccharomyces Cerevisiae) due to lacking Δ 12 (ω -6) and omega-fatty acid dehydrogenase, endogenous polyunsaturated fatty acid cannot be generated, carefully Intracellular fatty acid ingredient is simple, is the optimal expression system of Exogenous fatty dehydrogenase gene.INVScI/pYES2.0 is normal Express the Saccharomyces Serevisiae Expression System of Exogenous fatty acidohydrogenase.

According to the multiple cloning sites of saccharomyces cerevisiae expression pYES2.0, respectively primer 5 ' end introduce KpnI and The restriction enzyme site of EcoRI designs AhFAD2 gene specific primers, wherein forward primer pF1：5′— GGTACCATGGGAGCTGGAGGGC -3 ', reverse primer pR1：5′—GAATTCTCAGAACTTGTTCTTGTAC—3′.Using The target gene monoclonal bacterium solution of acquisition is template, with pF1-pR1 primer pair PCR amplification target gene code area, reaction system： DdH2O to 20 μ L is added in 2 × PCR Mix 10 μ L, forward and reverse each 1 μ L of primer, 1 μ L of DNA profiling bacterium solution.Amplification program is：94 DEG C pre-degeneration 5min；94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 30 recycle；72 DEG C of extension 5min.Amplification It after product purification, digests through restriction enzyme KpnI and EcoRI, is connect with through the postdigestive pYES2.0 of same enzyme, respectively structure Build up Yeast expression carrier pYES2/AhFAD2A and pYES2/AhFAD2B.The carrier of structure is correct through sequencing and digestion verification It is inserted into pYES2.0.In addition, using pYES2.0 empty carriers as negative control, by connection product and negative control vector plasmid each 10 μ L are added to INVScI saccharomycete (MAT α his3- Δs 1leu2trp1-289ura3-52, the Invitrogen companies) sense prepared In by state cell, mixing stands 5min on ice, and 30 DEG C of recovery 2-3h of sorbierite of 1mL precoolings, centrifugation is added in 1500V electrotransformations It is coated with the MD tablets containing 0.05%His and 0.01%Trp and Leu, 30 DEG C of culture 3d afterwards.The positive monoclonal of inoculated identification is extremely In MD (containing 0.05%His and 0.01%Trp and Leu) culture medium, 30 DEG C are incubated overnight.Inoculation will be incubated overnight to arrive In MD culture mediums of the 50mL containing 2% galactolipin in 250mL triangular flasks, the method with reference to shown in Invitrogen companies operation manual OD600 is set to reach 0.4.Under the conditions of 30 DEG C and 120rpm after Fiber differentiation 72h, 10min is centrifuged with 2000 × g, discards supernatant liquid, It is washed with deionized 2 times, then uses petroleum ether-ether (1:1) 2 times are washed and removes the aliphatic acid adhered on thalline.By cell 1M methanolic hydrochloric acids are added after freeze-drying, isometric petroleum ether-ether (1 is added after reacting 3h at 80 DEG C:1).Using gas-chromatography Method analyzes sample fatty acid composition and content.

The sub- fatty acid compositional analysis of 2 Saccharomyces cerevisiae transformant of table

Fig. 9-11 be separate sources peanut AhFAD2 genes expressed in saccharomyces cerevisiae, cause yeast body fat acid at Divide the gas chromatographic analysis figure with changes of contents.C16 is all had in the aliphatic acid chromatogram of positive transformant:2 and C18:2 Specific fats acid peak, and illustrate this then without this 2 specific fats acid peaks in the chromatography of negative control pYES2.0 transformants A little FAD2 are provided with oleic acid dehydrogenase function, but peanut AhFAD2A and AhFAD2B saltant type and wild type in yeast system Gene code enzymatic generates linoleic amount and has differences, and concrete numerical value is as shown in table 2, wherein transformant pYES2/ The linoleic acid content of AhFAD2B-814 is only the 50.5% and 46.5% of wild type AhFAD2A and AhFAD2B gene transformants, Reduce by 3.82% and 24.30% respectively than F435 type AhFAD2A and AhFAD2B mutator transformant linoleic acid contents.In addition, Desaturation rate is to weigh the important indicator of dehydrogenase activity, desaturation rate (%)=product assay/(product assay+substrate content) × 100%.In this research wild type AhFAD2A and AhFAD2B, F435 saltant type AhFAD2A-448 and AhFAD2B-442 and C18 in the yeast transformant of novel mutation AhFAD2B-814 genes:1 dehydrogenation desaturation rate is respectively 20.20%, 21.35%, 10.32%, 13.49%, 9.50%, illustrate the saltant type AhFAD2B dehydrogenase activities of the coding of AhFAD2B-814 It is minimum.Therefore, the novel high oleic acid peanut mutant C814 mutators AhFAD2B-814 that we study is reducing oleic acid to Asia Even more important effect is played in the catalytic activity of oleic acid.

Embodiment 4：The correlation analysis in high oleic acid the peanut mutational sites mutant C814T and high oleic acid content

(1) oleic acid content F2 segregating populations structure and group's single plant oleic acid content measure.

It is selfed by the high oleic acid peanut mutant C814T and common oleic acid content mixing breed, offspring that will excavate Obtain F2 trait segregation single plants.Specially：It is male parent that high oleic acid mutant C814T is utilized in peanut florescence in June, 2015, point Do not spend No. 6 with common oleic acid content kind Ji and the Weihe River spend No. 18 to assemble cross combination, using set fossil fragments hybridization pollination technology into Row sexual hybridization, current year 10 months at the beginning of harvest allocarpy (F0), obtain the hybrid seed of different genetic backgrounds, " Ji spend No. 6 × C814T " combinations obtain 26 allocarpies (44 seeds), and " spending No. 18 × C814T in the Weihe River " combination obtains 43 allocarpy (71 kinds Son).In May, 2016 3502 farm peanut breeding base of Shijiazhuang Luquan area plant F1, monoseeding, self propagated, Puppet hybrid strain is eliminated, subassembly is harvested by single plant after mid-September current year maturation, is not done any selection, is dried respectively, and 2 combinations divide It Huo get not 38 and 62 single plants.Plant F1 single-strain seeds in May, 2017 respectively by plant, monoseeding is not done any after ripe Selection is still pressed single plant and is harvested, and 2 combinations obtain 1071 and 1835 single plants respectively.

After 2 cross combination F2 single plant pods are peeled off, the full seed benevolence of each single plant is chosen respectively, using DA7200 near-infrareds Its content of fatty acid of analyzer small sample looping test.Group F2 single plant oleic acid content test results are as shown in table 3.

Table 3 " spending No. 6 × C814T in Ji " (F2-A) and " spending No. 18 × C814T in the Weihe River " (F2-B) F2 single plant oleic acid contents

(2) new mutation site and oleic acid content relevance verification

According to group's test result, the individual of two kinds of extreme phenotypes of high level and low value is selected from above 2 groups respectively Phenotype group is formed, that is, selects 10 oleic acid contents highest single plant (oleic acid content is 80% or more) structure in respective combination High oleic acid phenotype group chooses the minimum single plant (oleic acid content is below 43%) of 10 oleic acid contents and forms low oleic acid phenotype Group.It takes 5 to germinate in incubator at random from the single-strain seed of selection respectively and obtains single-strain blade, mix blade by single plant It is ground in liquid nitrogen, genomic DNA is extracted using modified CTAB method, with primer pair AhFAD2A-F/AhFAD2-R and AhFAD2B-F/ AhFAD2-R carries out AhFAD2A the and AhFAD2B gene orders of each single plant of PCR amplification, and it is complete that cloning and sequencing obtains gene coding region Long sequence.

The sequence of acquisition is compared, as a result, it has been found that, in the high oleic acid phenotype group single plant of 2 different genetic backgrounds and low Occur identical difference site, the i.e. positions 448bp of the AhFAD2A genes of high oleic acid phenotype group single plant in oleic acid phenotype group single plant Point is A, and is G at the sites 448bp of the AhFAD2A genes of low oleic acid phenotype group single plant；High oleic acid phenotype group single plant The sites 814bp of AhFAD2B genes are T, and are at the sites 814bp of the AhFAD2B genes of low oleic acid phenotype group single plant C.It can be seen that the T in 814 site of A and AhFAD2B genes in the sites high oleic acid phenotype group AhFAD2A gene 448bp is high level The high level genotype of phenotype group, and low oleic acid phenotype group does not have the genotype.It to sum up analyzes, AhFAD2B gene Cs 814T is The specific mutation sites of high oleic acid single plant.

Embodiment 5：The special primer exploitation and application in the mutational sites AhFAD2B-814

For the relationship of precise Identification C814T mutant AhFAD2B gene mutation sites and high oleic acid character, we according to There are the sequence signature in 2 mutational sites in AhFAD2A and AhFAD2B gene orders, 2 genes of detection respectively have been designed and developed The special primer in group homologous gene mutational site accurately carries out genotype identification.

The primer for detecting the G448A mutation of AhFAD2A genes of design is as follows：

AhFAD2A-Fo：5′—AGTGAGAATGCAGCCTTGGATG—3′

AhFAD2A-Ro：5′—TGTGAGTGTGATGAAGAGGGAG—3′

AhAFD2A-A：5′—ACCGGTTCCCTCGACCTCA—3′

AhFAD2A-G：5′—GGTTTTGGGACAAACACTTCTTC—3′

The primer for detecting the 814T mutation of AhFAD2B gene Cs of design is as follows：

AhFAD2B-Fo：5′—CATATCTGCTATATCACATAGCAACTT—3′

AhFAD2B-Ro：5′—GGCTTCTCTCCACAATGCTTTGTAAAC—3′

AhAFD2B-C：5′—AGTTACCATAACCTATTTGCAGCACAAAC—3′

AhFAD2B-T：5′—GAATCATAGTGAGGCAATGATGCCTA—3′

Wherein AhFAD2A-Fo/AhFAD2A-G primer pairs can be to the sites the 448bp alkali of peanut AhFAD2A wild type genes Base G carries out specific PCR amplification, amplified fragments 210bp；AhAFD2A-A/AhFAD2A-Ro primer pairs can be mutated AhFAD2A The sites the 448bp base A of type gene carries out specific PCR amplification, amplified fragments 120bp；AhAFD2A-Fo/AhFAD2A-Ro draws Object pairing energy carries out specific PCR amplification to the segment of AhFAD2A wild types and mutated genes including the sites 448bp, expands Increasing segment is 267bp, which actually plays the role of positive control, can reduce the amplification of non-specific PCR product and draw Object dimer is formed.Pcr amplification reaction system (20 μ L)：Containing 1 μ L genomic DNA templates (20ng/ μ L), 2 μ L 10 × Buffer, 1.5 μ L MgCl2,2 μ L dNTP (2.5mM each), 0.3 μ L Taq enzymes (0.5U), AhAFD2A-A and AhFAD2A- Each 1.0 μ L of G primers, AhAFD2A-Fo and AhFAD2A-Ro primers each 0.1 μ L, 11 μ L ddH2O.The above amplification AhFAD2A genes The response procedures of specific fragment are：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C of extension 1min10s, Totally 35 cycles；72 DEG C of extension 10min.Equally assemble amplification AhFAD2B gene specifics mutational site primer, wherein AhAFD2B- C/AhFAD2B-Ro primer pairs can carry out specific PCR amplification to the sites the 814bp base C of AhFAD2B wild type genes, expand piece Section is 280bp；AhFAD2B-Fo/AhFAD2B-T primer pairs can be to the sites the 814bp base T of peanut AhFAD2B mutated genes Carry out specific PCR amplification, amplified fragments 145bp；AhAFD2B-Fo/AhFAD2B-Ro primer pairing energies are wild to AhFAD2B The segment of type and mutated genes including the sites 814bp carries out specific PCR amplification, amplified fragments 371bp, as the positive Control.PCR reaction systems are same as above, but primer pair uses a fragment-specific primer of the present invention.It is special to expand AhFAD2B genes The response procedures of heteroleptic are：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C of extension 1min10s, altogether 35 cycles；72 DEG C of extension 10min.

The 3 pairs of primer pairs separately constituted with 4 primer strands of above-mentioned amplification A genomes and 1 B gene group can be anti-in 1 PCR It is expanded in answering (nest-type PRC), amplified production detected through gel electrophoresis, that 2 bands occur is homozygous (G/G, A/A, C/C Or T/T), that 3 bands occur is heterozygous (G/A or C/T).

As Ji that Figure 12 is the tool wild type AhFAD2 of the common oleic acid content of above 6 pairs of primer pairs spend No. 5, Ji spend No. 6 and Spend the result of No. 18 and high oleic acid mutant C814T genomic DNA progress PCR amplifications in the Weihe River.In figure 12 it can be seen that AhFAD2A-Fo/AhFAD2A-G and AhAFD2B-C/AhFAD2B-Ro primer pairs are only capable of expanding shaping to wild type (spending No. 6 in Ji) Band shows that it is respectively G and C bases at the sites 448bp of AhFAD2A and the sites 814bp of AhFAD2B；AhAFD2A-A/ AhFAD2A-Ro and AhFAD2B-Fo/AhFAD2B-T primer pairs are only capable of to band at saltant type (C814T) amplification, show its It is respectively A and T bases at the sites 448bp of AhFAD2A and the sites 814bp of AhFAD2B；AhAFD2A-Fo/AhFAD2A-Ro With AhAFD2B-Fo/AhFAD2B-Ro primer pairs as positive control, band can be amplified in all material.To sum up table It is bright, compared with the common oleic acid content peanut varieties of wild type, with special at 814bp in high oleic acid mutant 1 B gene group There are T bases at point.We, which successfully have developed, as a result, is directed to containing AhFAD2B-814 novel mutations site and exists simultaneously The high oleic acid peanut genotype of AhFAD2A-448 mutation detects special primer.

Using the above-mentioned special primer pair for mutational site, large-scale molecular has been carried out to the genotype of F2 groups single plant Identification, therefrom identifies the single plant 75 (F2-A) and 128 (F2-B) of specific site homozygosis.Through Chi-square Test, meet 2 pairs it is hidden Property gene control Heredity, i.e., F2 double recessives homozygote (aabb) segregation ratio be 15:1.

The primer pair can be used for Large-scale Screening high oleic acid single plant, while can also gather microarray gel electrophoresis technology, make Detection efficiency improves, and realizes the high-throughput detection of base mutation, greatly improves the accuracy of high oleic acid peanut breeding Characters Identification, Accelerate breeding process, reliable technological means is provided for molecular marker assisted selection high oleic acid filial generation.

Embodiment 6：The verification of filial generation single plant Genotyping and oleic acid content

Contained using the common oleic acid that the sites gene 448bp AhFAD2A and the sites AhFAD2B gene 814bp are wild type Amount peanut varieties Ji spends No. 5 to assemble cross combination " spending No. 5 × C814T in Ji " with novel high oleic acid peanut mutant C814T, uses The method of pedigree method selection and strange land south numerous added-generation obtains F3:4 progeny populations, the group include 602 single plants.Using near-infrared Spectrometer measures the aliphatic acid relative amount of single plant full seed, extracts single plant genomic DNA using CTAB methods, is set using above-mentioned 8 primer sets for oleic acid dehydrogenase gene mutational site of meter carry out PCR amplification with 6 pairs of primer pairs, according to amplification Banding pattern determines AhFAD2A the and AhFAD2B genotype of single plant.Genotype is compared with oleic acid content and is listed in table 4.

By 4 result of table it was found that (1) is under the various backgrounds of AhFAD2A, the mutational sites AhFAD2B-814 are oily with height Acid shape is highly relevant, as under aa backgrounds AhFAD2B genotype from BB, Bb to bb, oleic acid content respectively from 40.83%, 50.59% increases 66.39%；(2) under same AhFAD2A backgrounds, the mutational sites AhFAD2B-814 homozygote single plant oleic acid contains Amount is more than heterozygote oleic acid content, and the homozygote single plant oleic acid content that the site is not mutated is minimum；(3) AhFAD2A and The mutational sites AhFAD2B combined influence oleic acid content, with increasing for mutational site (base) number, oleic acid content also carries therewith Height, no mutation wild type (AA:BB) oleic acid content 34.81%, 1 base mutation (Aa:BB or AA:Bb) oleic acid of genotype contains Measure average out to 35.79%, 2 base mutation (aa:BB,Aa:Bb or AA:Bb) the oleic acid content average out to 41.40% of genotype, 3 base mutation (aa:Bb or Aa:Bb) the oleic acid content average out to 51.08% of genotype, 4 bases are all mutated (aa:bb) Oleic acid content be 66.39%；(4) under the background that AhFAD2A or AhFAD2B have a side to mutate, AhFAD2B-814 is prominent Become and the increase rate of oleic acid content is mutated higher than AhFAD2A-448, i.e. AA:Bb genotype (oleic acid content 41.72%) compares aa: High 2.19%, the AA of BB genotype (40.83%) oleic acid content:Bb genotype (36.42%) is compared with Aa:BB genotype (35.16%) Oleic acid content is high by 3.57%.

The above result shows that the PCR genotyping results of AhFAD2B are consistent with oleic acid content variation, this hair is further demonstrated The bright nucleotide site is apparent to improving oleic acid content effect, and the mutational sites the AhFAD2B-814 special primer of exploitation can To be used to refer to peanut high-oil acid content character.

Table 4 " spending No. 5 × C814T in Ji " offspring's single plant AhFAD2 gene nucleotides mutational site and oleic acid content correlation

Note：A and B indicates AhFAD2A and AhFAD2B wild-type genotypes respectively；A and b indicate respectively AhFAD2A and AhFAD2B mutated-genotypes.

Embodiment 7：Specificity analysis of the novel mutation site in having high oleic acid peanut varieties

In order to confirm whether the mutational sites AhFAD2B-814 have specificity in other peanut varieties, we are to come from The genomic DNA of the high oleic acid kind of national difference peanut breeding unit selection and breeding is template, and the specific nucleotide is directed to exploitation The special primer in acid mutation site carries out PCR.In amplification procedure, No. 6 and H2O are spent as negative control, with mutant using Ji C814T is positive control, and reaction system and reaction condition is arranged, and obtains expected amplification, as shown in figure 13.Show selecting Do not occur the mutational sites AhFAD2B-814 of the present invention in the 21 high oleic acid peanut varieties selected, further demonstrates this It invents mutational site and is different from classical F435 types mutation, there is specificity.

SEQUENCE　LISTING

<110>Food and Oil Crops Inst., Hebei Agriculture and Forestry Academy

<120>A kind of high oleic acid peanut mutator AhFAD2B-814 and application

<160> 15

<170> PstentIn version 3.5

<210> 1

<211> 1323

<212> DNA

<213> Arachis hypogaea

<400> 1

acggccgcca gtgtgctgga attgcccttc agaaccatta gctttgtagt agtgcaaagt 60

gctaactctt tctttctaca ttggtaacag gagctttaac aacacaacaa tgggagctgg 120

agggcgtgtc actaagattg aagctcaaaa gaagcctctt tcaagggttc cacattcaaa 180

ccctccattc agtgttggcc aactcaagaa agcaattcca ccacattgct ttgaacgttc 240

tcttttcata tcattctcat atgttgtcta tgatctctta atggcctact tactcttcta 300

cattgccacc acttatttcc acaagcttcc atacccattt tccttccttg cttggccaat 360

ctattgggcc atccaaggct gcattctcac cggtgtttgg gtgattgctc atgagtgtgg 420

ccaccatgcc ttcagcaagt accaacttgt tgatgacatg gttggtttga cccttcactc 480

ttgtctatta gttccttatt tctcatggaa aatcagccac cgccgccacc actccaacac 540

aggttccctc gaccgcgacg aagtgtttgt cccgaaacca aaatcaaagg tatcatggta 600

taacaagtac atgaacaatc caccagggag ggctatttcc cttttcatca cactcacact 660

aggatggccc ttgtacttgg ccttcaatgt ttctggcaga ccctatgata gatttgcaag 720

ccactatgac ccttatgctc ccatatactc taacagggaa aggcttctaa tttatgtctc 780

agattcatct gtctttgctg taacatatct gctatatcac atagcaactt tgaaaggttt 840

gggttgggtg gtatgtgttt atggggtgcc attgctcatt gtgaatgggt ttctagttac 900

cataacctat ttgcagcaca catatgcatc attgcctcac tatgattcat ccgaatggga 960

ctggttaaga ggagcattgg caacagtgga cagagattat gggatactga ataaggcatt 1020

tcatcatata actgatacgc atgtggctca tcatttgttc tcaacaatgc ctcattacca 1080

tgcaatggaa gcaaccaatg caataaagcc aatattgggt gattactacc aatttgatgg 1140

caccccagtt tacaaagcat tgtggagaga agccaaagag tgcctctatg tggagccaga 1200

tgatggagct tctcagaagg gtgtttattg gtacaagaac aagttctgat gcatagtcag 1260

agaagggcaa ttctgcagat atccatcaca ctggcggccg ctcgagcatg catctagagg 1320

gcc 1323

<210> 2

<211> 379

<212> PRT

<400> 2

Met Gly Ala Gly Gly Arg Val Thr Lys Ile Glu Ala Gln Lys Lys Pro

1 5 10 15

Leu Ser Arg Val Pro His Ser Asn Pro Pro Phe Ser Val Gly Gln Leu

20 25 30

Lys Lys Ala Ile Pro Pro His Cys Phe Glu Arg Ser Leu Phe Ile Ser

35 40 45

Phe Ser Tyr Val Val Tyr Asp Leu Leu Met Ala Tyr Leu Leu Phe Tyr

50 55 60

Ile Ala Thr Thr Tyr Phe His Lys Leu Pro Tyr Pro Phe Ser Phe Leu

65 70 75 80

Ala Trp Pro Ile Tyr Trp Ala Ile Gln Gly Cys Ile Leu Thr Gly Val

85 90 95

Trp Val Ile Ala His Glu Cys Gly His His Ala Phe Ser Lys Tyr Gln

100 105 110

Leu Val Asp Asp Met Val Gly Leu Thr Leu His Ser Cys Leu Leu Val

115 120 125

Pro Tyr Phe Ser Trp Lys Ile Ser His Arg Arg His His Ser Asn Thr

130 135 140

Gly Ser Leu Asp Arg Asp Glu Val Phe Val Pro Lys Pro Lys Ser Lys

145 150 155 160

Val Ser Trp Tyr Asn Lys Tyr Met Asn Asn Pro Pro Gly Arg Ala Ile

165 170 175

Ser Leu Phe Ile Thr Leu Thr Leu Gly Trp Pro Leu Tyr Leu Ala Phe

180 185 190

Asn Val Ser Gly Arg Pro Tyr Asp Arg Phe Ala Ser His Tyr Asp Pro

195 200 205

Tyr Ala Pro Ile Tyr Ser Asn Arg Glu Arg Leu Leu Ile Tyr Val Ser

210 215 220

Asp Ser Ser Val Phe Ala Val Thr Tyr Leu Leu Tyr His Ile Ala Thr

225 230 235 240

Leu Lys Gly Leu Gly Trp Val Val Cys Val Tyr Gly Val Pro Leu Leu

245 250 255

Ile Val Asn Gly Phe Leu Val Thr Ile Thr Tyr Leu Gln His Thr Tyr

260 265 270

Ala Ser Leu Pro His Tyr Asp Ser Ser Glu Trp Asp Trp Leu Arg Gly

275 280 285

Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile Leu Asn Lys Ala Phe

290 295 300

His His Ile Thr Asp Thr His Val Ala His His Leu Phe Ser Thr Met

305 310 315 320

Pro His Tyr His Ala Met Glu Ala Thr Asn Ala Ile Lys Pro Ile Leu

325 330 335

Gly Asp Tyr Tyr Gln Phe Asp Gly Thr Pro Val Tyr Lys Ala Leu Trp

340 345 350

Arg Glu Ala Lys Glu Cys Leu Tyr Val Glu Pro Asp Asp Gly Ala Ser

355 360 365

Gln Lys Gly Val Tyr Trp Tyr Lys Asn Lys Phe

370 375

<210> 3

<211> 27

<212> DNA

<213> Arachis hypogaea

<400> 3

catatctgct atatcacata gcaactt 27

<210> 4

<211> 27

<212> DNA

<213> Arachis hypogaea

<400> 4

ggcttctctc cacaatgctt tgtaaac 27

<210> 5

<211> 29

<212> DNA

<213> Arachis hypogaea

<400> 5

agttaccata acctatttgc agcacaaac 29

<210> 6

<211> 26

<212> DNA

<213> Arachis hypogaea

<400> 6

gaatcatagt gaggcaatga tgccta 26

<210> 7

<211> 22

<212> DNA

<213> Arachis hypogaea

<400> 7

agtgagaatg cagccttgga tg 22

<210> 8

<211> 22

<212> DNA

<213> Arachis hypogaea

<400> 8

tgtgagtgtg atgaagaggg ag 22

<210> 9

<211> 19

<212> DNA

<213> Arachis hypogaea

<400> 9

accggttccc tcgacctca 19

<210> 10

<211> 23

<212> DNA

<213> Arachis hypogaea

<400> 10

ggttttggga caaacacttc ttc 23

<210> 11

<211> 25

<212> DNA

<213> Arachis hypogaea

<400> 11

gattactgat tattgacttg ctttg 25

<210> 12

<211> 25

<212> DNA

<213> Arachis hypogaea

<400> 12

cagaaccatt agctttgtag tagtg 25

<210> 13

<211> 24

<212> DNA

<213> Arachis hypogaea

<400> 13

ctctgactat gcatcagaac ttgt 24

<210> 14

<211> 22

<212> DNA

<213> Arachis hypogaea

<400> 14

ggtaccatgg gagctggagg gc 22

<210> 15

<211> 25

<212> DNA

<213> Arachis hypogaea

<400> 15

gaattctcag aacttgttct tgtac 25

Claims

1. a kind of high oleic acid peanut mutator AhFAD2B-814, which is characterized in that the mutator AhFAD2B-814's Nucleotide sequence is as shown in SEQ ID NO.1, by 1140 base compositions.

2. a kind of high oleic acid peanut mutator AhFAD2B-814 according to claim 1, which is characterized in that described Mutator AhFAD2B-814 includes ariyoshi base mutation at one：814C > T exist at SEQ ID NO.1 sequences 814bp The base replacement of C814T.

3. a kind of high oleic acid peanut mutator AhFAD2B-814, which is characterized in that the mutator AhFAD2B-814's Nucleotides sequence is classified as SEQ ID NO:Expression identical function egg of the nucleotide sequence shown in 1 through displacement, insertion or deletion driven The nucleotide sequence of white matter；Or with SEQ ID NO:Nucleotide sequence shown in 1 has 90% or more homology and the identical work(of expression The nucleotide sequence or complementary series of energy protein.

4. a kind of protein of high oleic acid peanut mutator AhFAD2B-814 codings as described in claims 1 or 2 or 3, It is characterized in that, the protein sequence of mutator coding is made of as shown in SEQ ID NO.2 379 amino acid residues, 272 amino acid residue of protein sequence is changed into tyrosine (Y) by histidine (H).

5. a kind of PCR primer of detection high oleic acid peanut FAD2B mutated-genotypes, it is characterised in that：

(1) primer pair AhAFD2B-C/AhFAD2B- of the design to the sites the 814bp base C amplifications of AhFAD2B wild type genes Ro,

AhAFD2B-C：5′—AGTTACCATAACCTATTTGCAGCACAAAC—3′；

AhFAD2B-Ro：5′—GGCTTCTCTCCACAATGCTTTGTAAAC—3′；

(2) primer pair AhFAD2B-Fo/AhFAD2B- of the design to the sites the 814bp base T amplifications of AhFAD2B wild type genes T,

AhFAD2B-Fo：5′—CATATCTGCTATATCACATAGCAACTT—3′；

AhFAD2B-T：5′—GAATCATAGTGAGGCAATGATGCCTA—3′；

AhFAD2B-Fo：5′—CATATCTGCTATATCACATAGCAACTT—3′；

AhFAD2B-Ro：5′—GGCTTCTCTCCACAATGCTTTGTAAAC—3′.

6. a kind of detection sides PCR using the PCR primer for detecting high oleic acid peanut FAD2B mutated-genotypes described in claim 5 Method, which is characterized in that include the following steps：

(1) PCR amplification：

PCR reaction systems：Containing 1 μ L genomic DNA templates (20ng/ μ L), 2 10 × Buffer of μ L, 1.5 μ L MgCl₂、2μL DNTP (2.5mM each), 0.3 μ L Taq enzymes (0.5U), each 1.0 μ L of AhFAD2B-C and AhFAD2B-T primers, AhFAD2B-Fo With each 0.1 μ L of AhFAD2B-Ro primers, 11 μ L ddH₂O；

PCR amplification program：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 30s, 59 DEG C annealing 30s, 72 DEG C extension 1min10s, totally 35 Cycle；72 DEG C of extension 10min；

7. PCR primer described in claim 5 is in the height oil containing the mutational sites AhFAD2B homologous gene nucleotide sequence C814T Sour peanut varieties (are) application in selection and breeding.