CN108753725A - The human liver cell system of human serum albumin height expression and its method for building up and application - Google Patents
The human liver cell system of human serum albumin height expression and its method for building up and application Download PDFInfo
- Publication number
- CN108753725A CN108753725A CN201810503675.6A CN201810503675A CN108753725A CN 108753725 A CN108753725 A CN 108753725A CN 201810503675 A CN201810503675 A CN 201810503675A CN 108753725 A CN108753725 A CN 108753725A
- Authority
- CN
- China
- Prior art keywords
- liver cell
- human
- serum albumin
- human liver
- cell system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/067—Hepatocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3804—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by specific cells or progenitors thereof, e.g. fibroblasts, connective tissue cells, kidney cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3839—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by the site of application in the body
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/76—Albumins
- C07K14/765—Serum albumin, e.g. HSA
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2430/00—Materials or treatment for tissue regeneration
- A61L2430/28—Materials or treatment for tissue regeneration for liver reconstruction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/02—Cells for production
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Transplantation (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Dermatology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Oral & Maxillofacial Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- General Engineering & Computer Science (AREA)
- Vascular Medicine (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of human liver cell system of human serum albumin height expression and its method for building up and applications, belong to genetic engineering field.Complex functionality to improve hepatic cell line as final goal, is selected Expression of Albumin relevant gene (ALB, gene I/D by the present invention:213), by way of slow-virus transfection, CRISPR/dCas9 systematic protein compound Synergistic Activation Mediator (SAM) genome is set to be inserted into cell line genome, so that cell line is stablized expression and be overexpressed compound, to realize that the overexpression for albumin regulates and controls.The human liver cell system for the human serum albumin height expression that the present invention establishes can be used as cell source in Biotype artificial liver system.
Description
Technical field
The invention belongs to genetic engineering fields, specifically, be a kind of expression of human serum albumin height human liver cell system and
Its method for building up and application.
Background technology
Artificial Liver Support System by means of machinery, the device of physics by removing the noxious materials such as endotoxin, bilirubin,
The noxious materials such as albumin, amino acid, coagulation factor are supplemented, the supporting function of liver is temporarily played.Clinical treatment outcome is shown：
Artificial Liver Support System can significantly improve the clinical cure of hepatic failure, improvement rate.However, Non-biotype artificial liver supports system
The functions such as synthesis, metabolic function and the bioconversion of liver cannot be still substituted completely.Being separately cultured and preserving with liver cell
Technology, liver cell large-scale culture technology and bioreactor are increasingly ripe, using liver cell as the bion of bioactive ingredients
Artificial liver (bioartificial liver, BAL) becomes the hot spot of artificial liver research.Its dependence inoculation of Biotype artificial liver
Liver cell in bioreactor can provide the secretion of liver, be metabolized, the functions such as bioconversion and removing toxic substances, in theory
It says, can almost replace the repertoire of liver.
Albumin (albumin, ALB) is synthesized by liver parenchymal cell, accounts for the 40%-60% of Total plasma protein, is serum
In major protein components.Albumin has important physiological function in body：Maintain the constant of plasma colloid osmotic pressure；
It can reversibly be combined with the small organic molecule of internal many slightly solubilities and inorganic ions and to form the compound of ease of solubility, become this
A little types of transportation of the substance in blood circulation；It can guarantee intracellular fluid, extracellular fluid and exchanging between tissue fluid, play one kind
The stabilization of colloid protection；Albumin is that a kind of important nutriment, in-vivo content are directly related to liver and decline in human body
Exhaust the prognosis of patient.
Invention content
The primary purpose of the present invention is that providing a kind of human liver cell system of human serum albumin height expression, it is named as
HepG2N, which is characterized in that the human liver cell system is preserved in China typical culture collection center, and deposit number is
CCTCC NO:C201872, the deposit date is on April 10th, 2018.
Further, the human liver cell system is to deliver regulatory protein genome using slow virus carrier, is integrated into
Cell line obtained from archaeocyte genome.
Further, it includes three kinds of lentiviral particles that the slow virus carrier, which has altogether, delivers three kinds respectively
The regulatory protein genome of the active element of Synergistic Activation Mediator (SAM) protein complexes, i.e.,
DCas9-VP64, MS2-p65-HSF1 and targeting specific sgRNA.
Further, the regulatory protein genomic expression SAM protein complexes of the active element activate original paper, combination
As SAM protein complexes.
Further, include screening-gene in the slow virus carrier, will also be integrated into archaeocyte base together
Because in group.
Further, the screening-gene is selected from puromycin Puro, blasticidin S Blast and hygromycin Hygro.
The second object of the present invention is to provide a kind of method for building up of the human liver cell system of human serum albumin height expression, including
Following steps：A) by promoter regulation, include the plasmid of target gene and screening-gene；The promoter is selected from cytomegalovirus
Promoter (CMV promoter), the target gene is selected from：DCas9-VP64 albumen, MS2-P65-HSF1 albumen and targeting are special
Anisotropic sgRNA (ALB)；The screening-gene is selected from：Puromycin Puro, blasticidin S Blast and hygromycin Hygro；
B) plasmid for obtaining step a) packs out Lenti respectively with psPAX2, pMD2.G cotransfection 293T cells
DCAS-VP64_Blast, Lenti ALB-MS2_Puro and tri- kinds of slow virus carriers of Lenti MS2-P65-HSF1_Hygro
Grain；
C) the slow virus carrier particle coinfection human liver cell HepG2 for obtaining step b)；
D) work is screened, the human liver cell of Puro, Blast and Hygro resistant gene is carried；
E) by human liver cell secondary culture obtained by step d), the human liver cell system of human serum albumin height expression is established
HepG2N。
The human liver cell that the third object of the present invention is to provide the human serum albumin height expression ties up to Biotype artificial liver
Application in system.
Further, the human liver cell system is as the cell source in Biotype artificial liver system.
Compared with the existing technology, beneficial effects of the present invention are as follows：Its dependence of Biotype artificial liver is inoculated in biological respinse
Liver cell in device can provide the functions such as synthesis, secretion, metabolism, bioconversion and the removing toxic substances of liver, and albumin synthesis is
One of important embodiment of liver cell complex functionality.Albumin can maintain the constant of plasma colloid osmotic pressure, energy and body in body
The small organic molecule and inorganic ions of interior many slightly solubilities reversibly combine the compound for forming ease of solubility, become these substances
Types of transportation in blood circulation, moreover it is possible to ensure intracellular fluid, extracellular fluid and exchanging between tissue fluid, play a kind of colloid
The stabilization of protection.Hepatic cell line HepG2, C3A and primary hepatocyte etc. used in existing Biotype artificial liver system are thin
Born of the same parents are that albumin complex functionality does not protrude.The present invention makes CRISPR/dCas9 systems by way of lentivirus-mediated
Albumen composition Synergistic Activation Mediator (SAM) genome is inserted into cell line genome, is made thin
Born of the same parents are that stabilization expressed albumen composition SAM.Compound SAM can target the gene loci of positioning albumin, on this basis
The recruitment for increasing transcription factor, to realize that the overexpression for albumin regulates and controls.Shown in the present invention by relevant experimental data
Cell line HepG2N albumin exocytosis levels be about 5 times of archaeocyte, albumin gene expression is about original table
Up to 2 times of amount, CYP7A1 expressions are also significantly increased, and Western Blot confirm that intracellular albumin also increases compared with archaeocyte system
By force.Therefore, the cell line HepG2N in the present invention can be used as one of the cell source of Biotype artificial liver.
Description of the drawings
Figure 1A is the structure chart of Lenti dCAS-VP64_Blast plasmids；
Figure 1B is the structure chart of Lenti ALB-MS2_Puro plasmids；
Fig. 1 C are the structure chart of Lenti MS2-P65-HSF1_Hygro plasmids；
Fig. 2A is the contrasting detection result that the present invention detects ALB contents in two plants of cell line culture medium supernatants by ELISA
Figure；
Fig. 2 B survey canonical plotting by ELISA kit；
Fig. 3 is the contrasting detection result figure that the present invention detects two plants of cell line intracellular ALB contents by Western Blot；
Fig. 4 is the contrasting detection result figure that the present invention detects two plants of cell line ALB gene expressions by RT-qPCR.
Specific implementation mode
Below in conjunction with specific embodiment, the invention will be further described.It please understand, only be the preferred reality of the present invention below
Mode is applied, the present invention is not limited to following embodiments.
Specific implementation condition in the following example is according to normal condition, such as《Molecular Cloning:A Laboratory guide (former book the 4th
Version)》(M.R. Green, J. Pehanorm Brookers chief editor, just master translates He Fu, Science Press, 2017.3)
Material requested is as shown in table 1 in the following example.
Material requested in 1. embodiment of table
Embodiment：
1. the packaging of slow virus
Before 1.1 transfections for 24 hours, 293T cells are laid in 6 orifice plates, per about 10^6, hole cell, wait for that cell grows to 60%-
70% fusion.
1.2 take 1.5ml sterilizing EP pipes, and 0.75 μ g packaging mixing plasmids (psPAX2 and pMD2.G), 1 μ g expression plasmids is added
(Lenti dCAS-VP64_Blast or Lenti ALB-MS2_Puro or Lenti MS2-P65-HSF1_Hygro, their matter
The structure chart of grain is as shown in Figure 1A, Figure 1B and Fig. 1 C), the Opti-Mem of the P3000 of 6 μ l and 250 μ l.Soft mixing, room temperature
It is incubated 5min.
1.3 take 1.5ml sterilizing EP pipes, and 7 μ l Lipo3000 is taken to be dissolved in the Opti-Mem of 250 μ l.Soft mixing, room temperature are incubated
Educate 5min.
1.4 liang of pipes mix well, and are incubated at room temperature 20min.
1.5 being incubated：Mixed liquor is added dropwise in cell, gently mixing is placed on 37 DEG C of incubations containing 5%CO2.
1.6 change liquid：Culture medium is sucked after 10h, and the complete medium (DMEM) of appropriate 37 DEG C of preheatings is added, continues cell
Place incubation.
1.7 collect viral supernatants：The supernatant containing slow virus is collected for 24 hours.Using 0.45um filters filter after packing freeze in-
80℃。
2. slow-virus infection aim cell
Before 2.1 infection dyes for 24 hours, aim cell is laid on 12 orifice plates, per about 5*10^5, hole cell, waits for that cell is grown to
60%-70% is merged.
2.2 take three 1.5ml sterilizing EP pipes, are separately added into 1：1,1：10 and 1：100 slow virus liquid, has sequentially added
Full culture medium (DMEM) and polybrene, it is the final concentration of 8 μ g/ml of 1ml and polybrene to make total volume.Piping and druming, mixing.
2.3 suck original culture medium in cell plates, and cell is placed incubation by the mixed liquor being separately added into centrifuge tube
Culture is for 24 hours.
2.4 are sucked out the culture medium containing slow virus after 24h, and 1ml complete mediums (DMEM) are added, cell is placed incubator
Culture is incubated to 48h.
2.5 are sucked out culture medium after 48h, are added containing puromycin (Puromycin), blasticidin S
(Blasticidin) and the complete medium of hygromycin (Hygromycin), screen stablize transduction cell strain (two to three days into
Row changes liquid).
After 2.6 screenings 7-10 days, picking single cell clone is put into 6 orifice plates after digestion and is expanded, to be stablized
Human serum albumin high (ALB) expression human liver cell system HepG2N.
3.ELISA kits detect the extracellular albumin of two plants of cell lines and secrete situation
Stable cell line HepG2N and archaeocyte system HepG2 are laid on 12 orifice plates, per about 5*10^5, hole cell, point
Cell conditioned medium parallel 1 for 24 hours is not collected：50 dilutions.By supernatant stoste, dilution and the detection of standard items common row ELISA kit,
According to the albumin concentration in the standard curve conversion cell conditioned medium of fitting completion and carry out the comparison between cell line.Operation stream
Journey is as follows, as a result such as Fig. 2A.
1) standard items are subjected to multiple proportions concentration dilution.Final concentration is respectively 0ng/ml, 3.125ng/ml, 6.250ng/ml,
12.50ng/ml, 25.00ng/ml, 50.00ng/ml, 100.00ng/ml and 200.00ng/ml；
2) standard items and each 50 μ l of sample is added in every hole, is incubated 1 hour at room temperature；
3) 1 × washing lotion, 200 μ l are added in every hole, are washed 5 times per hole；
4) 1 × Biotinylated ALB antibody, 50 μ l are added in every hole, are incubated 30 minutes；
5) it cleans, respectively washes 5 times again；
6) 1 × SP crosslinking agents, 50 μ l are added in every hole, are incubated 30 minutes；
7) it cleans, respectively washes 5 times again；
8) 50 μ l of color developing agent are added in every hole, are incubated 25 minutes；
9) 50 μ l of terminate liquid, read plate, wavelength 450nm is added in every hole.
10) reading is subjected to standard curve fit conversion, ultimate density result figure 2A.Fig. 2 B are surveyed by ELISA kit
Standard curve.
4.RT-qPCR detects two plants of cell line albumin gene expressions
Stable cell line HepG2N and archaeocyte system HepG2 are laid on 12 orifice plates, per about 5*10^5, hole cell, used
Column formulation extracts cell total rna for 24 hours respectively, takes 1 μ g total serum IgEs reverse transcriptions at cDNA, and PCR expansions are carried out by template of 1 μ l cDNA
Increase.Reverse transcription system and amplification system are as follows, and analysis result is as schemed.
1) reverse transcription system：
Reaction condition：37 DEG C, 15 minutes；85 DEG C, 5 seconds；It 4 DEG C, preserves.
2) PCR amplification system：
Primer：
CYP7A1-F:GCAATTTGGTGCCAATCCTCT
CYP7A1-R:GCACAACACCTTATGGTATGACA
ALB-F:GATGCCTGCTGACTTGCCTTC
ALB-R:TCAGCAGCAGCACGACAGAGTA
Actin-F:TCACCACCACGGCCGAGCG
Actin-R:TCTCCTTCTGCATCCTGTCG
Reaction condition：The first step：95 DEG C, 30 seconds, recurring number 1；Second step：It 95 DEG C, 5 seconds, 60 DEG C, 34 seconds, follows
Number of rings 40.
3) analysis result such as Fig. 3.
5.Western Blot detect two plants of cell line intracellular albumin amounts
Stable cell line HepG2N and archaeocyte system HepG2 are laid on 12 orifice plates, per about 5*10^5, hole cell, used
RIPA Buffer cracking process lytic cells, collect total protein of cell for 24 hours respectively；Lowry methods survey albumen concentration, take 50 μ g respectively
Albumen carries out polyacrylamide gel electrophoresis (SDS-PAGE), electrophoretic parameters 80V, 10 minutes；130V, 50 minutes.Then will
On protein delivery to pvdf membrane on polyacrylamide gel, transferring film parameter：300mA, 60 minutes.Anti-ALB mono- is used after the completion
Anti-, closing is overnight.The expression that ALB in each protein sample is detected with the secondary antibody marked with HRP in second day.As a result such as Fig. 4.
By the above testing result it is found that the HepG2N in the present embodiment has significantly compared to original cell line indices
It improves.Wherein, ALB exocytosis amount is about 5 times of original secretory volume；Gene expression dose is about 2 times of original expression quantity,
CYP7A1 expressions are also significantly increased；Western Blot confirm that intracellular ALB also enhances earlier above.Therefore, HepG2N can be with
The overexpression that ALB is successfully realized on the basis of keeping other function-stables, can be used for Biotype artificial liver system, be it is a kind of compared with
Suitable ideal cell source.
Claims (9)
1. a kind of human liver cell system of human serum albumin height expression, is named as HepG2N, which is characterized in that the human liver cell
System is preserved in China typical culture collection center, and deposit number is CCTCC NO:C201872, the deposit date is 2018 4
The moon 10.
2. the human liver cell system of human serum albumin height expression according to claim 1, which is characterized in that the people liver is thin
Born of the same parents system is to deliver regulatory protein genome, cell line obtained from being integrated into archaeocyte genome using slow virus carrier.
3. the human liver cell system of human serum albumin height expression according to claim 2, which is characterized in that the slow virus
It includes three kinds of lentiviral particles that carrier, which has altogether, delivers the regulatory protein genome of the active element of three kinds of protein complexes respectively,
That is dCas9-VP64, MS2-p65-HSF1 and targeting specific sgRNA.
4. the human liver cell system of human serum albumin height expression according to claim 3, which is characterized in that the activation member
The regulatory protein genomic expression SAM protein complexes of part activate original paper, are combined into SAM protein complexes.
5. the human liver cell system of human serum albumin height expression according to claim 4, which is characterized in that the slow virus
Include screening-gene in carrier, also will together be integrated into archaeocyte genome.
6. the human liver cell system of human serum albumin height expression according to claim 5, which is characterized in that the screening base
Because being selected from puromycin, blasticidin S and hygromycin.
7. a kind of method for building up of the human liver cell system of human serum albumin height expression, which is characterized in that include the following steps：
A) by promoter regulation, include the plasmid of target gene and screening-gene；The promoter starts selected from cytomegalovirus
Son, the target gene are selected from：DCas9-VP64 albumen, MS2-P65-HSF1 albumen and targeting specific sgRNA；The screening
Gene is selected from：Puromycin, blasticidin S and hygromycin；
B) plasmid for obtaining step a) packs out Lenti dCAS- respectively with psPAX2, pMD2.G cotransfection 293T cells
VP64_Blast, Lenti ALB-MS2_Puro and tri- kinds of slow virus carrier particles of Lenti MS2-P65-HSF1_Hygro；
C) the slow virus carrier particle coinfection human liver cell HepG2 for obtaining step b)；
D) work is screened, the human liver cell of Puro, Blast and Hygro resistant gene is carried.
E) by human liver cell secondary culture obtained by step d), the human liver cell system HepG2N of human serum albumin height expression is established.
8. the human liver cell of human serum albumin height expression according to claim 1 ties up to answering in Biotype artificial liver system
With.
9. application according to claim 8, which is characterized in that the human liver cell system is as in Biotype artificial liver system
Cell source.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810503675.6A CN108753725A (en) | 2018-05-23 | 2018-05-23 | The human liver cell system of human serum albumin height expression and its method for building up and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810503675.6A CN108753725A (en) | 2018-05-23 | 2018-05-23 | The human liver cell system of human serum albumin height expression and its method for building up and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108753725A true CN108753725A (en) | 2018-11-06 |
Family
ID=64005014
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810503675.6A Withdrawn CN108753725A (en) | 2018-05-23 | 2018-05-23 | The human liver cell system of human serum albumin height expression and its method for building up and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108753725A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109504709A (en) * | 2018-11-28 | 2019-03-22 | 上海安民生物技术有限公司 | The albumin expression vectors of albumin promoter driving |
| CN109706168A (en) * | 2019-01-08 | 2019-05-03 | 清华大学 | A kind of carrier for the expression promoting kluyveromyces marxianus target gene |
| CN110218741A (en) * | 2019-05-31 | 2019-09-10 | 华中农业大学 | Multiple active methods of pig endogenous retinal stem cells factor transcription are activated using series connection sgRNA is synchronous |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101679945A (en) * | 2006-12-29 | 2010-03-24 | 梅迪斯蒂生物科技有限公司 | Differentiated immortalised cell lines capable of producing albumin and blood coagulation factors, methods of preparing thereof from a leukaemia cell line and uses thereof |
-
2018
- 2018-05-23 CN CN201810503675.6A patent/CN108753725A/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101679945A (en) * | 2006-12-29 | 2010-03-24 | 梅迪斯蒂生物科技有限公司 | Differentiated immortalised cell lines capable of producing albumin and blood coagulation factors, methods of preparing thereof from a leukaemia cell line and uses thereof |
Non-Patent Citations (4)
| Title |
|---|
| FEI TENG ET AL.: "Treatment with an SLC12A1 antagonist inhibits tumorigenesis in a subset of hepatocellular carcinomas", 《ONCOTARGET》 * |
| SILVANA KONERMANN ET AL.: "Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex", 《NATURE》 * |
| XIONG ET AL. ET AL.: "Guided Activation of Pluripotency Genes in Human Fibroblasts", 《CELULAR REPROGRAMMING》 * |
| 吴青松等: "人源肝细胞系CL-1、HepFMMU、HepG2、C3A生物学特性与功能的比较", 《实用医学杂志》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109504709A (en) * | 2018-11-28 | 2019-03-22 | 上海安民生物技术有限公司 | The albumin expression vectors of albumin promoter driving |
| CN109504709B (en) * | 2018-11-28 | 2020-07-24 | 上海安民生物技术有限公司 | Albumin expression vector driven by albumin promoter |
| CN109706168A (en) * | 2019-01-08 | 2019-05-03 | 清华大学 | A kind of carrier for the expression promoting kluyveromyces marxianus target gene |
| CN110218741A (en) * | 2019-05-31 | 2019-09-10 | 华中农业大学 | Multiple active methods of pig endogenous retinal stem cells factor transcription are activated using series connection sgRNA is synchronous |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yan et al. | Establishment of efficient genetic transformation systems and application of CRISPR/Cas9 genome editing technology in Lilium pumilum DC. Fisch. and Lilium longiflorum White Heaven | |
| CN108753725A (en) | The human liver cell system of human serum albumin height expression and its method for building up and application | |
| JP3764959B2 (en) | Cell culture container and cell culture method | |
| JPH07504570A (en) | Methods, compositions and devices for maintaining and growing human stem cells and/or hematopoietic cells | |
| JPH03503718A (en) | Modified hepatocytes and their uses | |
| CN107523588A (en) | A kind of tetracycline slow virus inducible expression carrier and its method for building up and application | |
| JPH06500927A (en) | Sustained and continuous production of high titer recombinant viral vectors and transduced target cells for gene therapy | |
| CN113801223A (en) | Neutralizing antibody against SARS-COV-2 of severe acute respiratory syndrome type II coronavirus | |
| CN109504709A (en) | The albumin expression vectors of albumin promoter driving | |
| JPH05505944A (en) | Modified hepatocytes and their uses | |
| Fusco et al. | Transformation of rat thyroid epithelial cells by Kirsten murine sarcoma virus | |
| CN103898162A (en) | Method for detecting plasmids of polycyclic aromatic hydrocarbons in environment and application thereof | |
| CN109868280A (en) | 2 gene overexpression slow virus of nitricoxide synthase, corresponding gene carrier and its preparation method and application | |
| Sonnenschein et al. | Loss of growth hormone production following hybridization of a functional rat pituitary cell strain with a mouse fibroblast line | |
| CN102584975B (en) | Nucleolar targeting signal peptide as well as coding gene and application thereof | |
| CN102392047B (en) | Bicistronic mRNA (messenger ribonucleic acid) expression vector suitable for cells of mammals and application thereof | |
| JPH0156051B2 (en) | ||
| CN104073514A (en) | Method of preparing pluripotency stem cell | |
| Cho et al. | Revertants of human cells transformed by murine sarcoma virus | |
| Rockman et al. | Expression of interleukin‐6, leukemia inhibitory factor and their receptors by colonic epithelium and pericryptal fibroblasts | |
| CN105274089B (en) | A kind of construction method for the REV viral infectivities clone for expressing green fluorescence cyst membrane fusion protein | |
| CN114164176A (en) | Human bladder cancer cis-platinum drug-resistant cell strain and application thereof | |
| CN106075396A (en) | The application of Cul4 albumen | |
| CN111961681A (en) | Method for enriching exosomes in extracellular matrix, ECM biomaterial rich in exosomes and application | |
| CN109456993A (en) | The albumin expression vectors of the promoter containing CAG |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20181106 |