CN108752443A - Rice CYC U2；1 gene is in the control developmental application of rice mesocotyl - Google Patents

Abstract

The invention belongs to plant genetic engineering fields, disclose rice CYC U2；1 gene is controlling the developmental application of rice mesocotyl, it is found by the applicant thatCYC U2;1（Os04g46660）Specifically plumular axis is expressed in rice, and CDS sequences are shown in SEQ ID NO.2, and the amino acid sequence of coding is shown in SEQ ID NO.3.The present invention also provides the promoter sequence of the gene, sequence is shown in SEQ ID NO.1.By CYC U2;1 promoter and overall length CDS is cloned on pCAMBIA1301, is transferred in Nipponbare, and it is longer than wild type that the transgenosis system obtained shows as mesocotyl length, therefore is passed through technique for gene engineering and improved or weakenCYC U2;1The expression quantity of gene can control the development of plant mesocotyl, and the Emergence after seed sowing is improved so as to improve plant plant type.

Description

Rice CYC U2；1 gene is in the control developmental application of rice mesocotyl

Technical field

The invention belongs to plant genetic engineering fields.More particularly to rice CYC U2；1 gene is in control rice mesocotyl hair Application in educating is filtered out using the method for reverse genetics in the specifically expressed CYC U2 of mesocotyl；1, utilize pCYCU2- GUS transgenosis systems prove CYC U2；1 promoter is specifically expressed at mesocotyl；CYC U2 are improved by transgenosis；1 table CYC U2 are reduced up to amount and RNAi technology；1 expression quantity proves CYC U2；The 1 gene base that rice mesocotyl is developed in order to control Cause.

Background technology

Plumular axis is an important phenotype during vegetable seeds and seedling development, and the plumular axis of plant can divide from top to bottom For epicotyl, mesocotyl and hypocotyl.Epicotyl is often referred to the part from plumule to plumule section, and mesocotyl is often referred to plumule The part between grass scultellum is saved, hypocotyl is often referred to dicot cotyledons section or grass scutellum node arrives Part between radicle.In arabidopsis, the entire plumular axis phenotype of hypocotyl main representative, and in rice, due to epicotyl With hypocotyl almost without development, so the entire plumular axis phenotype of mesocotyl main representative.In the grasses such as rice, according to Elongation by mesocotyl can be by plant embryo with upper bit top to soil top, to make the seedling of earth's surface or more organize to carry out For normal photosynthesis to provide nutrition for the normal development of plant, it is also in passing through that in addition rice root, which absorbs extraneous air, The ventilating slit of plumular axis mediates (Zheng mutually such as, 1998) of completion, therefore mesocotyl is very heavy for the growth and development of plant It wants.

There are mainly two types of seeding methods for rice：Live streaming and seedling transplanting.Compared with traditional seedling transplanting, more using live streaming Add simplicity, more saves labour, more save the time, more efficiently (woods build honor etc., 2006), therefore direct sowing of rice in recent years It is increasingly taken seriously in China.However direct sowing of rice also has its limitation, because of the increase of live streaming seed depth in the soil Soil emergence in rice paddy seed top can be made more difficult, to make emergence rate decline, yield declines.The process however the top soil of rice is emerged Rely primarily on the elongation ability of its mesocotyl, this is because under soil dark condition, in During Rice Seed Germination, only in The length of plumular axis is extended.Therefore the better rice varieties of mesocotyl elongation ability under dark condition, push up soil emergence Ability is stronger, emergence rate it is also higher (Dilday et al., 1990；Turner et al.,1982；It is identical to open light, 2005).Cause The elongation ability of this rice mesocotyl has a very important significance the agricultural production of direct seading rice.

Invention content

The purpose of the present invention is to provide rice CYC U2；1 gene (Os04g46660) is in control rice mesocotyl development In application, the gene cloning from rice mesocotyl, include promoter region shown in SEQID.NO.1, have SEQ ID CDS sequences shown in NO.2 nucleotide, amino acid sequence shown in gene code SEQID.NO.3；Pass through CYC U2；1 gene Promoter (SEQ ID.NO：Sequence shown in 1) driving CYC U2；1 gene overexpression in rice plant can promote embryo in rice Emergence is broadcast live so as to improve rice varieties in elongate axis.

To achieve the goals above, the present invention takes following technical measures：

Applicant clones CYC U2 by the method for reverse genetics from rice mesocotyl；1, utilize real-time QRT-PCR demonstrates CYC U2；1 specificity expressed at mesocotyl.

Rice CYC U2；1 gene is in the control developmental application of rice mesocotyl, including the use of gene provided by the invention Or the protein of its coding, for controlling the development of rice mesocotyl；Or it is used for rice breeding；Or improves plant plant type and improve Emergence after seed sowing.

In above-described application, the CYC U2；The CDS sequences of 1 gene be SEQ ID NO.2 shown in, coding Amino acid is shown in SEQ ID NO.3；

In above-described application, it is preferred that the CYC U2；1 gene can utilize primer using rice cDNA as template C YC U2-1306-F and CYC U2-1306-R expand to obtain：

CYC U2-1306-F：CGGGATCCATGGCGTCCACTGAGTTAGCGTCGG

CYC U2-1306-R：GCTCTAGACTGGGCTGCCGCCGACGCCGCTTGC.

In above-described application, it is preferred that including by CYCU2；1 promoter and overall length CDS is cloned into It on pCAMBIA1301, is transferred in rice, the transgenosis system obtained shows as mesocotyl length and becomes than wild type (Nipponbare) It is long, therefore mesocotyl elongation can be promoted by this method, to improve seed sowing Emergence.

Compared with prior art, the present invention has the following advantages：

1.CYC U2；1 is one in rice seedling mesocotyl position specifically expressed gene, this makes only to change using the gene Become crop plumular axis length, is possibly realized without influencing other characters.

2.CYC U2；1 is the effective gene of a change mesocotyl length, it can be by directly affecting mesocotyl position Cell division, and then change the mesocotyl length of crop.

3. currently, not known to the molecular mechanism of rape element sterol and only angle gold lactone regulation and control mesocotyl length, the base Because disclosing it as rape element sterol and the key element of only angle gold lactone signal passage downstream, point of regulation and control mesocotyl development Handset system.

Description of the drawings

Fig. 1 is Real-timePCR experimental verification CYC U2；1 plumular axis specifically expressing schematic diagram in rice.

Fig. 2 is pCYCU2：：GUS transgenic paddy rice GUS coloration result schematic diagrames.

Fig. 3 is pCYCU2::CYC U2；1 Transgenic Rice Seedlings mesocotyl phenotype and maturity period plant phenotype schematic diagram.

Fig. 4 is RNAi-CYC U2；1 Transgenic Rice Seedlings mesocotyl phenotype and maturity period plant phenotype schematic diagram.

Fig. 5 is multiple independent pCYCU2：：CYCU2；1 and RNAi-CYC U2；The phenotype and expression quantity of 1 transgenic line Analyze schematic diagram.

Specific implementation mode

Technical solution of the present invention is if not otherwise specified the conventional scheme of this field, the reagent or biological material Material, if not otherwise specified, discloses.

Embodiment 1：

A kind of gene C YC U2 of control rice mesocotyl development；1 acquisition：

Inventor clones CYC U2 by the method for reverse genetics from rice mesocotyl；1, utilize Real-timePCT Verify CYCU2；1 includes in the specifically expressed position of mesocotyl, specific steps：

Gene C YC U2；1 clone：

The total volume of reaction system is 50 μ l, and template is Nipponbare cDNA 1ul (about 50ng), 10 × KOD enzyme reactions buffer 5 μ l of liquid, 25mM MgCL₂2 μ l, 5 μ l of 5mM dNTP, 5 μ l of 5uM primers (use substep PCR modes, use primer CYC U2- 1306-F and CYC U2-1306-R (every primer is 2.5 μ l), 1 μ l KOD enzymes, add ddH₂O (aseptic deionized water) to 50 μ l。

Response procedures are：94 DEG C of denaturation 5min, 94 DEG C of 30s, 55 DEG C of 1min, 68 DEG C of 2min 35cycles, 68 DEG C of extensions 10min。

The primer is as follows：

CYC U2-1306-F:CGGGATCCATGGCGTCCACTGAGTTAGCGTCGG

CYC U2-1306-R:GCTCTAGACTGGGCTGCCGCCGACGCCGCTTGC

Final acquisition includes the CYC U2 of nucleotide described in SEQ ID NO.2；1 gene order, the ammonia of the gene code Base acid sequence is shown in SEQ ID NO.3.

Real time qRT-PCT verification CYC U4；1 in rice pulvinus specifically expressing：

1 week rice Nipponbare seedling of grown in darkness, takes aerial part and mesocotyl, utilizes TiangenRNApre respectively Plant Kit (Tiangen) extract total serum IgE, then utilize Takara PrimeScript First-strand cDNA Synthesis kit (T aKaRa) synthesize the first chain cDNA, then utilize real-time quantitative PCR detection aerial part and mesocotyl In CYCY U2；1 relative expression quantity.Real-time quantitative PCR primer：RT-CYC U2-F：GTCGCCTCCAAGTTCGTC；RT- CY C U2-R：GTAGCTCTGGAACACGCTG.It was found that gene C YC U2；1 specific expressed at pulvinus (Fig. 1).

Embodiment 2：

CYC U2；Application of 1 gene in controlling rice mesocotyl, application process are as follows：

1) plant expression vector pCYCU2；The structure of 1-GUS

Expand CYC U2；Segment is cloned into pCAMBIA1300GN by 1 promoter region using MfeI/KpnI restriction enzyme sites GUS(Ren Z H,Gao J P,Li L G,et al.A rice quantitative trait locus for salt tolerance enco des a sodium transporter[J].Nature genetics,2005,37(10):1141- 1146.) on carrier.

The CYC U2；1 promoter region obtains in the following manner：

The total volume of reaction system is 50 μ l, and template is Nipponbare genomic DNA 1ul (about 50ng), 1 × KOD enzyme reactions 5 μ l of buffer solution, 25mM MgCL₂2 μ l, 5 μ l of 5mM dNTP, 5 μ l of 5uM primers (primer CYC U2Pro-F and C YC U2Pro- R distinguish 2.5 μ l), 1 μ l KOD enzymes, add ddH₂O (aseptic deionized water) to 50 μ l.Response procedures are：94 DEG C denaturation 5min, 94 DEG C 30s, 55 DEG C of 1min, 68 DEG C of 2min 35cycles, 68 DEG C of extension 10min.

The primer is as follows：

CYC U2Pro-F:CCGcaattgACCAGACAATTTCATTCACCAAACA

CYC U2Pro-R:GGggtaccCTCCTGAAGAATTCAATGGCAAAAG

It is final to obtain containing CYC U2 shown in SEQ.ID.No.1；1 gene promoter region.

2) plant expression vector pCYCU2::CYC U2；1 structure

Using the method for fractional steps first by CYC U2；1 promoter region (the same step 1) of amplification method of promoter region) is connected to pCAM BIA1301 obtains pCAMBIA1301-pCYCU2；1, it then will be connected with the CYC U2 of FLAG labels again；1 overall length c DNA (SEQ Shown in ID NO.2) using BamHI/Xba1 it is cloned into pCAMBIA1301-pCYCU2；On 1, plant expression vector is obtained pCYCU2::CYC U2；1, it is transferred in Nipponbare.

3) plant expression vector RNAi-CYC U2；1 structure

By CYC U2；1 (- 168-200) is cloned into RNAi carrier p using Kpn1/BamH1 and Sac1/Spe1 restriction enzyme sites On TCK303, plant expression vector RNAi-CYC U2 are obtained；1, it is transferred in Nipponbare, the CYC U2；1(-168-200) It is using Nipponbare cDNA as template, with primer CYC U2-RNAi-U：ATATggtaccactagtCGTGTCG CCTTCAGCTGTTCAGTTCC and CYC U2-RNAi-L：ATATggatccgagctcACCGTGCCGCTGTC GAAGGCGCGCGC expands to obtain.

4) rice transformation

Step 1) -3) in rice conversion be all made of the genetic transforming method that Agrobacterium EHA105 is mediated, it is specific as follows：

1. callus induces.By rice paddy seed decladding, full limpid seed is taken first to impregnate 1min, sterile water with 70% ethyl alcohol It rinses 1-2 times；With the NaClO solution containing 2% Active Chlorine, (40ml contains again>The NaClO solution of 5.2% Active Chlorine adds 60ml water), Add 1-3 drops Tween 20, impregnate 30min or more (general 40min, longest can be to 1h).It shakes frequently, then uses aseptic water washing 4-5 times.It is poured on the tablet and filter paper of sterilizing and blots, about 1h or so.By merging N6D solid mediums on (10/25ml/ Bottle), embryo upward or contact culture medium, 28 DEG C, 25~30d of light culture.N6D2 culture mediums：N6 salinities and vitamin, 0.5g/l Casein hydrolysate, 30g/l sucrose, 2mg/l 2,4-D, 2.5g/l Phytagel (Sigma), p H5.8.

2. the culture of Agrobacterium and its co-cultivation with Rice Callus.The small spoon scraping Agrobacterium of sterilizing is taken, is carried on the back with spoon Thalline is attached to tube wall and gently clapped by face to be dissipated, OD600=0.8~1.0.The callus of preceding culture is dried in the air, so on aseptic filter paper After be concentrated to a plate and be disposably transferred in bacterium solution, gently rotating centrifuge tube makes bacterium solution be uniformly distributed, time of repose about 15~ 20min.Bacterium solution to be poured out, callus puts about 1.5h on aseptic filter paper, ensures that bacterium solution blots, and is connected in 1/2N6D AS, 20 DEG C, Light culture 2~3 days, it is seen that callus has mycoderm with culture medium contact portion, so that it may with degerming.1/2N6D AS culture mediums： N6D2,10g/l glucose, 100~400 μm of ol/l acetosyringones (used time now adds), pH5.2.

3. the removal of Agrobacterium.The callus of co-cultivation is packed into the centrifuge tube of 50ml, with sterile water wash 3 times or more, until Liquid is more limpid.Pour out sterile water, N6D+Cn500mg/L (or AP500ml/L), 100rpm, 15-20min, 2-3 times.It will be more Wound, which is poured on aseptic filter paper, blots 2h or so, depends on the circumstances.Dry callus is transferred in N6D-AS, cephalosporin is added Cn250mg/L, 28 DEG C, 7~10d of light culture.

4. the screening of callus.Choose the callus not polluted by Agrobacterium, adds Cn250mg/L and Hn (50mg/ for the first time ), L 15~20d.For the second time ibid, it is not added with Cn, adds hygromycin Hn, all callus are all turned primary, 15~20d again.Third It is secondary to select new callus, it is screened with Hn, 15~20d.Number portion, which uses, centainly presses above-mentioned arrangement, but should ensure that callus is screened on Hn Time at least 45d or more, the callus newly grown chosen for the third time preferably screens 20d.N6D screening and culturing mediums：N6D+ Cn250mg/L+Hn50mg/L, PH=5.8~5.9.

5. breaking up and taking root.Whole callus that 4th time is screened move into MS, Hn 50mg/L, light culture, pre- point Change (P H 5.9) 12~15d.The good fresh callus of growing way is selected, is moved into MS (PH 6.0), 15~20d of optical culture can be seen To there is green bud to grow, general 15d changes a subculture.Choosing grows the green bud of 1cm or more, peels off callus extra around, cuts off Root (can stay about 0.5cm long) moves into test tube, 1/2MS culture of rootage.MS differential mediums：MS salinities and vitamin, 2g/l junket Protolysate, 30g/l sucrose, 25g/L sorbierites, 2mg/l 6-BA, 0.5mg/l NAA, 0.2mg/l zeatin (Zeatin), 0.5mg/l KT, 3.0g/l Phytagel, pH5.8,50mg/l hygromycin B, 200mg/l cephalosporins；1/2MS Root media：1/2MS salinities, MS vitamins, 30g/l sucrose, 1mg/l paclobutrazols, 0.5mg/l NAA, 50mg/l hygromycin, 2.5g/l Phytagel,pH5.8。

5) transplanting, expression quantity identification and phenotypic analysis.

By each construction of the transfer-gen plant taken root, 30 are intermediate house, and blade is taken to carry out realtimeqRT- PCR expression quantity is identified and GUS staining analysis.

RT-CYCU2-F GTCGCCTCCAAGTTCGTC

RT-CYCU2-R GTAGCTCTGGAACACGCTG

6) result：

(1) carrier of acquisition is transferred in rice Nipponbare, utilizes pCYCU2；1-GUS transgenic paddy rice reporting system tables Bright CYC U2；1 mainly expresses (Fig. 2) at mesocotyl position.

(2) by CYC U2；1 promoter and overall length CDS is cloned on pCAMBIA1301, is transferred in Nipponbare, is obtained Transgenosis system (CYC U2-OX) to show as mesocotyl more elongated than wild type (Nipponbare) (Fig. 3).Illustrate C YC U2；1 tool There is the function of control rice mesocotyl length

(3) by CYC U2；1 (- 168-200bp) is cloned on RNAi carrier pTCK303, and R is in rice Nipponbare NAi (RNA interference) is tested, as a result, it has been found that success is by the mesocotyl of the transgenic paddy rice (CYC U2-RNAi) of RNAi Shorten (Fig. 4) than wild type (Nipponbare).

(4) pass through multiple independent pCYCU2 of acquisition：：CYCU2；1 and RNAi-CYC U2；The phenotype of 1 transgenic line And expression analysis, show CYC U2；1 expression quantity is related to rice mesocotyl length (Fig. 5).

Sequence table

<110>Hua Zhong Agriculture University

<120>Rice CYC U2；1 gene is in the control developmental application of rice mesocotyl

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2300

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

accagacaat ttcattcacc aaacatgcac ttgcttgaaa ctagcttatc ccttcattcc 60

aaaatataag catttttaga gttggacacg gttattaaga aagttggtag aattaaatgg 120

gggagtgctc tgactggaga ataagtggag atatgtgaga aaattgaata gtggaggttg 180

tgattggttg aaaggagaat gttaatgaag aaattattat attttaggac aaattctaaa 240

gactaaaagt tgttatattt ttggacgaag gaagtacttg ataaatacgt attctatttg 300

caaaaatagt gtaaatcact tatatactga aaacctgaaa attatcgttg gattaaaata 360

aaatggacat aagattcgtc cacgtgcgcg tgaacaaatc ttaggcgtcc atttttaatc 420

taacggtagt tttgaggttt caattatata tgtggtttct gctacgtatt atgacaaccc 480

cccccccccc cccccccagg ctgtcactct gctctctaac attactctgt cccgttcaga 540

tgatctttgt cctggtcacc gtaagcaagt gaagagcaga atgtaaaaca tgcttcaatg 600

aaaaaaataa taaatctcgc aaaactatat attggtatac attaaccaaa ctatcgaaaa 660

aaatgtaatt ttaagacgtt gaattacaaa actttagatt tatcactaaa gttatcccaa 720

accaaaagta tcaaaaaata cagatttagc aacaaaatta tcctaaaact acaagtttag 780

catcatatta atcacaaaac tataacattt atagttcaac tataaaatat ataattttat 840

gttaacttta atattaaatc tatagctttt tatgtacttt aaatatgtgg ttttgtgata 900

tggtgcctta aatttataat tttggatagt ttagttaaaa cacctatagt ttcatgaaat 960

ttatttttaa aaattctcta gtaaacacat gcctcaattt gtttaccatc cgctcgcatg 1020

agcactgtcg caagccatgg ccgattgatt cgatgtccca gagtggaatc tcttggcaaa 1080

gatcatgctg tacattatca cgcctgacaa taataaacaa aagctacttg tccagtggga 1140

gagaaatacc aatatccaat caagatcagg agttcaaaaa aaaaatctaa gatcaggggc 1200

atgataactt tgatcattat tatcagaaag caaagcaaag ttctgcttta ttcctgcaag 1260

ctttatgtgc gtgcatatac caaccagaca tctctttcca aaaaatgatc ctcacaaatg 1320

aaataaatta acctttggca actttaatta ttttcgatga agcagcttat tgcaacctaa 1380

cctcatcatt ctgcaagtag tactgatgat gaagaaaaac tatcagcaga tccattttta 1440

tatcctctct ggatcttcat gtcaacacct cgatgccgct gtcctatgag tacccaagaa 1500

cagtattccc actgatcatc caacctacta aaatagtgca aatctgtcgg cagaaagggc 1560

cactcctctc cagcaactcc aagaaccggt tgttacaacg ccgcggccat tgtcgtctcc 1620

tgcatccatc ggtcgcttcg acgtcttaac agaagttccc attaccatca taaactagct 1680

tatcaaccgg caaggcaaga ctaaaaagat cagaggcatc tgttcttcac ttgcccacaa 1740

gccacgcgtc tcgccgtgac acaagacgcc gtacctgaac agcaggtagc acgtacgcgg 1800

gaaaagtctc gcatagttaa atgtgtacgg gttcgccggg caccgacgcg ataattcgcc 1860

actcgcgctt gtttttccct cataaatcca gcctcgtcga tcacggatgc cgcccccaac 1920

cgcagtagtg cagtaccagc catcaatcag atctgcccct ggatgcattt gtcgtccgct 1980

tgatcataaa taagctcggg tgatcgggtc aggggcctca atggaaggtg cctgaaggct 2040

tcatctccgt gtctcgattt gttttagctc cagtttgcgt gtacgtgctg agttttttta 2100

tgccgatatc ttttgtttct ttgctccttc ctcgtgtcgc cttcagctgt tcagttccgc 2160

cattgttaat agcttctttt tgcccccacg cttgcctccc tctggtgtat aaagtgtctg 2220

catttgcaag agttctctgt gtacttgtgt agcataggtt ttgtgaagaa ccaagctttt 2280

gccattgaat tcttcaggag 2300

<210> 2

<211> 654

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

atggcgtcca ctgagttagc gtcggatgtg tacgcgctcc cgtgcggcga cgacggcacg 60

acggcgctgt cgacgccggt ggtcgtgtcg gtcctcgcgt cgctgctgga gcggcacatc 120

gcccggaacg agagggacca ggcggcggcg gcggacggcg aggccgcgag gagggcgcgc 180

gccttcgaca gcggcacggt gctggacatg agccttcacg cgttcctgga gcggttctcc 240

cggtacgcga acgtctcgcc gcaggtgtac gtcgtggcgt acgcgtacct ggaccggctt 300

cgccgcggcg acggcgtgcg cgtcgtgtcg gccaacgccc agcggctgct caccacagcc 360

atcctcgtcg cctccaagtt cgtcgaggac cggaactaca agaactcgta cttcgccgcg 420

gtgggcgggc tgaccgccgc ggaactgagc tcgctggagc tggacttcct cttcctgatg 480

cagttcaggc tcaacgtgag cgtcagcgtg ttccagagct actgccggca cctggagagg 540

gaggtgagct acggcggcgg gtaccaggtg gagaggtgcc tcaagaaggc cctcgtctgc 600

tccggcgagg cgcaggcgca gcagaggcaa gcggcgtcgg cggcagccca gtag 654

<210> 3

<211> 217

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 3

Met Ala Ser Thr Glu Leu Ala Ser Asp Val Tyr Ala Leu Pro Cys Gly

1 5 10 15

Asp Asp Gly Thr Thr Ala Leu Ser Thr Pro Val Val Val Ser Val Leu

20 25 30

Ala Ser Leu Leu Glu Arg His Ile Ala Arg Asn Glu Arg Asp Gln Ala

35 40 45

Ala Ala Ala Asp Gly Glu Ala Ala Arg Arg Ala Arg Ala Phe Asp Ser

50 55 60

Gly Thr Val Leu Asp Met Ser Leu His Ala Phe Leu Glu Arg Phe Ser

65 70 75 80

Arg Tyr Ala Asn Val Ser Pro Gln Val Tyr Val Val Ala Tyr Ala Tyr

85 90 95

Leu Asp Arg Leu Arg Arg Gly Asp Gly Val Arg Val Val Ser Ala Asn

100 105 110

Ala Gln Arg Leu Leu Thr Thr Ala Ile Leu Val Ala Ser Lys Phe Val

115 120 125

Glu Asp Arg Asn Tyr Lys Asn Ser Tyr Phe Ala Ala Val Gly Gly Leu

130 135 140

Thr Ala Ala Glu Leu Ser Ser Leu Glu Leu Asp Phe Leu Phe Leu Met

145 150 155 160

Gln Phe Arg Leu Asn Val Ser Val Ser Val Phe Gln Ser Tyr Cys Arg

165 170 175

His Leu Glu Arg Glu Val Ser Tyr Gly Gly Gly Tyr Gln Val Glu Arg

180 185 190

Cys Leu Lys Lys Ala Leu Val Cys Ser Gly Glu Ala Gln Ala Gln Gln

195 200 205

Arg Gln Ala Ala Ser Ala Ala Ala Gln

210 215

Claims (5)

1. Albumen shown in 1.SEQ ID NO.3 or the nucleotides sequence for encoding albumen shown in SEQ ID NO.3 are listed in embryo in control rice The developmental application of axis.
2. 2. application according to claim 1, the nucleotides sequence is classified as shown in SEQ ID NO.2.
3. Albumen shown in 3.SEQ ID NO.3 or the nucleotides sequence for encoding albumen shown in SEQ ID NO.3 are listed in raising rice paddy seed The application of Emergence is broadcast live.
4. Albumen shown in 4.SEQ ID NO.3 or the nucleotides sequence for encoding albumen shown in SEQ ID NO.3 are listed in rice breeding Using.
5. 5. according to the application in claim 1 or claim 3 or claim 4, startup used during the application Son is shown in SEQ ID NO.1.