CN108728555A - A kind of peripheral blood and menstrual blood discriminating kit and its application - Google Patents
A kind of peripheral blood and menstrual blood discriminating kit and its application Download PDFInfo
- Publication number
- CN108728555A CN108728555A CN201810570772.7A CN201810570772A CN108728555A CN 108728555 A CN108728555 A CN 108728555A CN 201810570772 A CN201810570772 A CN 201810570772A CN 108728555 A CN108728555 A CN 108728555A
- Authority
- CN
- China
- Prior art keywords
- kit
- blood
- circ
- peripheral blood
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The present invention relates to a kind of peripheral bloods and menstrual blood discriminating kit and its application, the kit includes the upstream and downstream PCR amplification primer of four kinds of circular rnas, and the circular rna is hsa_circ_0000212, novel_circ_0013653, novel_circ_0013655 and novel_circ_0013656.Four kinds of involved circular rnas rich content and expression has tissue specificity in menstrual blood, is the more preferably molecular labeling for differentiating peripheral blood and menstrual blood in this kit.Differentiated by human peripheral blood and menstrual blood, can simply and efficiently distinguish peripheral blood and menstrual blood, technical support is provided for the detection of crime case.
Description
Technical field
The present invention relates to technical field of molecular biology more particularly to a kind of peripheral blood and menstrual blood discriminating kit and
It is applied.
Background technology
The analytical control that body fluid is left to scene of a crime is the important link of forensic identification.Judge that the tissue of body fluid comes
Source can provide evidence to determine that case property, the scene of progress reappear.Blood stain is scene of a crime the most common type body fluid trace,
The blood stain of identification scene of a crime is peripheral blood or menstrual blood, is remolded to case most important.The appearance of peripheral blood and menstrual blood
It is difficult to distinguish, conventional method is usually differentiated using the morphological feature of peculiar cell in menstrual blood, cumbersome, cannot be satisfied method
Doctor's inspection case accurately and rapidly requires.RNA (mRNA, the miRNA based on molecular genetics to grow up in recent ten years
Deng) and DNA methylation detection method be deemed likely to be novel ideal body fluid different for identification method, be expected to replace
Traditional body fluid identification technology.However previously researches show that：The differentiation methyl for tissue/body fluid identification filtered out at present
It is also very little to change site, while methylation level is easily influenced by environment, disease, age etc.；MRNA is easily by ubiquitous RNA
Enzyme is degraded, and is exposed under strong daylight or ultraviolet light, the factors such as wet environment can all influence the stability of mRNA；MiRNA pieces
Section is short and small, higher to detection technique design requirement, and the sites miRNA differentiated for menstrual blood filtered out reported at present
Repeatability is bad.Therefore, it is necessary to explore new genetic marker to carry out the identification of legal medical expert's correlation body fluid.
Invention content
Exist easily by external interference, unstable, repeatability high to detection technique design requirement for existing detection method
Bad technical problem, the present invention provides a kind of peripheral bloods and menstrual blood discriminating kit.
And the present invention also provides the real time fluorescent quantitatives of a kind of peripheral blood and menstrual blood to differentiate detection method.
And the present invention also provides above-mentioned real time fluorescent quantitatives to differentiate that detection method differentiates that blood sample to be measured comes for legal medical expert
From the application of peripheral blood or menstrual blood.
And the present invention also provides the agarose gel electrophoresis of a kind of peripheral blood and menstrual blood to differentiate detection method.
And the present invention also provides a kind of above-mentioned agarose gel electrophoresis to differentiate that detection method is to be measured for legal medical expert's discriminating
Application of the blood sample from peripheral blood or menstrual blood.
To achieve the above object of the invention, the embodiment of the present invention uses the following technical solution：
A kind of peripheral blood and menstrual blood discriminatings kit, the kit include the upstream and downstream PCR expansions of four kinds of circular rnas
Increase primer, the circular rna be hsa_circ_0000212, novel_circ_0013653, novel_circ_0013655 and
novel_circ_0013656；Wherein,
The upstream and downstream PCR amplification primer of the hsa_circ_0000212 is：
Sense primer：5 '-GAAAGGCACCGCAGAATATGAAC-3 ',
Downstream primer：5'-AGCTGACAAAGTGCTCTCCATG-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013653 is：
Sense primer：5 '-AGCTCCTTCCAGCACGAGAT-3 ',
Downstream primer：5'-GTCCGGAATTGGGTGAAGGT-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013655 is：
Sense primer：5 '-CAGGCAGGAGCTGAATACCAT-3 ',
Downstream primer：5'-GGTCTTTGTACTTCTGCCCATC-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013656 is：
Sense primer：5 '-GGTCTCATGGCTTCTAGGAACT-3 ',
Downstream primer：5'-TCGGGCCCCATTCTTATGATGA-3'.
The detection object of this kit is circular rna, and circular rna is a kind of without 5' end caps and the ends 3' poly (A)
Tail structure results from single-stranded virus covalently closed circular non-coding RNA during RNA montages, is not easy to be degraded by exonuclease,
More stablize compared with linear rna.Four kinds of involved circular rnas, respective nucleotide excision sequence are respectively in this kit：
Hsa_circ_0000212 shears sequence：
GUCGAUCUUUGCUGUGGUUAAACUUGAAAGGCACCGCAGAAUAUGAACAGGAGUUACAGCGAUCCAGGGUGUAUGAU
GUUUCUGUUUGGGAGGCUUCUUGGUAAUUUUUUCUGCAGGAUGAAUUAAGAGAAGAGACACUUGCUCAUCAGGCAUG
GAGAGCACUUUGUCAGCUUCCAAUAUGCAAGACCCUUCAUCUUC；
Novel_circ_0013653 shears sequence：
GGAACUUCACUGACCUGUUUCCCCACAGGAACCCAGUCCAGGGCAAGCAGCUCCUUCCAGCACGAGAUGUCCCAAGA
AGGCUUCAGCACAGCCCUCACAAUGUUUGCACUGAUGCAGUACUCAAACCUCCUGAAGAUCCACUUCACCUUCACCC
AAUUCCGGACCAGCCCGAGCCAGCAGAGCCUGGUGGAUCCCAUC；
Novel_circ_0013655 shears sequence：
CAUCAGCUCAGCGCCUCCGCAGGACCACGUGUUCAAGGUGGACAACUUUGCAGCCCUUGGCAGCAUCCAGAAGCAGC
UGCAGGAGAAGAUCUAUGCAGUUGAGGGACACAGCUAUUUCAUCAUAAGAAUGGGGCCCGAAAAAGUGCCAAGAAGA
UCCUCAUUGUCAUCACAGAUGGGCAGAAGUACAAAGACCCCCUGG；
Novel_circ_0013656 shears sequence：
GGAACUUCACUGACCUGUUUCCCCACAGGAACCCAGUCCAGGGCAAGCAGCUCCUUCCAGCACGAGAUGUCCCAAGA
AGGCUUCAGCACAGCCCUCACAAUGGACACAGCUAUUUCAUCAUAAGAAUGGGGCCCGAAAAAGUGCCAAGAAGAUC
CUCAUUGUCAUCACAGAUGGGCAGAAGUACAAAGACCCCCUGGA。
Above-mentioned four kinds of circular rnas rich content and expression in menstrual blood have tissue specificity, are to differentiate periphery
The more preferably molecular labeling of blood and menstrual blood.
Preferably, the kit further includes TRIzol reagents, RNA extraction agents and reverse transcription reagent box.
Preferably, the kit further includes real time fluorescent quantitative kit.
Preferably, the kit further includes PCR kit, agarose, nucleic acid dye and 50bp DNAStep
Marker。
And the embodiment of the present invention additionally provides a kind of real time fluorescent quantitative discriminating detection side of peripheral blood and menstrual blood
Method, the real time fluorescent quantitative differentiate that detection method includes following operating procedure：Blood sample RNA to be measured is extracted, is tried with RNA reverse transcriptions
Agent box carries out reverse transcription, obtains cDNA；With the upstream and downstream PCR amplification primer of real time fluorescent quantitative kit and above-mentioned circular rna
Real time fluorescent quantitative detection is carried out to the cDNA, differentiates that blood sample to be measured comes from peripheral blood or the moon according to circular rna expression
Menses.
And the embodiment of the present invention additionally provides above-mentioned real time fluorescent quantitative and differentiates that detection method is to be measured for legal medical expert's discriminating
Application of the blood sample from peripheral blood or menstrual blood.
And the embodiment of the present invention additionally provides a kind of agarose gel electrophoresis discriminating detection side of peripheral blood and menstrual blood
Method, the agarose gel electrophoresis differentiate that detection method includes following operating procedure：Blood sample RNA to be measured is extracted, with RNA reverse transcriptions
Kit carries out reverse transcription, obtains cDNA；Described in PCR kit and the upstream and downstream PCR amplification primer pair of above-mentioned circular rna
CDNA carries out PCR amplification；Pcr amplification product is added in Ago-Gel and carries out electrophoresis, is differentiated according to electrophoretic band result
Blood sample to be measured comes from peripheral blood or menstrual blood.
And the embodiment of the present invention additionally provides a kind of above-mentioned agarose gel electrophoresis and differentiates detection method for legal medical expert's mirror
Application of the blood sample not to be measured from peripheral blood or menstrual blood.
Above-mentioned real time fluorescent quantitative or agarose gel electrophoresis are differentiated that detection method human peripheral blood reflects with menstrual blood
Not, peripheral blood and menstrual blood can be simply and efficiently distinguished, technical support is provided for the detection of crime case.
Description of the drawings
Fig. 1 is the representative result of real time fluorescent quantitative in the embodiment of the present invention 2.
Fig. 2 is the representative result of agarose gel electrophoresis in the embodiment of the present invention 3.
Description of the drawings：
1 peripheral blood hsa_circ_0000212 bands
2 menstrual blood hsa_circ_0000212 bands
3 peripheral blood novel_circ_0013656 bands
4 menstrual blood novel_circ_0013656 bands
5 peripheral blood novel_circ_0013655 bands
6 menstrual blood novel_circ_0013655 bands
7 peripheral blood novel_circ_0013653 bands
August menses novel_circ_0013653 bands
Specific implementation mode
In order to make the purpose , technical scheme and advantage of the present invention be clearer, below in conjunction with specific embodiment, to this
Invention is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, not
For limiting the present invention.
Embodiment 1
An embodiment of the present invention provides one kind for peripheral blood and menstrual blood discriminating kit, four kinds of circular rnas it is upper
Downstream PCR amplimer, the circular rna are hsa_circ_0000212, novel_circ_0013653, novel_circ_
0013655 and novel_circ_0013656；Wherein,
The upstream and downstream PCR amplification primer of the hsa_circ_0000212 is：
Sense primer：5 '-GAAAGGCACCGCAGAATATGAAC-3 ',
Downstream primer：5'-AGCTGACAAAGTGCTCTCCATG-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013653 is：
Sense primer：5 '-AGCTCCTTCCAGCACGAGAT-3 ',
Downstream primer：5'-GTCCGGAATTGGGTGAAGGT-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013655 is：
Sense primer：5 '-CAGGCAGGAGCTGAATACCAT-3 ',
Downstream primer：5'-GGTCTTTGTACTTCTGCCCATC-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013656 is：
Sense primer：5 '-GGTCTCATGGCTTCTAGGAACT-3 ',
Downstream primer：5'-TCGGGCCCCATTCTTATGATGA-3'.
Further include TRIzol reagents, RNA extraction agents, reverse transcription reagent box, real time fluorescent quantitative reagent in this kit
Box, PCR kit, agarose, nucleic acid dye and 50bp DNA Step Marker.
Embodiment 2
An embodiment of the present invention provides a kind of real time fluorescent quantitative of peripheral blood and menstrual blood discriminating detection methods, including with
Lower operating procedure：
1, the extracting of peripheral blood and menstrual blood cotton swab RNA, quantitative and preserve
1) the sterilizing 1.5mL centrifuge tubes 1 for taking no RNA enzyme, by 1cm2Blood cotton swab shreds in centrifuge tube, is added
It is acutely shaken 1-2 minutes after 1mLTRIzol reagent pipettors piping and druming mixing, until floccule all dissolvings, stands 5 points on ice
Clock；
2) it is 5 to press TRIzol reagents with chloroform volume ratio:200 μ L chloroforms, play of turning upside down is added in 1 ratio
Strong mixing 10 times stands 5 minutes on ice.Three layers of solution point at this time：Upper layer colourless liquid, lower layer's pink, middle layer unobvious；
3) 4 DEG C, 12000g/min centrifugation 15min, take out EP pipes, it is seen that three layers of liquid in pipe point：Upper layer colorless supernatant is
RNA, middle layer white precipitate are albumen (unobvious), and lower layer's pink is cell fragment；
4) it takes supernatant (200-400 μ L) to be transferred in the sterilizing 1.5mL centrifuge tubes of no RNA enzyme with micro sample adding appliance, adds
Enter the RNA extraction agent 200-400 μ L isometric with supernatant, gently turn upside down mixing, stands 5 minutes on ice；
5) it takes supernatant (100-200 μ L) to be transferred in the sterilizing 1.5mL centrifuge tubes of no RNA enzyme with micro sample adding appliance, adds
Enter 400 μ L isopropanols, gently turn upside down mixing, stands 12 minutes on ice；
6) 4 DEG C, 12000g/min centrifugations 10min；
7) discard supernatant, it is seen that white precipitate be RNA；
8) 75% ethyl alcohol (preparation of the DEPC water) 1mL for adding precooling, gently beats tube wall, makes RNA precipitate that mixing be resuspended；
9) 4 DEG C, 8000g/min centrifugation 10min, abandon supernatant, are inverted in a moment on clean filter paper, uncap, drying at room temperature 5 is divided
Clock makes ethyl alcohol volatilize；
10) 20 μ L 0.1%DEPC processing water dissolution precipitations are added, blow and beat mixing, you can obtain sample total serum IgE；
11) RNA extracted is detected using NanoQ microspectrophotometers, and records each sample rna
Concentration and purity, in -20 DEG C of preservations.
2, reverse transcription
The present embodiment uses PrimescriptTMRT reagent Kit with gDNA Eraser kits carry out anti-
Transcription.It is removed genomic DNA reaction first, reaction system is as shown in table 1.
Table 1
| Reactive component | Volume |
| 5×gDNA Eraser Buffer | 2μL |
| gDNA Eraser | 1μL |
| Total RNA | 5μL(200ng/μL) |
| Without enzyme core water | 2μL |
| Total volume | 10μL |
Then reverse transcription reaction is carried out, it is shown that reaction system such as table 2.
Table 2
| Reactive component | Volume |
| Primescript RT Enzyme MixⅠ | 1μL |
| RT primer Mix | 1μL |
| 5×Primescript Buffer 2 | 4μL |
| Without enzyme core water | 4μL |
| Total volume | 20μL |
3, the cDNA after reverse transcription carries out qRT-PCR reactions
The present embodiment uses SYBRRPremix Ex TaqTM II (Tli RnaseH Plus) kit carries out qRT-
PCR (Fluorescent quantitative PCR).Amplification system is as shown in table 3.
Table 3
| Reactive component | Volume |
| SYBR premix Ex TaqⅡ(Tli RnaseH Plus) | 10μL |
| PCR Forward Primer(10μM) | 0.8μL |
| PCR Reverse Primer(10μM) | 0.8μL |
| ROX Reference DyeⅡ(50×) | 0.4μL |
| CDNA templates | 2μL |
| Without enzyme core water | 6μL |
| Total volume | 20μL |
The nucleotide sequence of the PCR amplification primer is as shown in table 4.
Table 4
QRT-PCR reaction steps：It is reacted in 7500 real-time fluorescence quantitative PCR instrument, thermal circulation parameters：95 DEG C,
30sec；(95 DEG C, 5sec, 60 DEG C, 34sec) × 40,95 DEG C, 15sec, 60 DEG C, 1min, 95 DEG C, 15sec.
4, observation qRT-PCR is as a result, analysis result
According to real time fluorescent quantitative CTValue situation human peripheral blood is differentiated with menstrual blood.
4 kinds of circular rnas：Hsa_circ_0000212, novel_circ_0013653, novel_circ_0013655 and
Results of the novel_circ_0013656 in peripheral blood shows as " undetermined ", and considerable in menstruation blood sample
Observe C of corresponding sizeTValue.By Δ C of 4 kinds of circular rnas after reference gene β-actin standardizationTMethod is quantified, knot
Fruit is as shown in Figure 1, it is possible to find in the Δ C of peripheral bloodTValue shows as infinity, i.e., does not express.It can be seen that in peripheral blood and menstruation
There were significant differences for expression in blood sample.
Embodiment 3
An embodiment of the present invention provides the agarose gel electrophoresis of a kind of peripheral blood and menstrual blood to differentiate detection method, including
Following operating procedure：
1, the extracting of peripheral blood and menstrual blood cotton swab RNA, quantitative and preserve
1) the sterilizing 1.5mL centrifuge tubes 1 for taking no RNA enzyme, by 1cm2Blood cotton swab shreds in centrifuge tube, is added
It is acutely shaken 1-2 minutes after 1mLTRIzol reagent pipettors piping and druming mixing, until floccule all dissolvings, stands 5 points on ice
Clock；
2) it is 5 to press TRIzol reagents with chloroform volume ratio:200 μ L chloroforms, play of turning upside down is added in 1 ratio
Strong mixing 10 times stands 5 minutes on ice.Three layers of solution point at this time：Upper layer colourless liquid, lower layer's pink, middle layer unobvious；
3) 4 DEG C, 12000g/min centrifugation 15min, take out EP pipes, it is seen that three layers of liquid in pipe point：Upper layer colorless supernatant is
RNA, middle layer white precipitate are albumen (unobvious), and lower layer's pink is cell fragment；
4) it takes supernatant (200-400 μ L) to be transferred in the sterilizing 1.5mL centrifuge tubes of no RNA enzyme with micro sample adding appliance, adds
Enter the RNA extraction agent 200-400 μ L isometric with supernatant, gently turn upside down mixing, stands 5 minutes on ice；
5) it takes supernatant (100-200 μ L) to be transferred in the sterilizing 1.5mL centrifuge tubes of no RNA enzyme with micro sample adding appliance, adds
Enter 400 μ L isopropanols, gently turn upside down mixing, stands 12 minutes on ice；
6) 4 DEG C, 12000g/min centrifugations 10min；
7) discard supernatant, it is seen that white precipitate be RNA；
8) 75% ethyl alcohol (preparation of the DEPC water) 1mL for adding precooling, gently beats tube wall, makes RNA precipitate that mixing be resuspended；
9) 4 DEG C, 8000g/min centrifugation 10min, abandon supernatant, are inverted in a moment on clean filter paper, uncap, drying at room temperature 5 is divided
Clock makes ethyl alcohol volatilize；
10) 20 μ L 0.1%DEPC processing water dissolution precipitations are added, blow and beat mixing, you can obtain sample total serum IgE；
11) RNA extracted is detected using NanoQ microspectrophotometers, and records each sample rna
Concentration and purity, in -20 DEG C of preservations.
2, reverse transcription
The present embodiment uses PrimescriptTMRT reagent Kit with gDNA Eraser kits carry out anti-
Transcription.It is removed genomic DNA reaction first, reaction system is as shown in table 5.
Table 5
| Reactive component | Volume |
| 5×gDNA Eraser Buffer | 2μL |
| gDNA Eraser | 1μL |
| Total RNA | 5μL(200ng/μL) |
| Without enzyme core water | 2μL |
| Total volume | 10μL |
Then reverse transcription reaction is carried out, reaction system is as shown in table 6.
Table 6
| Reactive component | Volume |
| Primescript RT Enzyme MixⅠ | 1μL |
| RT primer Mix | 1μL |
| 5×Primescript Buffer 2 | 4μL |
| Without enzyme core water | 4μL |
| Total volume | 20μL |
3, the cDNA after reverse transcription carries out PCR amplification
The present embodiment is expanded (polymerase chain reaction, polymerase chain reaction using PCR kit
It answers).Amplification system is as shown in table 7.
Table 7
| Ingredient names | Concentration | Content |
| GoTaq Green Master Mix | - | 12.5μL |
| Sense primer | 10μmol/L | 0.5μL |
| Downstream primer | 10μmol/L | 0.5μL |
| Nuclease free water | - | 10.5μL |
| Template DNA | 50ng/μl | 1μL |
The nucleotide sequence of the PCR amplification primer is as shown in table 8.
Table 8
PCR amplification step：It is expanded in Masercycler Pro S PCR amplification instruments, thermal circulation parameters：95 DEG C,
5min；(95 DEG C, 15sec, X DEG C, 30sec, 72 DEG C, 15sec) × 48,72 DEG C, 5min.The annealing temperature difference of 4 kinds of circular rnas
It is hsa_circ_0000212: 57.1 DEG C, novel_circ_0013653: 58.1 DEG C, novel_circ_0013655: 56.6
DEG C, novel_circ_0013656: 60 DEG C, 4 DEG C are eventually held in, amplified production is obtained.
Amplified production needs to prepare Ago-Gel into before row agarose gel electrophoresis.
4, prepared by Ago-Gel
2g agar Icing Sugar is weighed in conical flask, 0.5 × TBE of 100mL are added, core is added after boiling to clarification in electric furnace
Acid dye (GelredTMDeveloping solution) 10 μ L jogs are uniform, the comb encapsulating of suitable size is then selected, about 0.5mm is thick, 30min
Solidifiable.
5, to amplified production into row agarose gel electrophoresis
The 4 μ L of amplified production of gained in step 3 are added in Ago-Gel hole, 50bp DNAStep are then added
Electrophoresis 30min under the conditions of Marker 3 μ L, voltage 150V.Electrophoresis knot is observed in Azure C500 Laser Near infrared imaging systems
Fruit.
6, observation agarose gel electrophoresis is as a result, analysis result
Differentiated with menstrual blood according to agarose gel electrophoresis band situation human peripheral blood.
4 kinds of circular rnas：Hsa_circ_0000212, novel_circ_0013653, novel_circ_0013655 and
Band of corresponding size can be observed without band and in menstruation blood sample in peripheral blood sample by novel_circ_0013656.
The results are shown in Figure 2, it is possible to find 4 kinds of circular rnas：hsa_circ_0000212,novel_circ_0013653,novel_
There were significant differences for band expression in peripheral blood and menstruation blood sample by circ_0013655, novel_circ_0013656.
By result as it can be seen that real time fluorescent quantitative provided in an embodiment of the present invention (qRT-PCR) and agarose gel electrophoresis mirror
Other detection method can human peripheral blood differentiated with menstrual blood, provide technical support for the relevant cracking of cases of legal medical expert.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
Any modification, equivalent replacement or improvement etc., should all be included in the protection scope of the present invention made by within refreshing and principle.
SEQUENCE LISTING
<110>Hebei Medical University
<120>A kind of peripheral blood and menstrual blood discriminating kit and its application
<130> 2018.5.25
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 1
gaaaggcacc gcagaatatg aac 23
<210> 2
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 2
agctgacaaa gtgctctcca tg 22
<210> 3
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 3
agctccttcc agcacgagat 20
<210> 4
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 4
gtccggaatt gggtgaaggt 20
<210> 5
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 5
caggcaggag ctgaatacca t 21
<210> 6
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 6
ggtctttgta cttctgccca tc 22
<210> 7
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 7
ggtctcatgg cttctaggaa ct 22
<210> 8
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 8
tcgggcccca ttcttatgat ga 22
<210> 9
<211> 198
<212> RNA
<213>Shear sequence
<400> 9
gucgaucuuu gcugugguua aacuugaaag gcaccgcaga auaugaacag gaguuacagc 60
gauccagggu guaugauguu ucuguuuggg aggcuucuug guaauuuuuu cugcaggaug 120
aauuaagaga agagacacuu gcucaucagg cauggagagc acuuugucag cuuccaauau 180
gcaagacccu ucaucuuc 198
<210> 10
<211> 198
<212> RNA
<213>Shear sequence
<400> 10
ggaacuucac ugaccuguuu ccccacagga acccagucca gggcaagcag cuccuuccag 60
cacgagaugu cccaagaagg cuucagcaca gcccucacaa uguuugcacu gaugcaguac 120
ucaaaccucc ugaagaucca cuucaccuuc acccaauucc ggaccagccc gagccagcag 180
agccuggugg aucccauc 198
<210> 11
<211> 199
<212> RNA
<213>Shear sequence
<400> 11
caucagcuca gcgccuccgc aggaccacgu guucaaggug gacaacuuug cagcccuugg 60
cagcauccag aagcagcugc aggagaagau cuaugcaguu gagggacaca gcuauuucau 120
cauaagaaug gggcccgaaa aagugccaag aagauccuca uugucaucac agaugggcag 180
aaguacaaag acccccugg 199
<210> 12
<211> 198
<212> RNA
<213>Shear sequence
<400> 12
ggaacuucac ugaccuguuu ccccacagga acccagucca gggcaagcag cuccuuccag 60
cacgagaugu cccaagaagg cuucagcaca gcccucacaa uggacacagc uauuucauca 120
uaagaauggg gcccgaaaaa gugccaagaa gauccucauu gucaucacag augggcagaa 180
guacaaagac ccccugga 198
Claims (8)
1. a kind of peripheral blood and menstrual blood discriminating kit, it is characterised in that：The kit includes the upper of four kinds of circular rnas
Downstream PCR amplimer, the circular rna are hsa_circ_0000212, novel_circ_0013653, novel_circ_
0013655 and novel_circ_0013656；Wherein,
The upstream and downstream PCR amplification primer of the hsa_circ_0000212 is：
Sense primer：5 '-GAAAGGCACCGCAGAATATGAAC-3 ',
Downstream primer：5'-AGCTGACAAAGTGCTCTCCATG-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013653 is：
Sense primer：5 '-AGCTCCTTCCAGCACGAGAT-3 ',
Downstream primer：5'-GTCCGGAATTGGGTGAAGGT-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013655 is：
Sense primer：5 '-CAGGCAGGAGCTGAATACCAT-3 ',
Downstream primer：5'-GGTCTTTGTACTTCTGCCCATC-3'；
The upstream and downstream PCR amplification primer of the novel_circ_0013656 is：
Sense primer：5 '-GGTCTCATGGCTTCTAGGAACT-3 ',
Downstream primer：5'-TCGGGCCCCATTCTTATGATGA-3'.
2. peripheral blood according to claim 1 and menstrual blood discriminating kit, it is characterised in that：The kit is also wrapped
Include TRIzol reagents, RNA extraction agents and reverse transcription reagent box.
3. peripheral blood according to claim 2 and menstrual blood discriminating kit, it is characterised in that：The kit is also wrapped
Include real time fluorescent quantitative kit.
4. peripheral blood according to claim 2 and menstrual blood discriminating kit, it is characterised in that：The kit is also wrapped
Include PCR kit, agarose, nucleic acid dye and 50bp DNA Step Marker.
5. the real time fluorescent quantitative of a kind of peripheral blood and menstrual blood differentiates detection method, which is characterized in that the real-time fluorescence is fixed
Amount differentiates that detection method includes following operating procedure：
Blood sample RNA to be measured is extracted, reverse transcription is carried out with RNA reverse transcription reagent box, obtains cDNA；
The upstream and downstream PCR amplification primer of circular rna described in the kit described in real time fluorescent quantitative kit and claim 1
Real time fluorescent quantitative detection is carried out to the cDNA, differentiates that blood sample to be measured comes from peripheral blood or menstrual blood according to rna expression level.
6. real time fluorescent quantitative described in claim 5 differentiates that detection method differentiates that blood sample to be measured comes from peripheral blood or the moon for legal medical expert
The application of menses.
7. the agarose gel electrophoresis of a kind of peripheral blood and menstrual blood differentiates detection method, which is characterized in that the agarose is solidifying
Gel electrophoresis differentiates that detection method includes following operating procedure：
Blood sample RNA to be measured is extracted, reverse transcription is carried out with RNA reverse transcription reagent box, obtains cDNA；
Described in the upstream and downstream PCR amplification primer pair of circular rna described in the kit described in PCR kit and claim 1
CDNA carries out PCR amplification；
Pcr amplification product is added in Ago-Gel and carries out electrophoresis, differentiates that blood sample to be measured comes from according to electrophoretic band result
Peripheral blood or menstrual blood.
8. agarose gel electrophoresis described in claim 7 differentiate detection method for legal medical expert differentiate blood sample to be measured from peripheral blood or
The application of menstrual blood.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810570772.7A CN108728555B (en) | 2018-06-05 | 2018-06-05 | Kit for identifying peripheral blood and menstrual blood and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810570772.7A CN108728555B (en) | 2018-06-05 | 2018-06-05 | Kit for identifying peripheral blood and menstrual blood and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108728555A true CN108728555A (en) | 2018-11-02 |
| CN108728555B CN108728555B (en) | 2021-10-08 |
Family
ID=63932022
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810570772.7A Active CN108728555B (en) | 2018-06-05 | 2018-06-05 | Kit for identifying peripheral blood and menstrual blood and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728555B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241192A (en) * | 2019-07-11 | 2019-09-17 | 公安部物证鉴定中心 | It is a kind of to identify that body fluid to be measured is non-blood, the method for menstrual blood or peripheral blood and its miRNA combination used |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014194884A2 (en) * | 2013-06-07 | 2014-12-11 | Klaus Olek | Method for locating nucleic acids, nucleic acids, and complementary oligonucleotides for identifying biological material, and method for identifying biological material and kit |
| CN104419753A (en) * | 2013-08-29 | 2015-03-18 | 公安部物证鉴定中心 | Method and system for identifying histologic origin of body fluids of Chinese population from gene level |
| CN107904316A (en) * | 2017-11-27 | 2018-04-13 | 公安部物证鉴定中心 | A kind of tissue-derived method for identifying human body fluid and its special miRNA combination |
-
2018
- 2018-06-05 CN CN201810570772.7A patent/CN108728555B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014194884A2 (en) * | 2013-06-07 | 2014-12-11 | Klaus Olek | Method for locating nucleic acids, nucleic acids, and complementary oligonucleotides for identifying biological material, and method for identifying biological material and kit |
| CN104419753A (en) * | 2013-08-29 | 2015-03-18 | 公安部物证鉴定中心 | Method and system for identifying histologic origin of body fluids of Chinese population from gene level |
| CN107904316A (en) * | 2017-11-27 | 2018-04-13 | 公安部物证鉴定中心 | A kind of tissue-derived method for identifying human body fluid and its special miRNA combination |
Non-Patent Citations (3)
| Title |
|---|
| FENG SONG等: "Microarray expression profile of circular RNAs in human body fluids", 《FORENSIC SCIENCE INTERNATIONAL: GENETICS SUPPLEMENT SERIES》 * |
| YAQI ZHANG等: "Evaluation of the inclusion of circular RNAs in mRNA profiling in forensic body fluid identification", 《INTERNATIONAL JOURNAL OF LEGAL MEDICINE》 * |
| 王冲等: "细胞mRNA检测鉴别外周血和月经血", 《中国法医学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241192A (en) * | 2019-07-11 | 2019-09-17 | 公安部物证鉴定中心 | It is a kind of to identify that body fluid to be measured is non-blood, the method for menstrual blood or peripheral blood and its miRNA combination used |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108728555B (en) | 2021-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Genome-wide methylation profiling and a multiplex construction for the identification of body fluids using epigenetic markers | |
| JP2023093499A5 (en) | ||
| CN106498040A (en) | A kind of molecular labeling microballon and the unicellular sequence measurement of the high flux based on the molecular labeling microballon | |
| Ito et al. | Fluorescent differential display: Arbitrarily primed RT‐PCR fingerprinting on an automated DNA sequencer | |
| Ginsberg | RNA amplification strategies for small sample populations | |
| Xiao et al. | FertDish: microfluidic sperm selection-in-a-dish for intracytoplasmic sperm injection | |
| US20240052396A1 (en) | Selective protection of nucleic acids | |
| CN107365845A (en) | For detecting the gene marker, kit and lung cancer detection method of lung cancer | |
| CN109825575A (en) | Auxiliary diagnosis miRNA marker lungy and its application | |
| CN112029900A (en) | Rapid nucleic acid detection method and detection system for novel coronavirus | |
| CN106715717A (en) | Nucleic acid extraction using organic solvents to remove inhibitors | |
| CN101796061A (en) | Method from the direct amplification of nucleic acid of crude samples | |
| CN105441565B (en) | MiRNA as osteosarcoma diagnosis and treatment target | |
| CN107287320A (en) | The LAMP detections of GAPDH genes are combined and kit with primer | |
| CN108070636A (en) | A kind of processing method and kit of fluorescent PCR amplified sample | |
| US7582435B2 (en) | Messenger RNA profiling: body fluid identification using multiplex reverse transcription-polymerase chain reaction (RT-PCR) | |
| CN110172530A (en) | A kind of probe and detection method for HPV detection | |
| CN109971843B (en) | Sequencing method of single cell transcriptome | |
| CN108728555A (en) | A kind of peripheral blood and menstrual blood discriminating kit and its application | |
| CN107904316A (en) | A kind of tissue-derived method for identifying human body fluid and its special miRNA combination | |
| CN109251964A (en) | Recycle the method and application of microRNAs detection kit and specific detection circulation microRNAs | |
| CN105506156A (en) | Molecular marker for diagnosing osteosarcoma | |
| Kirkegaard et al. | Comprehensive analysis of soluble RNAs in human embryo culture media and blastocoel fluid | |
| CN108559789A (en) | Cat coronavirus fluorescence EMA detection primers group, kit and detection method | |
| CN109628599B (en) | ALK fusion gene detection and typing kit based on sandwich method high-resolution melting curve analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |