CN108728467A - The preparation method and applications of luciferase reporter gene expression vector pFireRluc - Google Patents
The preparation method and applications of luciferase reporter gene expression vector pFireRluc Download PDFInfo
- Publication number
- CN108728467A CN108728467A CN201810695795.0A CN201810695795A CN108728467A CN 108728467 A CN108728467 A CN 108728467A CN 201810695795 A CN201810695795 A CN 201810695795A CN 108728467 A CN108728467 A CN 108728467A
- Authority
- CN
- China
- Prior art keywords
- rluc
- dna
- pfirerluc
- carriers
- reporter gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the preparation method and applications of luciferase reporter gene expression vector pFireRluc,It can effectively solve the problems, such as the influence of test system transfection efficiency in transfection process by cell activity and two different carriers,Using pmirGLO carriers as template,Amplification is carried out as primer obtain Rluc sequence fragments using R1/R2,The sequence both ends add SalI restriction enzyme sites,With Sal I single endonuclease digestion pGL4.10 carriers,Rluc sequence fragments are inserted into pGL4.10 carriers,Build the pFireRluc luciferase reporter gene carriers of recombination,It is identified effective for eukaryotic cell expression and in the activity assay of double luciferase reporter gene expression vector pFireRluc,Realize applications of the luciferase reporter gene expression vector pFireRluc in eukaryotic cell expression identification neutralization activity experiment.The method of the present invention novel and unique improves the confidence level of experimental data, reduces the influence of cell activity and transfection efficiency to experimental result, can exclude the influence of cell activity and transfection efficiency to experimental result, improve the stability and reliability of testing result.
Description
Technical field
The present invention relates to molecular biosciences, especially a kind of system of luciferase reporter gene expression vector pFireRluc
Preparation Method and its application.
Background technology
Luciferase Reporter Systems are to detect firefly luciferase with fluorescein (luciferin) for substrate
(fireflyluciferase) active a kind of reporting system.Pass through luciferase assay instrument (luminometer)
The bioluminescence discharged in luciferin oxidation process can sensitive, efficiently detect the expression of gene.The detecting system is
Detect a kind of detection method of transcription factor and the DNA interactions of target gene promoter region.Luciferase reporter gene is surveyed
Test system co-expresses firefly and renilla luciferase, and the expression of target gene is quantified with firefly luciferase, using the
Two reporter genes（Renilla luciferase）To reduce the changing factor of experiment.Traditional total reporter gene includes CAT, β-Gal,
GUS is not convenient enough, because respective test is chemical, processing requirement detection feature has differences.PGL4.10 is Promega companies
The luciferase reporter gene carrier of structure, contains firefly luciferase reporter gene（Firefly）, can be used as quantitative analysis
The tool of mammalian gene expression.But due to containing only firefly luciferase reporter gene in pGL serial carriers, in use
The interference that cannot exclude factor of background, easy tos produce detection error.In addition, Promega companies also developed on this basis it is double
Firefly luciferase test and renilla luciferase test are combined by reporter gene technology, are introduced pRL carrier systems and are carried out table
Up to second reporter gene renilla luciferase, the cotransfection carrier containing firefly and Renilla luciferase reporter gene respectively
Plasmid can carry out luciferase reporter gene test in eukaryocyte in single tube.But the test system can be by thin
The influence of cytoactive and two different carriers transfection efficiency in transfection process.Therefore, new Dual-Luciferase report is developed
It is imperative to accuse expression vector.
Invention content
For the above situation, to overcome the defect of the prior art, the purpose of the present invention to be just to provide a kind of Dual-Luciferase
The preparation method and applications of reporter gene expression carrier pFireRluc, can effectively solve test system by cell activity with
And the influence problem of two different carriers transfection efficiency in transfection process.
The technical solution that the present invention solves is a kind of preparation of luciferase reporter gene expression vector pFireRluc
Method and its application, preparation method are, using pmirGLO carriers as template, carry out amplification as primer using R1/R2 and obtain Rluc sequences
Rluc sequence fragments are inserted into plus SalI restriction enzyme sites with Sal I single endonuclease digestion pGL4.10 carriers by column-slice section, the sequence both ends
In pGL4.10 carriers, the pFireRluc luciferase reporter gene carriers of recombination are built；Specific method includes the following steps：
（1）, design Rluc primers：
According to Rluc expression unit DNA sequence dna design primers R1, R2 in pmirGLO plasmids：
（2）, PCR amplification：
Using pmirGLO carriers as template, PCR amplification is carried out by primer of R1, R2, obtains Rluc expression units；
（3）, product electrophoresis：
Pcr amplification product is mixed with 10 × bromophenol blue sample loading buffer, into row agarose gel electrophoresis, uses DNA
Makrer2000 judges amplified fragments size, is taken a picture with gel analysis system；
（4）, to electrophoresis plasmid extraction, purifying, method is：Under ultraviolet light, by the agarose containing target gene fragment
Gel is quickly cut, the weight of calculated for gel block；Buffer DE-A are added in gel piece, melt；The buffering of half volume is added
Liquid Buffer DE-B, are mixed into mixed liquor；By mixed liquor dress column centrifugation, filtrate is abandoned, 4 times repeatedly, Eppendorf pipes is packed into and washes
De- DNA, centrifugation, warm bath, electrophoresis verify the target fragment length of recycling, obtain Rluc pcr amplification products；
（5）, prepare DH5 α competent bacterias：With the single DH5 α bacterium colonies on oese picking LB solid mediums, it is inoculated with
In LB liquid medium, shaken overnight, culture moves to bacterium solution in PA tube, places and is cultivated in mixture of ice and water, cold
But, it centrifuges, recycles bacterium, be resuspended, centrifugation obtains resuspension thalline；
（6）, with T4 DNA ligases Rluc expression units are connect with pGEM-T carriers, obtain recombinant vector pGEM-T-Rluc,
PGEM-T Rluc recombinants are transformed into bacillus coli DH 5 alpha；
（7）, using T7 and SP6 as primer, PCR identifies recombinant pGEM-T Rluc, and positive recombinant vector is located at 2526bp（T7
It is two class promoters with SP6, is usually used in construction of expression vector, can transcribes acquisition RNA single strand with its primer, also can singly be drawn
It is single-stranded that object PCR obtains DNA, it is also possible to make sequencing primer, known technology）.
Luciferase reporter gene expression vector pFireRluc prepared by the method for the present invention is effective for eukaryocyte table
Up to identification and in the activity assay of double luciferase reporter gene expression vector pFireRluc, realizing that Dual-Luciferase reports base
Because of applications of the expression vector pFireRluc in eukaryotic cell expression identification neutralization activity experiment.
The method of the present invention novel and unique can be effectively used for preparing new luciferase reporter gene carrier, which can
HRLUC provides a datum line as internal reference, for experiment, improves the confidence level of experimental data, which reduces cell activity
Influence with transfection efficiency to experimental result can exclude the influence of cell activity and transfection efficiency to experimental result, to carry
The stability and reliability of high detection result provide reliable technical support, economic and society's effect for the diagnosing and treating of disease
It is beneficial notable.
Description of the drawings
Fig. 1 is recombinant vector collection of illustrative plates figure of the present invention.
Specific implementation mode
It elaborates to the specific implementation mode of the present invention below in conjunction with attached drawing and concrete condition.
The present invention in specific implementation, a kind of preparation method of luciferase reporter gene expression vector pFireRluc,
Using pmirGLO carriers as template, amplification is carried out as primer using R1/R2 and obtains Rluc sequence fragments, which adds SalI
Rluc sequence fragments are inserted into pGL4.10 carriers with Sal I single endonuclease digestion pGL4.10 carriers, are built recombination by restriction enzyme site
PFireRluc luciferase reporter gene carriers；Specific method includes the following steps：
（1）, design Rluc primers：
According to Rluc expression unit DNA sequence dna design primers R1, R2 in pmirGLO plasmids：
R1 is 5'-AAAGTCGACCGCGGATCTGCGCAGCACCATGGC-3'；
R2 is 5'-CCCGTCGACATCGATTCACACAAAAAACCAACACA-3'；
GTCGAC isI restriction enzyme sites of Sal（That is lower part setting-out part）；
（2）, PCR amplification：
Using pmirGLO carriers as template, PCR amplification is carried out by primer of R1, R2, obtains Rluc expression units；Pcr amplification reaction
System is：10 × buffer, 32 μ L, R1, R2 of μ L, 4 × dNTPs each 0.5 μ L, Pfu high fidelity enzyme 0.5 μ L, ddH2O18.5 μ L,
5 μ L of template DNA；Reaction condition：95 DEG C of pre-degeneration 3min；95 DEG C denaturation 45s, 55 DEG C annealing 55s, 72 DEG C extension 90min, 30
A cycle；72 DEG C of ends extend 10min, obtain pcr amplification product；
（3）, product electrophoresis：
6 μ l of pcr amplification product are taken to be mixed with 10 × bromophenol blue sample loading buffer, 1 μ l, with containing 5 μ g/ μ l of ethidium bromide, 1 × TAE
1.5% agarose gel electrophoresis of mass concentration of electrophoretic buffer, voltage 5V/cm judge amplified fragments with DNA Makrer2000
Size is taken a picture with gel analysis system, and the amplification length of Rluc expression units is 2350bp, and sequence table 1 is shown in sequence table；
（4）, to electrophoresis plasmid extraction, purifying, method is：
A, under ultraviolet light, the Ago-Gel containing target gene fragment is quickly cut, is placed on the 1.5ml to have weighed
Eppendorf pipes in, weigh；Calculate the weight of gel piece；
B, it is converted with the weight of gel piece and the volume of buffer solution B uffer DE-A is added, the Buffer of 3 gel volumes is added
DE-A, the centrifuge tube for filling gel piece is placed in heating in 75 DEG C of water baths, and, until gel melts completely, aerosol time cannot surpass
10min is crossed, centrifuge tube is shaken per 2-3min and accelerates gel dissolving；
C, the buffer solution B uffer DE-B of half volume are added, mixing terminates colloidal sol；
D, DNA is prepared column to be placed on the centrifuge tube of 2ml, the mixed liquor in upper step is moved into pillar, 12000 × g, centrifugation
1min；
E, filtrate is abandoned, DNA, which is prepared column, to be put back in former centrifuge tube, and 500 μ l buffer solution B uffer W1,12000 × g, centrifugation is added
30s；
F, filtrate is abandoned, DNA, which is prepared column, to be put back in centrifuge tube, 700 μ l buffer solution B uffer W2 is added, then with 12000 × g, from
Heart 30s；
G, filtrate is abandoned, DNA, which is prepared column, again puts back in centrifuge tube, adds 700 μ l buffer solution B uffer W2, with 12000 × g, from
Heart 1min；
H, filtrate is abandoned, DNA, which is prepared column, to be put back in centrifuge tube, with 12000 × g, centrifuges 1min；
I, the Eppendorf pipes for column will be prepared putting into a clean 1.5ml, fiber center membrane add the eluent of 30 μ l with
Eluted dna allows it to stand 5min at room temperature, then with 12000 × g, centrifuges 1min, Eluent uses preceding 65 DEG C of water-bath temperature
Bath, improves elution efficiency, and the target fragment length of electrophoresis verification recycling obtains Rluc pcr amplification products at 2350bp；
（5）, prepare DH5 α competent bacterias：With the single DH5 α bacterium colonies on oese picking LB solid mediums, it is inoculated with
In 5ml LB liquid mediums, 37 DEG C, 2000 × g, shaken overnight takes the LB liquid of the 5ml bacterium solutions of α containing DH5 that 30ml LB are added
In fluid nutrient medium, 2000 × g, 37 DEG C of shaken cultivations 4-6 hours to exponential phase OD600 ≈ 0.3-0.4；Aseptic condition
Under, bacterium solution is moved in the 50ml PA tubes of an ice precooling by high pressure sterilization processing, is placed in mixture of ice and water
10min after so that culture is cooled to 0 DEG C, 4 DEG C, 2700 × g, centrifuges 10min, recycles bacterium；Abandon supernatant；It is ice-cold
Thalline is resuspended in 0.1mmol/L CaCl2 solution 10ml, is placed in mixture of ice and water after 30min, 4 DEG C, 2700 × g, centrifuges
10min abandons supernatant, the 0.1mmol/L CaCl for adding 2ml ice to be pre-chilled2Thalline is resuspended；It is spare to set 4 DEG C of refrigerator 12-24h；
（6）, with T4 DNA ligases Rluc expression units are connect with pGEM-T carriers, obtain recombinant vector pGEM-T-Rluc；
Coupled reaction system is：2 × Buffer, 5 μ l, glue recycle 3 μ l, pGEM-T Easy carriers of Rluc pcr amplification products 1 μ l, T4
1 μ l of DNA ligase, reaction condition：Reaction system is placed in 1.5ml Eppendorf pipes, 16 DEG C overnight, pGEM-T Rluc
Recombinant is transformed into bacillus coli DH 5 alpha；
（7）, using T7/SP6 as primer, PCR identifies recombinant pGEM-T Rluc, and positive recombinant vector is located at 2526bp.
Luciferase reporter gene expression vector pFireRluc prepared by the method for the present invention is effective for eukaryocyte table
Up to identification and in the activity assay of double luciferase reporter gene expression vector pFireRluc, realizing that Dual-Luciferase reports base
Because of applications of the expression vector pFireRluc in eukaryotic cell expression identification neutralization activity experiment, and through applying on the spot, effect is non-
Chang Hao, related testing data are as follows：
One, Luciferase reporter recombinant vector pFireRluc sequences are identified.
PCR and double digestion identify whether Rluc sequences are inserted into respectively, and method is：A. use oese random from LB tablets
10 bacterium colonies are selected, are inoculated on another LB tablet containing Amp+, continue to cultivate 16h.It is identified：It is with R-1, R-2
Primer.Prepare masterplate DNA.Single bacterium colony is taken to be dissolved in 50 μ l ddH2O, boiling lysis makes template DNA disengage and be denaturalized, simultaneously
Inactivated proteases and nuclease.Reaction system：10 × Buffer 3 μ l, 4 × dNTP 2 μ l, R-1,0.5 0.5 μ l of μ l, 4-2,
0.5 μ l of TaqDNA polymerases, 5 18.5 μ l of μ l, ddH2O of masterplate.PCR reaction conditions：94 DEG C of pre-degeneration 3min, 94 DEG C of changes
Property 40s, 55 DEG C annealing 40s, 72 DEG C extension 45s, 34 reaction cycles, 72 DEG C re-extend 2min.Extract each amplification sample
6 μ l of product analyze amplification with 1.5% agarose gel electrophoresis, the size of amplified fragments are judged with DNAMarker2000.
Picking identifies correct bacterium colony through PCR amplifications, is transferred to fluid nutrient medium and continues to expand culture.B. plasmid is extracted, with limit
Property restriction endonuclease xba I and Stu I double digestions identification pFireRluc processed is correctly inserted into clone, endonuclease reaction system：10×Buffer
1 I enzymes of μ l xba, 1 μ l, Stu I, 1 μ l, pFireRluc plasmids, 7 μ l.Reaction condition：37 DEG C of digestions 2h, 70 DEG C of inactivation 5min.
1.5% agarose gel electrophoresis analyzes digestion result；(note：Due to being single endonuclease digestion position during Rluc is connected with pGL4.10
Point be directly connected to, so will appear during the connection process forward and reverse be inserted into purpose band, so need with double digestion into
Row identification, forward direction be inserted into result pFireRluc is cut into 679bp and 5937bp), with pFireRluc forward/
Reverse is that primer carries out DNA sequence analyses, identifies Luciferase reporter recombinant vector pFireRluc, glycerol stock conservation.
Sequencing result is completely the same with experimental design, sees sequence table 2.
Two, the identification of recombinant vector pGEM-T Rluc bands.
With I single endonuclease digestion recombinant plasmid pGEM-T-Rluc of restriction enzyme Sal, double viscous Rluc segments are obtained.Endonuclease reaction
System：10 × Buffer, 6 I enzymes of μ l, Sal, 8 μ l, pGEM-T-Rluc recombinant plasmid, 46 μ l；Reaction condition：37 DEG C of digestion 2h,
70 DEG C of inactivation 5min, inactivate ligase.There are I restriction enzyme sites of Sal on pGL4.10 carriers and carry out single endonuclease digestion, to double viscous
PGL4.10 carries out dephosphorylation process and obtains open loop pGL4.10 skeleton carrier carriers；Reaction system：10 × Buffer, 6 μ l,
I enzymes of Sal, 8 μ l, pGL4.10 plasmid, 46 μ l；Reaction condition：37 DEG C of digestions 2h, 70 DEG C of inactivation 5min inactivate ligase.Respectively
The double viscous Rluc segments of glue recovery purifying and open loop pGL4.10 plasmids, are as follows：A-1：Under ultraviolet light, use is small
Knife quickly cuts the Ago-Gel containing target gene fragment in the Eppendorf pipes for being placed on the 1.5ml to have weighed, claims
Weight；Calculate the weight of gel piece.A-2：The volume that buffer solution B uffer DE-A are added with the weight conversion of gel piece (is added 3
The Buffer DE-A of a gel volume), will multiply, which has the centrifuge tube of gel piece to be placed in 75 DEG C of water baths, heats until gel is complete
Melt（Aerosol time is no more than 10min）, centrifuge tube is shaken per 2-3min to accelerate gel to dissolve. A-3：Half is added
The buffer solution B uffer DE-B of volume, mixing terminate colloidal sol.A-4：DNA is prepared column to be placed on the centrifuge tube of 2ml, upper
Mixed liquor in step moves into pillar, and 12000 × g centrifuges 1min.A-5：Filtrate is abandoned, DNA, which is prepared column, puts back to former centrifuge tube
In, 500 μ l buffer solution B uffer W1,12000 × g are added, centrifuge 30s.A-6：Filtrate is abandoned, DNA, which is prepared column, puts back to centrifugation
Guan Zhong is added 700 μ l buffer solution B uffer W2, then with 12000 × g, centrifuges 30s.A-7:Filtrate is abandoned, again prepares DNA
Column is put back in centrifuge tube, and 700 μ l buffer solution B uffer W2 are added, and with 12000 × g, centrifuges 1min.A-8：Filtrate is abandoned, by DNA
It prepares column to put back in centrifuge tube, with 12000 × g, centrifuges 1min.A-9：Column will be prepared and put clean 1.5ml's into
In Eppendorf pipes, adds the eluent of 30 μ l with eluted dna in fiber center membrane, allow it to stand 5 min at room temperature, so
Afterwards with 12000 × g, 1min is centrifuged.（Eluent uses preceding 65 DEG C of water-bath warm bath, improves elution efficiency.）A-10：Electroresis appraisal
As a result it is through SalI single endonuclease digestions, the visible apparent purpose band at 2350bp, it was demonstrated that using pmirGLO carriers as template, with R1/
R2 is that primer is expanded, and visible purpose band, consistent with expected results at 2350bp.
Three, electroresis appraisal Ago-Gel plasmid extraction purifies.
Extraction purification plasmid, is as follows：A-1：Take 4ml overnight incubations in LB culture mediums（12-16h）Bacterium
Liquid, 12000 × g centrifuge 1min；Most supernatant is abandoned, by bacterial deposition in tube bottom；A-2：250 μ l BufferS1 buffer solutions are added
Bacterium is resuspended in (adding RNase A), be resuspended it is uniform, should not there are small fungus blocks；A-3：250 μ l BufferS2 bufferings are added
Liquid is mildly fully spun upside down 4-6 times, and bacterium is made fully to crack, and not rocked acutely, in case genomic DNA is broken, directly
To bright solution is formed, this step is no more than 5min；A-4：350 μ l BufferS3 buffer solutions are added, mildly fill immediately
It spins upside down 6-8 times with dividing, until forming cloud, 12000 × g centrifuges 10min, it is seen that a fine and close white blocks.A-5：
Supernatant in upper step is moved to 2ml DNA to prepare in pipe（Dedicated pipe）, 12000 × g, centrifugation 1min abandon filtrate；A-6：It will
DNA prepares pipe and puts back into centrifuge tube, adds 500 μ l BufferW1 buffer solutions, centrifuges 1min, abandons filtrate；A-7：Pipe will be prepared to put back into
Centrifuge tube adds 700 μ l BufferW2 buffer solutions, centrifuges 1min, abandons filtrate；A-8：It is walked on repeating；A-9：It prepared by DNA managed
Centrifuge tube is put back into, 12000 × g centrifuges 1min；Remove Liquid Residue；A-10：Pipe will be prepared move into the Ependorf of new 1.5ml
In pipe, the EB eluents that pipe center adds 60 μ l are prepared in DNA（10m MTris-Cl, pH 8.5）, it is stored at room temperature 5min, is centrifuged
5min, eluted dna；A-11：1.5% agarose gel electrophoresis identifies plasmid extraction effect, with restriction enzyme xba I and
The identification of Stu I double digestions, the result that forward direction is inserted into：It is consistent with 5937bp that pFireRluc is cut into 679bp, electroresis appraisal result
For through SalI single endonuclease digestions, the visible apparent purpose band at 2350bp is accurate, reliable.
Four, it verifies PCR amplification and double digestion identifies whether Rluc sequences are inserted into respectively.
A. 10 bacterium colonies are selected at random from LB tablets with oese, are inoculated in another LB tablet containing Amp+
On, continue to cultivate 16h.It is identified：Using R-1, R-2 as primer.Prepare masterplate DNA.Single bacterium colony is taken to be dissolved in 50 μ l ddH2O
In, boiling lysis makes template DNA disengage and be denaturalized, while inactivated proteases and nuclease.Reaction system：10×Buffer 3
μ l, 4 × dNTP 2 μ l, R-1,0.5 0.5 μ l, TaqDNA polymerase of μ l, 4-2,0.5 μ l, 5 18.5 μ of μ l, ddH2O of masterplate
l.PCR reaction conditions：94 DEG C of pre-degeneration 3min, 94 DEG C of denaturation 40s, 55 DEG C of annealing 40s, 72 DEG C of extension 45s, 34 are reacted
Cycle, 72 DEG C re-extend 2min.Each amplification 6 μ l of sample are extracted, amplification is analyzed with 1.5% agarose gel electrophoresis, uses
DNAMarker2000 judges the size of amplified fragments.Picking identifies correct bacterium colony through PCR amplifications, is transferred to liquid
Culture medium continues to expand culture.B. plasmid is extracted, just with restriction enzyme xba I and Stu I double digestions identification pFireRluc
Really it is inserted into clone, endonuclease reaction system：10 × Buffer, 1 I enzymes of μ l xba, 1 μ l, Stu I, 1 μ l, pFireRluc plasmids, 7 μ l.
Reaction condition：37 DEG C of digestions 2h, 70 DEG C of inactivation 5min.1.5% agarose gel electrophoresis analyzes digestion result；(note：Due to
Rluc is being directly connected to for single endonuclease digestion site during being connected with pGL4.10, thus will appear during the connection process it is positive and
Reversed to be inserted into purpose band, so needing to be identified with double digestion, pFireRluc is cut by the result that forward direction is inserted into
679bp and 5937bp), DNA sequence analyses are carried out by primer of pFireRluc forward/reverse, identify luciferin
Enzyme reports recombinant vector pFireRluc, glycerol stock conservation.Sequencing result is completely the same with experimental design, sequencing result such as sequence
Table 2.
Five, the screening and identification of double Luciferase reporter recombinant vector pFireRluc.
PFireRluc recombinant vectors are built, are carried out Rluc expression units and the pGL4.10 of phosphorylation with T4 ligases
Connection, is transformed into competent bacteria DH5 α.It is as follows to connect reaction response system（10μl）：10 × Buffer 1 μ l, double viscous Rluc
Segment 6 μ l, 2 μ l, T4 DNA ligases of double viscous pGL4.10 carriers, 1 μ l.Reaction condition：Reaction system is placed in 1.5ml
In Eppendorf pipes, 16 DEG C overnight.Connection product is transformed into overnight incubation in DH5 α competent bacterias, it will with coat stick
It is uniformly applied on ampicillin positive tablet, is placed in 37 DEG C of incubators and is incubated overnight.
It selects 10 bacterium colonies at random from LB tablets with oese, is inoculated on another LB tablet containing Amp+, after
Continuous culture 16h.It is identified：Using R-1, R-2 as primer, whether PCR identifications Rluc sequences are inserted into.Prepare masterplate DNA.Take list
Bacterium colony is dissolved in 50 μ l ddH2O, and boiling lysis makes template DNA disengage and be denaturalized, while inactivated proteases and nuclease.Instead
Answer system：10 × Buffer 3 μ l, 4 × dNTP 2 μ l, R-1,0.5 0.5 μ l, TaqDNA polymerase of μ l, 4-2,0.5 μ l,
5 18.5 μ l of μ l, ddH2O of masterplate.PCR reaction conditions：94 DEG C of pre-degenerations 3min, 94 DEG C of denaturation 40s, 55 DEG C of 40s that anneal, 72
DEG C extend 45s, 34 reaction cycles, 72 DEG C re-extend 2min.Each amplification 6 μ l of sample are extracted, are coagulated with 1.5% agarose
Gel electrophoresis analyzes amplification, and the size of amplified fragments is judged with DNAMarker2000.Picking is identified just through PCR amplifications
True bacterium colony is transferred to fluid nutrient medium and continues to expand culture.Plasmid is extracted, with restriction enzyme xba I and Stu I
Double digestion identification pFireRluc is correctly inserted into clone, endonuclease reaction system：10 × Buffer, 1 I enzymes of μ l xba, 1 μ l, Stu I 1
7 μ l of μ l, pFireRluc plasmid.Reaction condition：37 DEG C of digestions 2h, 70 DEG C of inactivation 5min.1.5% agarose gel electrophoresis is analyzed
Digestion result；(note：Due to being being directly connected to for single endonuclease digestion site during Rluc is connected with pGL4.10, so connecting
It will appear forward and reverse in the process and be inserted into purpose band, so needing to be identified with double digestion, the result that forward direction is inserted into will
PFireRluc is cut into 679bp and 5937bp), carry out DNA sequences by primer of pFireRluc forward/reverse
Luciferase reporter recombinant vector pFireRluc, glycerol stock conservation are identified in analysis.Sequencing result is consistent with experimental design, sequencing
As a result see sequence table 3, show that the method for the present invention is reliable and stable.
Six, the eukaryotic cell expression identification and activity test of pFireRluc.
Transfection process carries out in 24 orifice plates, and involved amount refers to that each hole is required in 24 orifice plates
Amount, adjustment appropriate can be done according to other culture plates according to ratio.It is trained with the DMEM culture mediums containing 10% fetal calf serum
HEK293 cells are supported, the method that the plasmid pGL4.10 and recombinant plasmid pFireRluc built is used to liposome respectively
HEK293 cells are transfected into, G418 screening positive clone cells are used in combination.It is as follows：By cell with 3 × 105/ hole
Density is inoculated on 24 orifice plates, is changed the liquid once for 24 hours before transfection；By plasmid pGL4.10, pFireRluc, pGL4.72- of extraction
Each 6 μ l of CMV-hRLUC, are dissolved in respectively in 200 μ l serum-frees and dual anti-culture medium；Take 2 μ l liposomes be added on 200 μ l without
In serum and dual anti-culture medium；Both upper steps mixing is placed at room temperature for 20min；It is washed with serum-free and dual anti-DMEM culture mediums
It washs cell 2 times, above-mentioned mixed liquor is added, be placed in 37 DEG C, continue to cultivate in 5%CO2 incubators；After transfecting 6h, centrifugation discards
Transfection liquid adds DMEM culture solution of 500 holes μ l/ containing 10% fetal calf serum to continue to cultivate；Liquid is changed after transfection 48h, is added containing G418
The culture solution of (800 μ g/ml) is screened；When transfecting 14d, positive colony is formed, and is continued to expand culture, is established and stablize passage
Cell line, G418 makes into maintain concentration 200 μ g/ml.
First cell is washed with PBS 3 times, with reference to E1960 fluorescence detection reagent kit specifications, be first added and split before detection
Liquid lytic cell is solved, the relative fluorescence of cell is detected with 960 fluorescence detectors of Berthold Centro XS3 LB.With not
Transfectional cell compares.Every group sets 5 multiple holes.
Luciferase testing result
| Group | n | Uciferase activity |
| PGL4.10 groups | 5 | 22.31±2.082 |
| PFireRluc groups | 5 | 0.7633±0.1161* |
| pGL4.72-CMV-hRLUC | 5 | 20.33±1.202 |
Compared with pGL4.72-CMV-hRLUC groups and pGL4.10 groups, * P< 0. 0
The present invention successfully constructs a kind of luciferase reporter gene expression vector pFireRluc, utilizes molecular biology skill
HRLUC genes are inserted into pGL4.10 carriers by art, construct the pFireRluc that can express Firefly and hRLUC simultaneously
Expression vector.PGL4.10, pGL4.72-CMV-hRLUC, pFireRluc are each separately transfected into HEK293 cells, G418 screenings obtain
Obtain stable transfected cells strain.Using Dual-Luciferase®Luciferase reporter gene detecting system measures luciferase
Activity.As a result it shows：The uciferase activity of pFireRluc groups is substantially reduced compared with pGL4.10 groups, it was demonstrated that hRLUC expression is single
Member can work normally.Illustrate that pFireRluc is built successfully and being capable of normal expression.The carrier can using hRLUC as internal reference,
A datum line is provided for experiment, improves the confidence level of experimental data.The carrier reduces cell activity and transfection efficiency to reality
The influence for testing result, to improve the stability and reliability of testing result.
Constructed pFireRluc carriers are double luciferase reporter carriers in the present invention, can express firefly simultaneously
Fluorescein and renilla luciferase.Wherein the front end of firefly luciferin gene can be cloned into eukaryotic promoter to be detected, that
The activity of promoter can be reflected by the expression of firefly luciferin downstream.This carrier is advantageous in that：
By the expression unit of RLUC（SV40 promoter, hRluc renilla luciferase genes, neo eukaryocytes screen label, PolA
Tail）It is cloned into carrier simultaneously, in this way, Background control of the expression unit of RLUC as carrier, can exclude cell activity and turn
Influence of the efficiency to experimental result is contaminated, to improve the stability and reliability of testing result, a benchmark is provided for experiment
Line improves the confidence level of experimental data.Therefore, the activity of promoter can be studied with the carrier, the activity of promoter passes through
The ratio of firefly luciferin and renilla luciferase reflects；In addition, the application value of the carrier, which is also embodied in, can use this
Drug, including Chinese medicine, compound medicine are screened, monomer etc. filters out to the active drug of promoter, greatly improve medicine
Object breakneck acceleration and screening effect improve medical value, have very strong actual application value, economic and social benefit notable.
Sequence table
<110>Henan university of TCM
Henan university of TCM
<120>The preparation method and applications RLUC expression unit sequences of luciferase reporter gene expression vector pFireRluc
Row comparison 1 ... ... ... ... ... ... ... ... ... .ATCTGTGC | | | | | | | |
361 TAACAAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGC9
GGTATTTCACACCGCATACGCGGATCTGCGCAGCACCATGGCCTGAAATAACCTCTGAAA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||421
GGTATTTCACACCGCATACGCGGATCTGCGCAGCACCATGGCCTGAAATAACCTCTGAAA69
GAGGAACTTGGTTAGGTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGT|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||481
GAGGAACTTGGTTAGGTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGT129
TAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||541
TAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCA189
ATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||601
ATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAA249
GCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||661
GCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCC309
TAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||721
TAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATG369
CAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||781
CAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTG429
GAGGCCTAGGCTTTTGCAAAAAGCTTGATTCTTCTGACACAACAGTCTCGAACCAAAGGC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||841
GAGGCCTAGGCTTTTGCAAAAAGCTTGATTCTTCTGACACAACAGTCTCGAACCAAAGGC489
TGGAGCCACCATGGCTTCCAAGGTGTACGACCCCGAGCAACGCAAACGCATGATCACTGG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||901
TGGAGCCACCATGGCTTCCAAGGTGTACGACCCCGAGCAACGCAAACGCATGATCACTGG549
GCCTCAGTGGTGGGCTCGCTGCAAGCAAATGAACGTGCTGGACTCCTTCATCAACTACTA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||961
GCCTCAGTGGTGGGCTCGCTGCAAGCAAATGAACGTGCTGGACTCCTTCATCAACTACTA609
TGATTCCGAGAAGCACGCCGAGAACGCCGTGATTTTTCTGCATGGTAACGCTGCCTCCAG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1021
TGATTCCGAGAAGCACGCCGAGAACGCCGTGATTTTTCTGCATGGTAACGCTGCCTCCAG669
CTACCTGTGGAGGCACGTCGTGCCTCACATCGAGCCCGTGGCTAGATGCATCATCCCTGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1081
CTACCTGTGGAGGCACGTCGTGCCTCACATCGAGCCCGTGGCTAGATGCATCATCCCTGA729
TCTGATCGGAATGGGTAAGTCCGGCAAGAGCGGGAATGGCTCATATCGCCTCCTGGATCA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1141
TCTGATCGGAATGGGTAAGTCCGGCAAGAGCGGGAATGGCTCATATCGCCTCCTGGATCA789
CTACAAGTACCTCACCGCTTGGTTCGAGCTGCTGAACCTTCCAAAGAAAATCATCTTTGT|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1201
CTACAAGTACCTCACCGCTTGGTTCGAGCTGCTGAACCTTCCAAAGAAAATCATCTTTGT849
GGGCCACGACTGGGGGGCTTGTCTGGCCTTTCACTACTCCTACGAGCACCAAGACAAGAT|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1261
GGGCCACGACTGGGGGGCTTGTCTGGCCTTTCACTACTCCTACGAGCACCAAGACAAGAT909
CAAGGCCATCGTCCATGCTGAGAGTGTCGTGGACGTGATCGAGTCCTGGGACGAGTGGCC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1321
CAAGGCCATCGTCCATGCTGAGAGTGTCGTGGACGTGATCGAGTCCTGGGACGAGTGGCC969
TGACATCGAGGAGGATATCGCCCTGATCAAGAGCGAAGAGGGCGAGAAAATGGTGCTTGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1381
TGACATCGAGGAGGATATCGCCCTGATCAAGAGCGAAGAGGGCGAGAAAATGGTGCTTGA1029
GAATAACTTCTTCGTCGAGACCATGCTCCCAAGCAAGATCATGCGGAAACTGGAGCCTGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1441
GAATAACTTCTTCGTCGAGACCATGCTCCCAAGCAAGATCATGCGGAAACTGGAGCCTGA1089
GGAGTTCGCTGCCTACCTGGAGCCATTCAAGGAGAAGGGCGAGGTTAGACGGCCTACCCT|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1501
GGAGTTCGCTGCCTACCTGGAGCCATTCAAGGAGAAGGGCGAGGTTAGACGGCCTACCCT1149
CTCCTGGCCTCGCGAGATCCCTCTCGTTAAGGGAGGCAAGCCCGACGTCGTCCAGATTGT|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1561
CTCCTGGCCTCGCGAGATCCCTCTCGTTAAGGGAGGCAAGCCCGACGTCGTCCAGATTGT1209
CCGCAACTACAACGCCTACCTTCGGGCCAGCGACGATCTGCCTAAGATGTTCATCGAGTC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1621
CCGCAACTACAACGCCTACCTTCGGGCCAGCGACGATCTGCCTAAGATGTTCATCGAGTC1269
CGACCCTGGGTTCTTTTCCAACGCTATTGTCGAGGGAGCTAAGAAGTTCCCTAACACCGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1681
CGACCCTGGGTTCTTTTCCAACGCTATTGTCGAGGGAGCTAAGAAGTTCCCTAACACCGA1329
GTTCGTGAAGGTGAAGGGCCTCCACTTCAGCCAGGAGGACGCTCCAGATGAAATGGGTAA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1741
GTTCGTGAAGGTGAAGGGCCTCCACTTCAGCCAGGAGGACGCTCCAGATGAAATGGGTAA1389
GTACATCAAGAGCTTCGTGGAGCGCGTGCTGAAGAACGAGCAGACCGGTGGTGGGAGCGG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1801
GTACATCAAGAGCTTCGTGGAGCGCGTGCTGAAGAACGAGCAGACCGGTGGTGGGAGCGG1449
AGGTGGCGGATCAGGTGGCGGAGGCTCCGGAGGGATTGAACAAGATGGATTGCACGCAGG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1861
AGGTGGCGGATCAGGTGGCGGAGGCTCCGGAGGGATTGAACAAGATGGATTGCACGCAGG1509
TTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1921
TTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGG1569
CTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||1981
CTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAA1629
GACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCT|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2041
GACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCT1689
GGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2101
GGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGA1749
CTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2161
CTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGC1809
CGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTAC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2221
CGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTAC1869
CTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2281
CTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGC1929
CGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACT|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2341
CGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACT1989
GTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2401
GTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGA2049
TGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2461
TGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGG2109
CCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2521
CCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGA2169
AGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGA|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2581
AGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGA2229
TTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGG|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2641
TTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGG2289
TTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGATGGCCGCAATAAAATATC|||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||2701
TTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGATGGCCGCAATAAAATATC2349
TTTATTTTCATTACATCTGTGT......................................|||||||||||||||||
|||||2761 TTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGCGATAAGGATCCTSEQUENC
The preparation method and applications RLUC expression units of E LISTING luciferase reporter gene expression vectors pFireRluc
cgcg421 gatctgcgca gcaccatggc ctgaaataac ctctgaaaga ggaacttggt taggtacctt481
ctgaggcgga aagaaccagc tgtggaatgt gtgtcagtta gggtgtggaa agtccccagg541
ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg601
aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc661
aaccatagtc ccgcccctaa ctccgcccat cccgccccta actccgccca gttccgccca721
ttctccgccc catggctgac taattttttt tatttatgca gaggccgagg ccgcctcggc781
ctctgagcta ttccagaagt agtgaggagg cttttttgga ggcctaggct tttgcaaaaa841
gcttgattct tctgacacaa cagtctcgaa ccaaaggctg gagccaccat ggcttccaag901
gtgtacgacc ccgagcaacg caaacgcatg atcactgggc ctcagtggtg ggctcgctgc961
aagcaaatga acgtgctgga ctccttcatc aactactatg attccgagaa gcacgccgag1021
aacgccgtga tttttctgca tggtaacgct gcctccagct acctgtggag gcacgtcgtg1081
cctcacatcg agcccgtggc tagatgcatc atccctgatc tgatcggaat gggtaagtcc1141
ggcaagagcg ggaatggctc atatcgcctc ctggatcact acaagtacct caccgcttgg1201
ttcgagctgc tgaaccttcc aaagaaaatc atctttgtgg gccacgactg gggggcttgt1261
ctggcctttc actactccta cgagcaccaa gacaagatca aggccatcgt ccatgctgag1321
agtgtcgtgg acgtgatcga gtcctgggac gagtggcctg acatcgagga ggatatcgcc1381
ctgatcaaga gcgaagaggg cgagaaaatg gtgcttgaga ataacttctt cgtcgagacc1441
atgctcccaa gcaagatcat gcggaaactg gagcctgagg agttcgctgc ctacctggag1501
ccattcaagg agaagggcga ggttagacgg cctaccctct cctggcctcg cgagatccct1561
ctcgttaagg gaggcaagcc cgacgtcgtc cagattgtcc gcaactacaa cgcctacctt1621
cgggccagcg acgatctgcc taagatgttc atcgagtccg accctgggtt cttttccaac1681
gctattgtcg agggagctaa gaagttccct aacaccgagt tcgtgaaggt gaagggcctc1741
cacttcagcc aggaggacgc tccagatgaa atgggtaagt acatcaagag cttcgtggag1801
cgcgtgctga agaacgagca gaccggtggt gggagcggag gtggcggatc aggtggcgga1861
ggctccggag ggattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag1921
aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc1981
cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg2041
aatgaactgc aggacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc2101
gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg2161
ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct2221
gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg2281
aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat2341
ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc2401
atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg2461
gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc2521
tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct2581
gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat2641
cgccttcttg acgagttctt ctgagcggga ctctggggtt cgaaatgacc gaccaagcga2701
cgcccaacct gccatcacga tggccgcaat aaaatatctt tattttcatt acatctgtgt2761
gttggttttt tgtgtgaatc gat
<160> 0
<170> SIPOSequenceListing 1.0
Claims (4)
1. a kind of preparation method of luciferase reporter gene expression vector pFireRluc, which is characterized in that with pmirGLO
Carrier is template, and carrying out amplification as primer using R1/R2 obtains Rluc sequence fragments, which adds SalI restriction enzyme sites,
With Sal I single endonuclease digestion pGL4.10 carriers, Rluc sequence fragments are inserted into pGL4.10 carriers, the pFireRluc of recombination is built
Luciferase reporter gene carrier, specific method include the following steps：
（1）, design Rluc primers：
According to Rluc expression unit DNA sequence dna design primers R1, R2 in pmirGLO plasmids：
（2）, PCR amplification：
Using pmirGLO carriers as template, PCR amplification is carried out by primer of R1, R2, obtains Rluc expression units；
（3）, product electrophoresis：
Pcr amplification product is mixed with 10 × bromophenol blue sample loading buffer, into row agarose gel electrophoresis, uses DNA
Makrer2000 judges amplified fragments size, is taken a picture with gel analysis system；
（4）, to electrophoresis plasmid extraction, purifying, method is：Under ultraviolet light, by the agarose containing target gene fragment
Gel is quickly cut, the weight of calculated for gel block；Buffer DE-A are added in gel piece, melt；The buffering of half volume is added
Liquid Buffer DE-B, are mixed into mixed liquor；By mixed liquor dress column centrifugation, filtrate is abandoned, 4 times repeatedly, Eppendorf pipes is packed into and washes
De- DNA, centrifugation, warm bath, electrophoresis verify the target fragment length of recycling, obtain Rluc pcr amplification products；
（5）, prepare DH5 α competent bacterias：With the single DH5 α bacterium colonies on oese picking LB solid mediums, it is inoculated with
In LB liquid medium, shaken overnight, culture moves to bacterium solution in PA tube, places and is cultivated in mixture of ice and water, cold
But, it centrifuges, recycles bacterium, be resuspended, centrifugation obtains resuspension thalline；
（6）, with T4 DNA ligases Rluc expression units are connect with pGEM-T carriers, obtain recombinant vector pGEM-T-Rluc,
PGEM-T Rluc recombinants are transformed into bacillus coli DH 5 alpha；
（7）, using T7 and SP6 as primer, PCR identifies recombinant pGEM-T Rluc, and positive recombinant vector is located at 2526bp.
2. the preparation method of luciferase reporter gene expression vector pFireRluc according to claim 1 a kind of,
It is characterized in that, using pmirGLO carriers as template, amplification is carried out as primer using R1/R2 and obtains Rluc sequence fragments, the sequence both ends
In addition Rluc sequence fragments are inserted into pGL4.10 carriers, structure by SalI restriction enzyme sites with Sal I single endonuclease digestion pGL4.10 carriers
Build the pFireRluc luciferase reporter gene carriers of recombination；Specific method includes the following steps：
（1）, design Rluc primers：
According to Rluc expression unit DNA sequence dna design primers R1, R2 in pmirGLO plasmids：
R1 is 5'-AAAGTCGACCGCGGATCTGCGCAGCACCATGGC-3'；
R2 is 5'-CCCGTCGACATCGATTCACACAAAAAACCAACACA-3'；
GTCGAC isI restriction enzyme sites of Sal；
（2）, PCR amplification：
Using pmirGLO carriers as template, PCR amplification is carried out by primer of R1, R2, obtains Rluc expression units；Pcr amplification reaction
System is：10 × buffer, 32 μ L, R1, R2 of μ L, 4 × dNTPs each 0.5 μ L, Pfu high fidelity enzyme 0.5 μ L, ddH2O18.5 μ L,
5 μ L of template DNA；Reaction condition：95 DEG C of pre-degeneration 3min；95 DEG C denaturation 45s, 55 DEG C annealing 55s, 72 DEG C extension 90min, 30
A cycle；72 DEG C of ends extend 10min, obtain pcr amplification product；
（3）, product electrophoresis：
6 μ l of pcr amplification product are taken to be mixed with 10 × bromophenol blue sample loading buffer, 1 μ l, with containing 5 μ g/ μ l of ethidium bromide, 1 × TAE
1.5% agarose gel electrophoresis of mass concentration of electrophoretic buffer, voltage 5V/cm judge amplified fragments with DNA Makrer2000
Size is taken a picture with gel analysis system, and the amplification length of Rluc expression units is 2350bp；
（4）, to electrophoresis plasmid extraction, purifying, method is：
A, under ultraviolet light, the Ago-Gel containing target gene fragment is quickly cut, is placed on the 1.5ml to have weighed
Eppendorf pipes in, weigh；Calculate the weight of gel piece；
B, it is converted with the weight of gel piece and the volume of buffer solution B uffer DE-A is added, the Buffer of 3 gel volumes is added
DE-A, the centrifuge tube for filling gel piece is placed in heating in 75 DEG C of water baths, and, until gel melts completely, aerosol time cannot surpass
10min is crossed, centrifuge tube is shaken per 2-3min and accelerates gel dissolving；
C, the buffer solution B uffer DE-B of half volume are added, mixing terminates colloidal sol；
D, DNA is prepared column to be placed on the centrifuge tube of 2ml, the mixed liquor in upper step is moved into pillar, 12000 × g, centrifugation
1min；
E, filtrate is abandoned, DNA, which is prepared column, to be put back in former centrifuge tube, and 500 μ l buffer solution B uffer W1,12000 × g, centrifugation is added
30s；
F, filtrate is abandoned, DNA, which is prepared column, to be put back in centrifuge tube, 700 μ l buffer solution B uffer W2 is added, then with 12000 × g, from
Heart 30s；
G, filtrate is abandoned, DNA, which is prepared column, again puts back in centrifuge tube, adds 700 μ l buffer solution B uffer W2, with 12000 × g, from
Heart 1min；
H, filtrate is abandoned, DNA, which is prepared column, to be put back in centrifuge tube, with 12000 × g, centrifuges 1min；
I, the Eppendorf pipes for column will be prepared putting into a clean 1.5ml, fiber center membrane add the eluent of 30 μ l with
Eluted dna allows it to stand 5min at room temperature, then with 12000 × g, centrifuges 1min, Eluent uses preceding 65 DEG C of water-bath temperature
Bath, improves elution efficiency, and the target fragment length of electrophoresis verification recycling obtains Rluc pcr amplification products at 2350bp；
（5）, prepare DH5 α competent bacterias：With the single DH5 α bacterium colonies on oese picking LB solid mediums, it is inoculated with
In 5ml LB liquid mediums, 37 DEG C, 2000 × g, shaken overnight takes the LB liquid of the 5ml bacterium solutions of α containing DH5 that 30ml LB are added
In fluid nutrient medium, 2000 × g, 37 DEG C of shaken cultivations 4-6 hours to exponential phase OD600 ≈ 0.3-0.4；Aseptic condition
Under, bacterium solution is moved in the 50ml PA tubes of an ice precooling by high pressure sterilization processing, is placed in mixture of ice and water
10min after so that culture is cooled to 0 DEG C, 4 DEG C, 2700 × g, centrifuges 10min, recycles bacterium；Abandon supernatant；It is ice-cold
Thalline is resuspended in 0.1mmol/L CaCl2 solution 10ml, is placed in mixture of ice and water after 30min, 4 DEG C, 2700 × g, centrifuges
10min abandons supernatant, the 0.1mmol/L CaCl for adding 2ml ice to be pre-chilled2Thalline is resuspended；It is spare to set 4 DEG C of refrigerator 12-24h；
（6）, with T4 DNA ligases Rluc expression units are connect with pGEM-T carriers, obtain recombinant vector pGEM-T-Rluc；
Coupled reaction system is：2 × Buffer, 5 μ l, glue recycle 3 μ l, pGEM-T Easy carriers of Rluc pcr amplification products 1 μ l, T4
1 μ l of DNA ligase, reaction condition：Reaction system is placed in 1.5ml Eppendorf pipes, 16 DEG C overnight, pGEM-T Rluc
Recombinant is transformed into bacillus coli DH 5 alpha；
（7）, using T7/SP6 as primer, PCR identifies recombinant pGEM-T Rluc, and positive recombinant vector is located at 2526bp.
3. luciferase reporter gene expression vector pFireRluc prepared by claims 1 or 2 the method is in double fluoresceins
Applications of the enzyme reporter gene expression carrier pFireRluc in eukaryotic cell expression identification.
4. luciferase reporter gene expression vector pFireRluc prepared by claims 1 or 2 the method is in double fluoresceins
Applications of the enzyme reporter gene expression carrier pFireRluc in eukaryocyte activity test.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810695795.0A CN108728467A (en) | 2018-06-29 | 2018-06-29 | The preparation method and applications of luciferase reporter gene expression vector pFireRluc |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810695795.0A CN108728467A (en) | 2018-06-29 | 2018-06-29 | The preparation method and applications of luciferase reporter gene expression vector pFireRluc |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108728467A true CN108728467A (en) | 2018-11-02 |
Family
ID=63931195
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810695795.0A Pending CN108728467A (en) | 2018-06-29 | 2018-06-29 | The preparation method and applications of luciferase reporter gene expression vector pFireRluc |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728467A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154780A (en) * | 2020-01-13 | 2020-05-15 | 江西农业大学 | Method for detecting activity of Dnmt3 gene promoter of western bee by using dual-luciferase reporter gene |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102094037A (en) * | 2010-12-13 | 2011-06-15 | 湖北省农业科学院畜牧兽医研究所 | Reference internal type dual-luciferase reporter vector and application thereof |
| CN103343167A (en) * | 2013-07-16 | 2013-10-09 | 中南大学湘雅医院 | Screening and identifying method of SCA3/MJD molecular marker miRNAs capable of regulating and controlling ATXN3 gene expression |
| CN103898158A (en) * | 2014-03-04 | 2014-07-02 | 上海中医药大学附属曙光医院 | Carrier with MALAT1 (Metastasis-Associated Lung Adenocarcinoma Transcript 1) promoter sequence and reporter gene as well as construction method and application thereof |
| CN104164443A (en) * | 2014-07-14 | 2014-11-26 | 东华大学 | Dual-luciferase monitoring plasmid for detecting living yeast cell UPR level, construction and application thereof |
| WO2015120197A1 (en) * | 2014-02-05 | 2015-08-13 | Regents Of The University Of California | Rna editing biomarkers for diagnosis, pharmacological screening and prognostication in cancer |
| US20150225739A1 (en) * | 2014-02-13 | 2015-08-13 | National Taiwan University | Expression vectors comprising ires element and the multiple expression gene system thereof |
| CN107893085A (en) * | 2017-12-19 | 2018-04-10 | 浙江大学 | A kind of luciferase reporter gene plasmid and its structure available for lonely nuclear receptor activities regulator screening is with applying |
| CN108004270A (en) * | 2017-11-24 | 2018-05-08 | 上海交通大学 | Utilize the method for luciferase reporter gene detection duck IFN-β promoter activity |
-
2018
- 2018-06-29 CN CN201810695795.0A patent/CN108728467A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102094037A (en) * | 2010-12-13 | 2011-06-15 | 湖北省农业科学院畜牧兽医研究所 | Reference internal type dual-luciferase reporter vector and application thereof |
| CN103343167A (en) * | 2013-07-16 | 2013-10-09 | 中南大学湘雅医院 | Screening and identifying method of SCA3/MJD molecular marker miRNAs capable of regulating and controlling ATXN3 gene expression |
| WO2015120197A1 (en) * | 2014-02-05 | 2015-08-13 | Regents Of The University Of California | Rna editing biomarkers for diagnosis, pharmacological screening and prognostication in cancer |
| US20150225739A1 (en) * | 2014-02-13 | 2015-08-13 | National Taiwan University | Expression vectors comprising ires element and the multiple expression gene system thereof |
| CN103898158A (en) * | 2014-03-04 | 2014-07-02 | 上海中医药大学附属曙光医院 | Carrier with MALAT1 (Metastasis-Associated Lung Adenocarcinoma Transcript 1) promoter sequence and reporter gene as well as construction method and application thereof |
| CN104164443A (en) * | 2014-07-14 | 2014-11-26 | 东华大学 | Dual-luciferase monitoring plasmid for detecting living yeast cell UPR level, construction and application thereof |
| CN108004270A (en) * | 2017-11-24 | 2018-05-08 | 上海交通大学 | Utilize the method for luciferase reporter gene detection duck IFN-β promoter activity |
| CN107893085A (en) * | 2017-12-19 | 2018-04-10 | 浙江大学 | A kind of luciferase reporter gene plasmid and its structure available for lonely nuclear receptor activities regulator screening is with applying |
Non-Patent Citations (2)
| Title |
|---|
| FENG LONG ET AL.: "A novel dual-luciferase assay for anti-HIV drug screening based on the CCR5/CXCR4 promoters", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 马云云 等: "带新霉素抗性的荧光素酶报告载体的构建", 《郑州大学学报（医学版）》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154780A (en) * | 2020-01-13 | 2020-05-15 | 江西农业大学 | Method for detecting activity of Dnmt3 gene promoter of western bee by using dual-luciferase reporter gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP4008336A1 (en) | A recombinant nucleic acid molecule of transcriptional circular rna and its application in protein expression | |
| US6410276B1 (en) | Selective amplification of target polynucleotide sequences | |
| CN106544351A (en) | CRISPR Cas9 knock out the method for drug resistant gene mcr 1 and its special cell-penetrating peptides in vitro | |
| Cobbin et al. | Influenza virus PB1 and neuraminidase gene segments can cosegregate during vaccine reassortment driven by interactions in the PB1 coding region | |
| CN111235313A (en) | CRISPR-Cas13 method for rapidly detecting novel coronavirus | |
| CN112322705A (en) | Isothermal amplification fluorescence RMA method for multiple nucleic acid detection | |
| CN108707635B (en) | Compositions, methods and uses for nucleotide sequence modification | |
| EA022993B1 (en) | Nucleic acid molecules coding for alpha- and beta-chains of human follicle stimulating hormone (fsh) | |
| CN108624720A (en) | The primed probe group and kit of RAA Fluorometric assay Rift Valley fever virus | |
| CN117987599A (en) | CRISPR reagent for detecting 2019-nCov and application thereof | |
| CN108728467A (en) | The preparation method and applications of luciferase reporter gene expression vector pFireRluc | |
| CN113862263B (en) | Sequencing library construction method and application | |
| JP2023520948A (en) | Nucleic acid sequence selection method | |
| CN102443628B (en) | Preparation method for nucleic acid quality control by chimeric exogenous independent sequence | |
| CN109722472A (en) | Detect the universal PCR primer combination and application of Chimeric antigen receptor gene | |
| US20100304375A1 (en) | Influenza Virus Genome Replication and Transcription System in Yeast Cells | |
| US20230235334A1 (en) | Phosphorylation-based mirna sensor | |
| CN107619438B (en) | Novel cyclic dinucleotide receptor and method and kit for screening agonist or inhibitor thereof | |
| CN113355329B (en) | Nucleic acid aptamer specifically binding reverse transcriptase and application thereof | |
| CN114410835A (en) | RPA-LFD kit for rapidly detecting novel coronavirus | |
| CN103917645A (en) | Cell free translation system for compound screening and related uses | |
| KR101340159B1 (en) | Probes for detecting new influenza viruses, and a method for detecting new influenza viruses using the same | |
| CN115232795B (en) | Cell strain for stably expressing AQP4-M23 protein, construction method and application thereof | |
| US20240026345A1 (en) | Parallel single-cell reporter assays and compositions | |
| CN117143878B (en) | Nucleic acid aptamer for specifically targeting SARS-COV-2N protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |