CN108728424B - Method for purifying immobilized alpha-amino acid lipid acyltransferase by one step - Google Patents
Method for purifying immobilized alpha-amino acid lipid acyltransferase by one step Download PDFInfo
- Publication number
- CN108728424B CN108728424B CN201810672940.3A CN201810672940A CN108728424B CN 108728424 B CN108728424 B CN 108728424B CN 201810672940 A CN201810672940 A CN 201810672940A CN 108728424 B CN108728424 B CN 108728424B
- Authority
- CN
- China
- Prior art keywords
- amino acid
- alpha
- gene
- vector
- immobilized
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N11/00—Carrier-bound or immobilised enzymes; Carrier-bound or immobilised microbial cells; Preparation thereof
- C12N11/16—Enzymes or microbial cells immobilised on or in a biological cell
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Abstract
The invention relates to the technical field of enzyme immobilization, and particularly discloses a method for one-step purification of immobilized alpha-amino acid lipid acyltransferase. The method of the invention saves operation steps, ensures the expression of the target protein, can be immobilized by using a common amino carrier, and is suitable for industrial production.
Description
Technical Field
The invention relates to the technical field of enzyme immobilization, and particularly relates to a method for purifying immobilized alpha-amino acid lipid acyltransferase in one step.
Background
Immobilization of enzymes is a technique in which enzymes are bound or confined to a certain area by a solid material, yet can undergo their own catalytic reactions, and can be recovered and recycled. The immobilized enzyme overcomes the defects of free enzyme while keeping the characteristics of high efficiency, specificity and mild enzyme catalytic reaction, and has a series of advantages of high storage stability, easy separation and recovery, repeated use, continuous and controllable operation, simple and convenient process and the like. But also has the advantages of saving resources and energy, reducing or preventing pollution and meeting the strategic requirements of sustainable development.
The immobilized enzyme techniques can be classified into adsorption, binding, crosslinking, and embedding. The covalent binding method is widely applied because the solid phase carrier is connected with enzyme molecules through more stable covalent bonds, and the enzyme is not easy to fall off in the using process. The covalent bonding of the enzyme and the carrier is mainly formed by the chemical reaction of active functional groups on the surface of the carrier and active amino acid residues on the surface of the enzyme. However, such binding is generally achieved by binding the carrier to amino groups of amino acid residues of the protein at random, and non-specific binding is easily caused due to lack of specificity of the target protein and specificity of the binding site. In this case, in order to improve the enzymatic activity of the immobilized enzyme, it is generally necessary to purify the target protein, which increases the operation steps and cost. In addition, random combination can cause the inactivation of partial enzyme molecules, and influences the enzyme activity yield in the immobilization process.
Some studies have been made to solve the problem of non-specific binding sites by modifying enzymes with genes, which can eliminate the subsequent purification step and overcome some problems of the conventional enzyme immobilization methods, but these methods also have certain defects. Firstly, in the engineering bacteria construction process, two protein genes need to be transferred simultaneously, one is a target enzyme, namely lipase gene, and the other is FGE (formylglycine synthetase) gene. Two genes use two sets of induction expression systems, in the expression process, arabinose is firstly utilized to carry out induction expression on FGE genes, and lipase is induced after a period of time, so that the step-by-step induction mode easily causes the relatively low expression quantity of the lipase, and the production efficiency is reduced. In addition, the solid phase carriers used in the researches have complex production process and high use cost, are not easy to popularize in the field of immobilized enzyme production, and are not suitable for the production of industrialized immobilized enzymes.
The alpha-amino acid ester acyltransferase can generate dipeptide by taking amino acid methyl ester as an acyl donor and amino acid as a nucleophilic substance, only generates a dipeptide byproduct, can also generate polypeptide by taking the amino acid methyl ester and the dipeptide as substrates, and has important application value in the preparation of biochemical medicines and nutrients. At present, no relevant report of realizing one-step purification immobilization of alpha-amino acid ester acyltransferase by genetic modification exists.
Disclosure of Invention
In view of the above technical problems, an object of the present invention is to provide an economical and efficient method for purifying an immobilized α -amino acid lipid acyltransferase in one step.
In order to achieve the purpose, the invention adopts the following technical scheme:
an improved one-step process for purifying an immobilized alpha-amino acid lipid acyltransferase, comprising the steps of:
(1) fusing an alpha-amino acid ester acyltransferase gene with an aldehyde-based tag gene;
(2) respectively connecting the fused gene in the step (1) and the formylglycine synthetase gene to a prokaryotic expression vector;
(3) transferring the constructed vector into a host cell, and performing synchronous induced expression on the two enzymes;
(4) and centrifugally collecting the induced thallus, centrifugally collecting supernatant after crushing, and mixing with an amino carrier for immobilization.
Preferably, the alpha-amino acid ester acyltransferase gene is derived from the genus Sphingobacterium and the formylglycine synthetase gene is derived from the genus Streptococcus pneumoniae.
Preferably, step (1) is specifically: and adding a nucleotide sequence comprising the amino acid sequence of SEQ ID NO. 1 before the start codon or before the stop codon of the alpha-amino acid ester acyltransferase gene.
Preferably, the fused gene in the step (1) is connected to a pET30a vector to obtain a SEAT-30a vector, and the formylglycine synthetase gene is firstly connected to a Topo vector by using a Gateway system and then is recombined to a PDEST17 vector to obtain an FGE-PDEST17 vector.
Preferably, the host cell in step (3) is escherichia coli, and the method for synchronously inducing expression comprises the following steps: the host cells were cultured to OD in liquid LB medium containing ampicillin and kanamycin600When the concentration was 0.6 to 0.8, IPTG was added to induce both enzymes.
Further preferably, the concentration of IPTG is 0.5-1 mM, and the induction is carried out for 2-12 h at 25-30 ℃.
Preferably, the mass ratio of the supernatant to the amino carrier in the step (4) is 1: 0.5-20, the reaction temperature is 8-30 ℃, the pH value is 6.5-8.0, and the reaction time is 2-24 h.
Compared with the traditional immobilized enzyme technology, the invention can realize one-step purification of alpha-amino acid ester acyltransferase, reduce purification steps and achieve the aim of specifically immobilizing the target protein. Meanwhile, the covalent interaction between the aldehyde label and the immobilized carrier overcomes the problem that the carrier is randomly combined with an amino side chain in a protein molecule in the traditional immobilization method, which may cause the change of the tertiary structure of the enzyme or cover the active site, resulting in the inactivation of part of the enzyme. Moreover, after the technology is applied, the enzyme activity yield is obviously improved compared with the traditional immobilized enzyme method, and the enzyme stability has no obvious difference compared with the traditional immobilized enzyme method.
The invention realizes the one-step purification and immobilization of alpha-lipid acyltransferase for the first time, improves the induction mode, synchronously induces the alpha-lipid acyltransferase and formylglycine synthetase, saves the operation steps and ensures the expression of the target protein; in addition, the method of the invention uses the traditional and cheap amino-immobilized carrier, so that the method is further suitable for industrialization.
Drawings
FIG. 1 is a pre-and post-immobilization electrophoretogram of alpha-lipoyltransferase of the present invention;
wherein, 1: before immobilization; 2: after an HA carrier (model LX-1000HA) is immobilized; 3: after the NH-1 carrier (model LX-1000NH010) is immobilized; 4: after the NH-2 carrier (model LX-1000NH030) is immobilized; 5: protein molecular weight standards. The band indicated by the arrow in the figure is alpha-lipid acyltransferase.
FIG. 2 is an electrophoretogram of the yields of target enzymes for simultaneous induction and step-by-step induction in accordance with the present invention
Wherein, 1: protein molecular weight marker; 2: BL21 mycoprotein control; 3: synchronous induction; 4: and (4) step-by-step induction. The arrow indicates the alpha-lipid acyltransferase protein band, and the arrow indicates the FGE protein band.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Example 1 Gene acquisition and vector construction
Obtaining a gene sequence of sphingosine bacillus alpha-amino acid lipid acyltransferase (SEAT gene, access No. AB610978.1) and a gene sequence of streptococcus pneumoniae formylglycine synthetase (FGE gene, access No. NC-000962.3), sending the gene sequences to a third-party service organization to synthesize a full-length gene sequence, wherein a nucleotide sequence 5 ' CGAATTTTCTGTCCTCAAAGAT3 ' (SEQ ID NO:2) for encoding LCTPSR is added before a stop codon at the 3 ' end of the SEAT gene, BamH I enzyme cutting sites and HindIII enzyme cutting sites are respectively added at two sides of the gene, and CACC is added before an initial codon of the FGE gene. The synthesized SEAT gene is connected into a pET30a vector by utilizing an enzyme digestion connection method to obtain a SEAT-30a vector.
The FGE gene is firstly connected to a Topo vector by using a Gateway system and then is recombined to a PDEST17 vector to obtain an FGE-PDEST17 vector. Sequencing confirmed the correct sequence.
Synthesis of primer FGE-BAD-f: 5 ' CATGCCATGGATGCTGACCGAGTTGGTTG3 ' (SEQ ID NO:3) and FGE-BAD-r:5 ' CTACCCGGACACCGGGTCAAGCTTGG (SEQ ID NO:4), using the synthesized FEG gene as a template, carrying out PCR amplification, recovering the product, carrying out enzyme digestion by using Nco I and Hind III, recovering the enzyme digestion product by using glue, and connecting the enzyme digestion product with a pBAD/Myc-His vector completely digested by using Nco I and Hind III to obtain the FGE-pBAD vector. Sequencing confirmed correct.
Example 2 obtaining of expression Strain
100ng of each of the sequence-confirmed correct SEAT-30a and FGE-pdest17 plasmids was mixed with 100. mu.l of BL21(DE3) competent cells, allowed to stand on ice for 30min, heat-shocked at 42 ℃ for 30sec, allowed to stand at room temperature for 5min, then added with liquid LB medium, shaken at 37 ℃ for 30min, centrifuged at 5000rpm for 1min, the supernatant was discarded, and the precipitate was resuspended in 200. mu.l of sterile water and then spread on a solid LB plate containing 50. mu.g/mL ampicillin and 30. mu.g/mL kanamycin. The culture was carried out overnight at 37 ℃. Positive monoclonals were picked the next day, cultured overnight in liquid LB medium containing 50. mu.g/mL ampicillin and 30. mu.g/mL kanamycin, and IPTG was added to the resulting concentration of 1mM/L to induce protein expression at 25 ℃ for 4 hours. Collecting 1mL culture solution 12000g, centrifuging for 1min, resuspending with 100 μ l distilled water, adding 100 μ l2 xSDS protein loading buffer, mixing, heating at 95 deg.C for 10min, centrifuging at 12000g for 5min, collecting supernatant, and performing SDS-PAGE to detect SEAT and FGE expression levels. The strain SQ05, which both expressed and expressed the highest amount, was selected as the test strain.
Example 3 protein induced fermentation
The SQ05 strain was cultured overnight at 37 ℃ in liquid LB medium containing 50. mu.g/mL ampicillin and 30. mu.g/mL kanamycin. The next day, 20ml of the culture medium was taken and further expanded to 1L. When the concentration of the bacteria reaches OD600When the concentration was 0.6 to 0.8, IPTG was added to give a final concentration of 0.5 mM. Induction was carried out at 25 ℃ for 6 h.
EXAMPLE 4 one-step purification immobilization of SEAT
The fermentation broth of the SQ05 strain was centrifuged at 6000g for 10min, the supernatant was discarded, and the cells were resuspended in 20mM phosphate buffer pH7.5 to a cell concentration of 7.5%. And crushing the thallus suspension in a high-pressure homogenizer. The crushed homogeneous liquid enters a high-speed refrigerated centrifuge for centrifugation at 4 ℃ and 12000g for 10min, and the supernatant is reserved.
The amino vector from West Ann blue Xiao corporation was first soaked with 20mM phosphate buffer pH7.5 for 1h and filtered. The treated carrier was mixed with 1: 20-1: mixing with enzyme solution at a ratio of 0.5 (volume is supplemented with buffer solution of 1: 2-1: 0.5), stirring at 20 deg.C and 100rpm for 24 hr, filtering, washing with 20mM phosphate buffer solution pH7.5 for 3 times, and filtering to obtain immobilized enzyme. As shown in FIG. 1, the results of electrophoresis showed that the alpha-amino acid lipid acyltransferase of the present invention has good specificity and can be immobilized on different amino carriers, while other hetero proteins are not adsorbed.
Comparative example 1 SEAT and FGE step Induction
The SQ06 strain was cultured overnight at 37 ℃ in liquid LB medium containing 50. mu.g/mL ampicillin and 30. mu.g/mL kanamycin. The next day, 20ml of the culture medium was taken and further expanded to 1L. When the concentration of the bacteria reaches OD600When the concentration is 0.6-0.8, arabinose is added to a final concentration of 0.02%, and after shaking for 30min, IPTG is added to a final concentration of 0.5 mM. Induction was carried out at 25 ℃ for 6 h.
Effect example 1 comparison of expression amounts of synchronous Induction and stepwise Induction
The step-by-step induction method comprises the following steps: 100ng of each of the sequence-confirmed correct SEAT-30a and FGE-pBAD plasmids was mixed with 100. mu.l of BL21(DE3) competent cells, allowed to stand on ice for 30min, heat shocked at 42 ℃ for 30sec, allowed to stand at room temperature for 5min, added with liquid LB medium, shaken at 37 ℃ for 30min, centrifuged at 5000rpm for 1min, the supernatant was discarded, the precipitate was resuspended in 200. mu.l of sterile water, and then coated with a solid LB plate containing 50. mu.g/mL ampicillin and 30. mu.g/mL kanamycin. The culture was carried out overnight at 37 ℃. The next day, positive single clones were picked, cultured overnight in liquid LB medium containing 50. mu.g/mL ampicillin and 30. mu.g/mL kanamycin, first 0.02% arabinose was added, and after 30min of induction, IPTG was added to a final concentration of 1mM/L to induce protein expression at 25 ℃ for 4 hours. Collecting 1mL culture solution 12000g, centrifuging for 1min, resuspending with 100 μ l distilled water, adding 100 μ l2 xSDS protein loading buffer, mixing, heating at 95 deg.C for 10min, centrifuging at 12000g for 5min, collecting supernatant, and performing SDS-PAGE to detect SEAT and FGE expression levels. The strain SQ06, which both expressed and expressed the highest amount, was selected as a control strain.
1ml of induced SQ05 and SQ06 bacterial liquid is respectively taken, 12000g is centrifuged for 2min, the supernatant is discarded, 100 mul PBS is added into the thalli for heavy suspension, 100 mul 2 xSDS protein loading buffer solution is added into the thalli for even mixing, the mixture is heated for 10min at 95 ℃, 12000g is centrifuged for 5min, and the supernatant is taken for SDS-PAGE to detect the expression levels of SEAT and FGE for comparison. As shown in FIG. 2, the SEAT protein level in the synchronous induction was significantly increased compared to the stepwise induction, and there was no significant difference in the FGE level compared to the two.
Comparative example 2 traditional immobilization of SEAT
Conventional aldehyde immobilization was performed on the α -amino acid lipid acyltransferase in SQ05 strain, which was not labeled with aldehyde:
the fermentation broth of the SQ05 strain was centrifuged at 6000g for 10min, the supernatant was discarded, and the cells were resuspended in 20mM phosphate buffer pH7.5 to a cell concentration of 7.5%. And crushing the thallus suspension in a high-pressure homogenizer. The crushed homogeneous liquid enters a high-speed refrigerated centrifuge for centrifugation at 4 ℃ and 12000g for 10min, and the supernatant is reserved.
The amino vector from West Ann blue Xiao corporation was first soaked with 20mM phosphate buffer pH7.5 for 1h and filtered. The filtered carrier was added with 4 volumes of 2% glutaraldehyde in phosphate buffer at 25 ℃ and stirred for 1 hour, filtered, washed with deionized water until the carrier was clear, and filtered to remove water. The treated carrier was mixed with 1: 20-1: mixing with enzyme solution at a ratio of 0.5 (volume is supplemented with buffer solution of 1: 2-1: 0.5), stirring at 20 deg.C and 100rpm for 24 hr, filtering, washing with 20mM phosphate buffer solution pH7.5 for 3 times, and filtering to obtain immobilized enzyme.
Effect example 2 comparison of enzyme Activity yields of immobilized enzymes
The enzyme activity of the one-step purified immobilized enzyme obtained in example 4 and the immobilized enzyme and the supernatant of the homogeneous liquid obtained in the comparative example were measured respectively (the carrier was NH-1 carrier of xian blue dawn company, both carriers were used), and the enzyme activity yield was calculated. The enzyme activity determination method is carried out by referring to the CN1316016 method. The results are shown in table 1, and the enzyme activity yield of the method is obviously improved compared with that of the traditional immobilization method.
TABLE 1 comparison of enzyme activity yields for one-step purification immobilization and conventional immobilization
Effect example 3 detection of stability of immobilized enzyme
The one-step purified immobilized enzyme obtained in example 4 and the immobilized enzyme obtained in comparative example by the conventional immobilization process (mass ratio carrier: supernatant: 1:10) were placed in 50mM phosphate buffer solution at pH9.5, respectively, and incubated at 25 ℃ with a shaker at constant temperature of 200 rpm. Sampling for 0, 0.5, 1, 2, 3, 5, 8, 10, 20 and 30 hours respectively, and determining the enzyme activity of the immobilized enzyme. The enzyme activity determination method refers to the CN1316016 method, and the results are shown in Table 2, and the stability of the immobilized enzyme by the method of the invention is not obviously different from that of the traditional immobilization method.
TABLE 1 comparison of the stability of the one-step purification immobilization and the conventional immobilization
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents or improvements made within the spirit and principle of the present invention should be included in the scope of the present invention.
SEQUENCE LISTING
<110> Hebei Shanquan Biotechnology Ltd
<120> method for purifying immobilized alpha-amino acid lipid acyltransferase in one step
<130> 2018.6.22
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 6
<212> Protein
<213> Artificial Synthesis
<400> 1
LCTPSR 6
<210> 2
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 2
cgaattttct gtcctcaaag at 22
<210> 3
<211> 29
<212> DNA
<213> Artificial Synthesis
<400> 3
catgccatgg atgctgaccg agttggttg 29
<210> 4
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 4
ctacccggac accgggtcaa gcttgg 26
Claims (4)
1. A method for purifying an immobilized alpha-amino acid lipid acyltransferase in one step, comprising the steps of:
(1) fusing an alpha-amino acid ester acyltransferase gene with an aldehyde-based tag gene; adding a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:1 before a start codon or before a stop codon of the alpha-amino acid ester acyltransferase gene;
(2) respectively connecting the fused gene in the step (1) and the formylglycine synthetase gene to a prokaryotic expression vector;
(3) transferring the constructed vector into escherichia coli, and performing synchronous induced expression on the two enzymes; the method for synchronously inducing expression comprises the following steps: escherichia coli transformed with the construction vector is cultured in the presence of ampicillinCultured in liquid LB medium containing biotin and kanamycin to OD600When the ratio is 0.6-0.8, adding IPTG (isopropyl-beta-D-thiogalactoside) to induce the two enzymes;
(4) centrifugally collecting induced thalli, centrifugally collecting supernate after crushing, mixing with an amino carrier and immobilizing;
the alpha-amino acid ester acyltransferase gene is derived from Sphingobacterium, and the formylglycine synthetase gene is derived from Streptococcus pneumoniae.
2. The process for purifying an immobilized alpha-amino acid lipid acyltransferase according to claim 1, wherein the immobilized alpha-amino acid lipid acyltransferase comprises: the fused gene in the step (1) is connected to a pET30a vector to obtain a SEAT-30a vector, and the formylglycine synthetase gene is firstly connected to a Topo vector by using a Gateway system and then is recombined to a PDEST17 vector to obtain an FGE-PDEST17 vector.
3. The process for purifying an immobilized alpha-amino acid lipid acyltransferase according to claim 1, wherein the immobilized alpha-amino acid lipid acyltransferase comprises: the concentration of IPTG is 0.5-1 mM, and the induction is carried out for 2-12 h at the temperature of 25-30 ℃.
4. The process for purifying an immobilized alpha-amino acid lipid acyltransferase according to claim 1, wherein the immobilized alpha-amino acid lipid acyltransferase comprises: in the step (4), the mass ratio of the supernatant to the amino carrier is 1: 0.5-20, the reaction temperature is 8-30 ℃, the pH value is 6.5-8.0, and the reaction time is 2-24 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810672940.3A CN108728424B (en) | 2018-06-26 | 2018-06-26 | Method for purifying immobilized alpha-amino acid lipid acyltransferase by one step |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810672940.3A CN108728424B (en) | 2018-06-26 | 2018-06-26 | Method for purifying immobilized alpha-amino acid lipid acyltransferase by one step |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108728424A CN108728424A (en) | 2018-11-02 |
| CN108728424B true CN108728424B (en) | 2021-09-14 |
Family
ID=63930957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810672940.3A Active CN108728424B (en) | 2018-06-26 | 2018-06-26 | Method for purifying immobilized alpha-amino acid lipid acyltransferase by one step |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728424B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980823B (en) * | 2021-03-09 | 2023-01-24 | 河北善泉生物科技有限公司 | Immobilized aspartase suitable for industrialization and method for producing L-aspartic acid by using immobilized aspartase |
| CN115786379A (en) * | 2023-01-06 | 2023-03-14 | 成都雅途生物技术有限公司 | Immobilized enzyme, preparation method and method for converting FR901379 by immobilized enzyme |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104356238A (en) * | 2014-10-15 | 2015-02-18 | 大连理工大学 | Fixed-point immobilization method for recombinant protein A affinity ligands |
| CN106480009A (en) * | 2016-12-25 | 2017-03-08 | 河北周酶生物科技有限公司 | A kind of immobilized alpha-amino-acid ester acyltransferase and the application in preparing glutamine dipeptide |
| CN107603936A (en) * | 2017-09-21 | 2018-01-19 | 合肥工业大学 | The recombination engineering and its construction method and purposes of a kind of express alpha amino-acid ester acyltransferase |
-
2018
- 2018-06-26 CN CN201810672940.3A patent/CN108728424B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104356238A (en) * | 2014-10-15 | 2015-02-18 | 大连理工大学 | Fixed-point immobilization method for recombinant protein A affinity ligands |
| CN106480009A (en) * | 2016-12-25 | 2017-03-08 | 河北周酶生物科技有限公司 | A kind of immobilized alpha-amino-acid ester acyltransferase and the application in preparing glutamine dipeptide |
| CN107603936A (en) * | 2017-09-21 | 2018-01-19 | 合肥工业大学 | The recombination engineering and its construction method and purposes of a kind of express alpha amino-acid ester acyltransferase |
Non-Patent Citations (2)
| Title |
|---|
| Site-specific chemical protein conjugation using genetically encoded aldehyde tags;David Rabuka等;《Nat Protoc》;20120531;第7卷(第6期);第1052-1067页 * |
| 特异性定点共价固定化及酰基肽释放酶ST0779的非特异性催化的研究;李蓉;《中国博士学位论文全文数据库 基础科学辑》;20150815(第8期);第A006-25页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108728424A (en) | 2018-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101318422B1 (en) | D-psicose epimerase and method for producing psicose using the same | |
| CN108728424B (en) | Method for purifying immobilized alpha-amino acid lipid acyltransferase by one step | |
| WO2018121458A1 (en) | Gene which encodes alanyl-glutamine dipeptide biosynthetic enzyme and application thereof | |
| CN105624128B (en) | Immobilized monoamine oxidase and application thereof in synthesis of chiral azabicyclo compound | |
| CN108752479B (en) | Recombinant beta-glucosidase, expression and purification method thereof and immobilization application thereof | |
| CN107488639B (en) | Toluene monooxygenase and application thereof in chiral sulfoxide biocatalysis synthesis | |
| CN105950605B (en) | Directional covalent fixation method of biotin ligase on magnetic microsphere surface | |
| CN109988778B (en) | Sucrose phosphorylase gene and application thereof | |
| CN103627691B (en) | A kind of immobilization glutathione synthetase and its preparation and application | |
| Pei et al. | Catalytically active inclusion bodies (CatIBs) induced by terminally attached self-assembling coiled-coil domains: To enhance the stability of (R)-hydroxynitrile lyase | |
| CN104946705B (en) | A kind of method of continuous production c-di-AMP | |
| CN107400667B (en) | Immobilization method of cell containing recombinant high-temperature-resistant glucose isomerase | |
| CN109337887B (en) | Nucyep coding gene, recombinant expression vector, recombinant engineering bacterium, and preparation method and application thereof | |
| CN113754726B (en) | Recombinant enzyme containing polypeptide tag and application thereof in synthesis of medicinal chemicals | |
| CN112831492B (en) | Immobilized fusion enzyme and preparation method and application thereof | |
| JP6353438B2 (en) | Method for immobilizing and desorbing microorganisms | |
| CN114686507A (en) | Construction method and application of nitrile hydratase recombinant protein | |
| CN113930376A (en) | Engineering bacterium for catalytic production of D-p-hydroxyphenylglycine, high-density culture method and catalytic production method | |
| CN112481320A (en) | Method for preparing (-) gamma-lactam with high catalytic efficiency | |
| RU2653750C1 (en) | Method for obtaining heterotetrameric recombinant streptavidin from periplasm of escherichia coli | |
| JP6610868B2 (en) | Method for attaching and detaching microorganisms | |
| CN112980823B (en) | Immobilized aspartase suitable for industrialization and method for producing L-aspartic acid by using immobilized aspartase | |
| CN106119233B (en) | Cephalosporin acylase mutant and its encoding gene and application | |
| CN110923223A (en) | Novel nitrilase and application thereof | |
| CN114958894B (en) | Construction method and application of spermidine synthetic multienzyme complex based on CcmK2 fibrous protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230519 Address after: 050035 6-501, Tianshan science and Technology Park, 319 Xiangjiang Road, high tech Zone, Shijiazhuang City, Hebei Province Patentee after: HEBEI FEINISI BIOTECHNOLOGY Co.,Ltd. Address before: 050035 6-501, Tianshan science and Technology Industrial Park, No. 319 Xiangjiang Road, high tech Zone, Shijiazhuang City, Hebei Province Patentee before: HEBEI SHANQUAN BIOLOGICAL TECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right |