CN108715904A - A method of panax japonicus is identified based on ITS2 and its non-belongs to mixed adulterant - Google Patents
A method of panax japonicus is identified based on ITS2 and its non-belongs to mixed adulterant Download PDFInfo
- Publication number
- CN108715904A CN108715904A CN201810560240.5A CN201810560240A CN108715904A CN 108715904 A CN108715904 A CN 108715904A CN 201810560240 A CN201810560240 A CN 201810560240A CN 108715904 A CN108715904 A CN 108715904A
- Authority
- CN
- China
- Prior art keywords
- its2
- panax japonicus
- mixed adulterant
- panax
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is a kind of to identify that panax japonicus and its non-method for belonging to mixed adulterant the invention discloses a kind of DNA level identification panax japonicus and its non-method for belonging to mixed adulterant, include the following steps based on ITS2：1) extraction sample to be tested panax japonicus DNA；2) using sample to be tested DNA as template, the segment of PCR amplification ITS2 sequences；3) PCR product forward direction is sequenced, panax japonicus ITS2 sequences is obtained by ITS2 database shearings；4) structure NJ phylogenetic trees, in kind and the analysis of inter-species average genetic, second structure characteristic are compared.The result shows that the ITS2 Sequence clusterings of panax japonicus are together, in panax japonicus kind average genetic significantly less than panax japonicus with its it is non-belong to mixed adulterant inter-species average genetic and panax japonicus secondary structure with it is non-to belong to mixed adulterant secondary structure difference big, illustrate ITS2 sequences as quick and precisely identifying panax japonicus and its non-belong to mixed adulterant.The method of the present invention is easy to operate, high resolution, and applicability and repeatability are strong, and can realize can quick and precisely identify panax japonicus and its non-belong to mixed adulterant.
Description
Technical field
The present invention relates to a kind of based on ITS2 sequence Rapid identification panax japonicuses and its non-method for belonging to mixed adulterant.
Background technology
Panax japonicus be araliaceae ginseng plant panax japonicus (Panax japonicusC. A. Mey.) dry root
Stem, alias north Radix Notoginseng, Rhizoma Panacis japonici etc. belong to China's Precious, Rare, Endangered Chinese herbal medicine, are referred to as " king of herbal medicine ".Panax japonicus is warm-natured,
Sweet in flavor, slight bitter, Return liver, spleen, lung channel have both northern medicine ginseng Xu-tonic, southern medicine pseudo-ginseng blood-circulation-invigovating stagnation resolvation and other effects, cure mainly empty after being ill
The illnesss such as weak, injury from falling down.Modern pharmacology research shows that the chemical substances such as saponins, volatile oil, carbohydrate, amino acid are bamboos
The medicinal ingredient of ginseng is saved, wherein saponin component passes through mitogen-activated protein kinase (mitogen-activated protein
Kinase, MAPK) and the anti-inflammatory work of nuclear factor kappa B (nuclear factor-kappa B, NF-kB) signal path performance
With, in addition saponin component reduce myocardial ischemia-reperfusion injury effect, by Fas/FasL approach alleviate skin it is excessive
Skin symptom caused by apoptotic cell death simultaneously shows significant neurite outgrowth enhancing in human neuroblastoma cells
Activity.Moreover, panax japonicus crude extract and polysaccharide are proved to the ability with apparent supplemental blood, cyclophosphamide can be prevented
Caused hematopoiesis function declines, and inhibits tumour growth；Obvious panax japonicus saponin, polysaccharide component or crude extract are to tumour, slow
Property syndrome, four big system of human body (digestion, nervous centralis, angiocarpy, immune) etc. have apparent pharmacological action.Due to ring
Join the extensive use in fields such as tcm clinical practice treatment, health products, cosmetics, people are growing day by day to the demand of panax japonicus.
However, often thering is Dysosma versipellis, Radix Caulophylli, Root of Tall Monkshood, aizoon stonecrop etc. are non-to belong to mixed adulterant and pretend to be or be mistakened as certified products ring in the market
Ginseng is used or is sold, and the name that they have is close, is easy to obscure in civil use, shape and panax japonicus phase after some processing
Seemingly, but medicinal material inherent quality and ingredient are greatly different, and wherein Dysosma versipellis was once reported is entrained in bamboo because being similar to panax japonicus
Make medicinal in section ginseng, because Dysosma versipellis contains toxic podophyllotoxin, after misapplying Dysosma versipellis digestion, nerve and painstaking effort easily occur for patient
Guard system is poisoned, or even dead.The adulterant of Market of Chinese Materia Medica homonym or alternative grade are more, and mixed adulterant has upset Chinese medicine city
Order, the larger impact medication curative effect and safety of panax japonicus.To ensure Chinese medicine quality, it is ensured that clinical application has safely
Effect is badly in need of seeking a kind of precisely reliable, efficient stable method and is applied to differentiate distinguishing panax japonicus and its non-belonging to mixed adulterant.
Currently, traditional Materia Medica Identification mainly identifies medicine by differentiating color, form, smell, slice of medicinal material etc.
The true and false and purity of material, the common Ji Yuan having based on morphological characters feature, character, the identification of micro- and physics and chemistry etc..Zhu Yonghong etc. was once
Differentiate panax japonicus and mixed adulterant Root of Tall Monkshood, Phnom Penh seven, Radix Caulophylli etc. by character, Zhu Yinghui etc. is once from character and microscopic features angle
Degree, which differentiates, distinguishes panax japonicus and adulterant Dysosma versipellis, and Xia Li etc. also once combines character and microscopical characters panax japonicus and aizoon stonecrop；Four
Great tradition Chinese traditional medicine identification method (Ji Yuan, character, the identification of micro- and physics and chemistry) solves many Chinese herbal medicines after precipitation accumulation for many years
The problem of first line mass is checked on, but require identifier that must have abundant and sturdy classification gain knowledge and identification of experience, by
It is influenced in being grown and being picked environment by appraiser experience, medicinal material, qualification result usually lacks accuracy and repeatability.
Infiltration and application with molecular genetic marker technique in STUDIES ON PHARMACEUTICAL BOTANY field, more and more plant medicinal materials start
Attempt the genetic analysis identification of molecular level, DNA bar codes refer to using in genome one section of recognised standard, it is relatively short
DNA segments marked as species and a kind of new biomolecule identification method for establishing, Canadian systematist Paul
Hebert was put forward for the first time in 2003.This method determines general bar code by screening, and establishes bar code data library and identification
Platform by bioinformatic analysis method analyses and comparison DNA data, and is identified species.DNA bar codes are identified
Quick and precisely, it is expected to realize automatic identification, effective supplement of traditional biological identification method, and receives the extensive of domestic and foreign scholars
Concern, has become species identification and the research hotspot of classification at present.Compared with other method for identifying molecules, the identification of DNA bar codes
With three advantages:Qualification result repeatability is good;Method is versatile;Unified database and identification platform can be built,
Easy to spread and standardization.At present, DNA bar code technology has obtained the approval of most of experts and scholars, in species identification
It has obtained effectively applying extensively, it can quickly and accurately differential plant type;The technology obtains in Materia Medica Identification
It is widely applied and fast-developing, prominent achievement is achieved in medicinal plant and plant source Med Mat Appreciation etc., accelerate
Chinese traditional medicine identification standardized process.
Different DNA bar codes have respective merits and demerits, such as mat K are difficult to be expanded and are sequenced, and primer is general
Property it is poor, different plant groups usually require use different primers；Although rbcL sequences have general, easy amplification, easily compare
Advantage, but the variability on species level is not notable；PsbA-trnH is easier design universal primer, and has
The high feature of high universalizable, amplification success rate, but the segment length of spacer region or variability of copy between different plant species
It is larger, it is more difficult that sequence alignment is carried out between large-scale sample there are excessive insertion/deletion phenomenon, cause discriminating to belong to
Plant species it is more difficult；ITS has preferable stability and accuracy, but in the identification to some species, ITS is simultaneously
Effective qualification result cannot be obtained.Chen Shilin etc. by 7 kinds of DNA bar code segments (psbA-trnH, matK, rbcL,
RpoC1, ycf5, ITS2, and ITS) it is applied to differentiate from 753 categories, 4800 kinds of more than 6600 parts plant samples, compare
As a result, it has been found that identification high resolutions of the ITS2 in plant identification be up to 92.7%, and propose that ITS2 can be used as plant identification monoid
Identify bar code.Luo Kun etc. by current hot spot candidate sequence (matK, rbcL, psbA-trnH, rpoC1, ycf5) and
NrDNA-ITS sequences belong to 192 kinds of 300 samples with Rutaceae 72 and are compared, and attempt have more sibling species in same section's accessory
Under conditions of, really judge the identification capacity of each sequence, the result shows that, the PCR amplification and sequencing success rate of ITS2 is higher,
With the variation of maximum inter-species and smaller intraspecific variablity, and there are pole significant difference, each evaluation indexes for inter-species variation in kind
It is superior to other candidate sequences, and species identification success rate highest.More and more researchers utilize a large amount of vegetable material pair
Hot spot candidate's bar code sequence is analyzed and researched, and proposes ITS2 most suitable as DNA bar code.
ITS2 (internal transcribed spacer 2) gene order is removal 5.8S rRNA sequences and 28S
The ribosomal dna sequence spacer region of rRNA sequences has good versatility, and segment is short enough and easily expands, is sequenced.
The variant sites of ITS2 sequences can ensure its identification capacity, the success rate of species identification be maintained, so as to identifying species
Various, substantial amounts Chinese medicine base plants.Identification energy of the ITS2 sequences in multiple sections belong to base plant and plant medicinal material
Power is largely verified, can identifying species are various, substantial amounts medicinal plants and its closely related species, and
And the variant sites of ITS2 also ensure its identification capacity enough, it is maintained to identify the success rate of species.Therefore, the present invention utilizes
ITS2 sequence pairs panax japonicus and its it is non-belong to mixed adulterant and carry out DNA molecular identification, be the quick and precisely identification and medication of panax japonicus
Safety provides scientific basis.
Invention content
The purpose of the present invention：In order to overcome traditional character of panax japonicus, the limitation of tissue the methods of microscopical characters and multiple
The technical deficiency of polygamy provides an ITS2 segment using rDNA and differentiates panax japonicus and its non-side for belonging to mixed adulterant
Method.
The present invention specifically includes following steps, as follows.
（1）Extract panax japonicus sample DNA to be measured（Plant tissue DNA rapid extraction RNA isolation kit Tiangeng DP305）.
（2）PCR amplification contains the ITS2 sequences of rDNA.
（3）Electrophoresed agarose gel sugar detected through gel electrophoresis.
（4）It transfers to Huada gene company to carry out positive sequencing PCR products, is obtained by ITS2 database shearings
Panax japonicus ITS2 sequences.
（5）By GenBank (https://www.ncbi.nlm.nih.gov/genbank/) download panax japonicus and its non-
Belong to the ITS2 sequence sets of mixed adulterant.
（6）In structure NJ trees, kind and the analysis of inter-species average genetic, second structure characteristic are compared.
（7）Identification judges：If the ITS2 Sequence clusterings of panax japonicus are together, average genetic is notable in panax japonicus kind
Less than panax japonicus and its non-mixed adulterant inter-species average genetic and panax japonicus secondary structure of belonging to mixed adulterant two level is belonged to non-
Architectural difference is big, illustrates that ITS2 sequences can be used as and quick and precisely identifies panax japonicus and its non-method for belonging to mixed adulterant.
The step（2）Middle primer sequence uses ITS2F：5 '-ATGCGATACTTGGTGTGAAT-3 ' and ITS3R: 5′-
GACGCTTCTCCAGACTACAAT-3′。
The step（2）Middle pcr amplification reaction uses 50 μ L systems：Including 4 μ L of template DNA, forward primer and reversed
25 19.6 μ L of μ L, ddH2O of each 0.7 μ L, PrimeSTAR HS Premix of primer.PCR amplification program is 94 DEG C of pre-degenerations 2
Min, 1 cycle；98 DEG C of 10 s of denaturation, 55 DEG C of 10 s of annealing, 72 DEG C of 30 s of extension, 40 recycle；72 DEG C of last extensions 5
Min carries out 1 cycle, 4 DEG C of preservation amplified productions.
Advantages of the present invention and its effect are as follows.
（1）Compared with the methods of traditional Morphological Identification, physics and chemistry identification, inventive result is accurate, reproducible, identification is simple
Single easy, professional technique requires low and strong applicability, the ITS2 sequences of acquisition help to realize panax japonicus medicinal material and its Dysosma versipellis,
The non-Rapid identification for belonging to mixed adulterant such as Radix Caulophylli, Root of Tall Monkshood, aizoon stonecrop.
（2）The present invention is by NJ trees, kind and the analysis of inter-species average genetic, second structure characteristic compares multi-angle and test
Card ITS2 sequences can Rapid identification panax japonicus and its it is non-belong to mixed adulterant, avoid identification of indicator unicity.
Specific embodiment
Embodiment one
1.DNA is extracted（Plant tissue DNA rapid extraction RNA isolation kit Tiangeng DP305）, as follows.
（1）About 30 mg of dry weight tissue is added liquid nitrogen and fully mills.
（2）Ground powder is quickly transferred in the centrifuge tube for being pre-loaded with 700 μ l, 65 DEG C of preheating buffer solution GP1
（Experiment before mercaptoethanol is added in the GP1 of preheating, make its final concentration of 0.1%）, rapidly after reverse mixing, centrifuge tube is put
Reverse centrifuge tube is to mix sample for several times during 65 DEG C of 20 min of water-bath, water-bath.
（3）700 μ l chloroforms are added, mix well, 12,000 rpm (~ 13,400 × g) centrifuge 5 min.Note：If carrying
The plant tissue rich in polyphenol or starch is taken, phenol can be used before the 3rd step：Chloroform/1:1 is extracted in equal volume.
（4）Carefully upper strata aqueous phase obtained by previous step is transferred in a new centrifuge tube, 700 μ l buffer solution GP2 are added,
It mixes well.
（5）The liquid of mixing is transferred in adsorption column CB3,12,000 rpm (~ 13,400 × g) centrifuge 30 sec, abandon
Fall waste liquid.It is 700 μ l or so to adsorb column volume, and centrifugation is added in graded.
（6）500 μ l buffer solutions GD are added into adsorption column CB3（It is please first checked whether before use and absolute ethyl alcohol has been added）,
12,000 rpm (~ 13,400 × g) centrifuge 30 sec, outwell waste liquid, adsorption column CB3 is put into collecting pipe.
（7）600 μ l rinsing liquids PW are added into adsorption column CB3（It is please first checked whether before use and anhydrous second has been added
Alcohol）, 12,000 rpm (~ 13,400 × g) centrifuge 30 sec, outwell waste liquid, adsorption column CB3 be put into collecting pipe.
（8）Repetitive operation step 7.
（9）Adsorption column CB3 is put back in collecting pipe, 12,000 rpm (~ 13,400 × g) centrifuge 2 min, outwell waste liquid.
Adsorption column CB3 is placed in and is placed at room temperature for several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.Pay attention to：This step
Purpose is to remove rinsing liquid remaining in adsorption column, and the residual of ethyl alcohol can influence subsequent enzyme reaction in rinsing liquid（Digestion,
PCR etc.）Experiment.
（10）Adsorption column CB3 is transferred in a clean centrifuge tube, 50- is vacantly added dropwise to the intermediate position of adsorbed film
200 μ l elution buffer TE, are placed at room temperature for 2-5 min, and 12,000 rpm (~ 13,400 × g) centrifuge 2 min, solution is received
Collect in centrifuge tube.
（11）DNA concentration and purity obtained by 2000 micro spectrophotometer Detection and Extraction of DanoDrop.As a result such as table 1.
Table 1：DNA extracts testing result
| Sample serial number | Sample ID | DNA concentration（ng/μg） | A260（Abs） | A280（Abs） | 260/280 | 260/230 |
| TE | — | -0.1 | -0.001 | -0.007 | 0.21 | -0.01 |
| 1 | Panax japonicus No. 1 | 4.7 | 0.095 | 0.068 | 1.39 | -0.62 |
| 2 | Panax japonicus No. 2 | 7.0 | 0.140 | 0,088 | 1.59 | -0.70 |
2.PCR is expanded, as follows.
This experiment is expanded using 4 parts of samples of plant gene ITS2 primer sequences pair, and primer refers to pertinent literature, with
Lower table is primer combination table（Table 2）, amplification reaction system（Table 3）And amplified reaction program（Table 4）.
Table 2：Primer sequence
| Primer titles | Base sequence (5'to3') | Base number | Mrna length | It anneals (oC) |
| S2F | ATGCGATACTTGGTGTGAAT | 20 | ITS2：500bp | 54-56 |
| S3R | GACGCTTCTCCAGACTACAAT | 21 | ---- | -- |
Table 3：Amplification reaction system
| System ingredient | Addition（μL） |
| Forward Primer(20μM） | 0.7 |
| Reverse Primer(20μM） | 0.7 |
| DNA Template | 4 |
| ddH2O | 19.6 |
| PrimeSTAR®HS Premix | 25 |
| Total volume | 50 |
Table 4：Amplified reaction program
| Step | Temperature (ºC) | Time(s) | Cycles |
| Pre-degeneration | 94 | 120 | 1 |
| Denaturation | 98 | 10 | |
| Annealing | 55 | 10 | 40 |
| Extend | 72 | 30 | |
| Finally extend | 72 | 300 | 1 |
| It preserves | 4 | Forever | -- |
3. electrophoresed agarose gel sugar detected through gel electrophoresis, as follows.
（1）The preparation of 1*TAE buffer solutions：20 mL 50*TAE buffer are measured with graduated cylinder, are settled to ultra-pure water
1000 mL to obtain the final product.
（2）PCR amplimers carry out electrophoresis with 1% Ago-Gel.0.2 g agaroses are weighed with electronic balance
It is put into special triangular flask, the 1*TAE buffer solutions that 20 mL are measured with graduated cylinder pour into triangular flask, add in micro-wave oven
Heat（10s is primary, probably three times）, until directly only clarifying pico- boiling no longer muddiness, another special glue is poured into after being cooled to 60 DEG C
Triangular flask is added 1.5 μ L sybrsafe coloring agents (Thermo) and is put into duplicate rows comb in gel maker fully after dissolving,
Gel maker is poured into rapidly before agarose colloid solidification, drives bubble away, stands 30 ~ 60 min point sample electricity after colloid completely solidification
Swimming.After 5 μ L of applied sample amount PCR products and 6*Loading buffer dyeing mixings, Marker:D2000 loadings 3
μ L inject in 1% Ago-Gel, and electrophoresis is carried out with 100V, 200mA, 23min.
4. transferring to Huada gene company to carry out positive Sequence Detection PCR products, 2 length are obtained after sequencing is respectively
The non-coding sequence of 468bp and 464bp finally passes through ITS2 database shearings and obtains 2 panax japonicus ITS2 sequences, submits
GenBank databases simultaneously obtain No. GenBank (MH370860, MH381784).
5. passing through GenBank (https://www.ncbi.nlm.nih.gov/genbank/) download panax japonicus and its non-
It belongs to the ITS2 sequence sets of mixed adulterant, panax japonicus and its non-belong to mixed adulterant ITS2 sequence source-informations and be shown in Table 5.
5 panax japonicus of table and its non-belong to mixed adulterant ITS2 sequences source-information table
| Species latin name | Chinese name | Species section Belong to | No. Genbank (collecting location) |
| Panax japonicus C.A. Mey. | Panax japonicus | Araliaceae Panax | MH370860 (Guangdong), MH381784 (Guangdong), KJ559422.1 (Guizhou), KJ559421.1 (Shanxi), KJ559420.1 (Yunnan), KJ559419.1 (Sichuan), KJ559418.1 (Guizhou), KX674925.1 (Japan), KX674924.1 (Japan) |
| Aconitum sinomontanum Nakai | Root of Tall Monkshood | Ranunculaceae Aconitum | KY417332.1 (Sichuan), KY417331.1 (Hubei), KY417330.1 (Hubei), AY150232.1 |
| Caulophyllum robustum Maxim. | Radix Caulophylli | Berberidaceae Radix Caulophylli Belong to | JX040540.1, EU592026.1 (Anhui), L77157.1 (South Korea) |
| Diphylleia sinensis H.L.Li | Phnom Penh seven | Berberidaceae Unmrellaleaf Belong to | KY746321.1, KY746322.1, KY746323.1, KY746324.1, KY746325.1, KY746326.1 |
| Dysosma versipellis (Hance) M.Cheng ex T.S.Ying | Dysosma versipellis | Berberidaceae Podophyllum emodi var chinense category | EU592023.1 (Anhui), KT290659.1, KY701310.1, KY701315.1 |
| Dysosma delavayi (Franch.) Hu | River is octagonal Lotus | Berberidaceae Podophyllum emodi var chinense category | KM980521.1, KM980520.1, |
| Dysosma difformis (Hemsl. & E.H.Wilson) T.H.Wang | Small illiciumverum Lotus | Berberidaceae Podophyllum emodi var chinense category | KT290665.1, KT290664.1 |
| Dysosma majoensis (Gagnep.) M.Hiroe | Guizhou eight Angle lotus | Berberidaceae Podophyllum emodi var chinense category | KT290667.1, KT290666.1 |
| Dysosma pleiantha (Hance) Woodson | Dysosma Pleiantha | Berberidaceae Podophyllum emodi var chinense category | KT290663.1, KT290662.1, KT290661.1, KT290660.1, KM980518.1 |
| Dysosma tsayuensis T.S.Ying | Tibet eight Angle lotus | Berberidaceae Podophyllum emodi var chinense category | MF785662.1 (Chinese Lu Lang) |
| Phedimus aizoon (L.) 't Hart | Red-spotted stonecrop three Seven | Crassulaceae Sedum | MG236504.1 (Canada), MG236951.1 (Canada), EU592008.1 (Jiangsu Province, China), KX896732.1 (China), |
6. in structure NJ trees, kind and the analysis of inter-species average genetic, second structure characteristic are compared.
First, Multiple sequence alignments are carried out using ClustalW methods, using 6.06 software building NJ systematic growths of MEGA
Tree（Neighbor-Joining tree）, 1000 replicate analysis are carried out using Bootstrap methods, examine each systematic growth branch
Supporting rate, analyze each species branch whether have monosystem.Based on two-parameter model Kimura two-parameter
(K2P) kind of interior and inter-species minimum, a maximum and average genetic distance are calculated.By ITS2 database (http:// its2.bioapps.biozentrum.uni-wuerzburg.de) predict panax japonicus and its mixed adulterant ITS2 secondary structures.
7. identification judges：See Fig. 1, the panax japonicus from different regions is polymerized to same independent clade, and supporting rate 100% is single
It is that property is strong, can effectively distinguishes over mixed adulterant, Crassulaceae Sedum aizoon stonecrop, Ranunculaceae Aconitum Root of Tall Monkshood and Berberidaceae ghost
Mortar category Dysosma versipellis, Diphylleia Phnom Penh seven, each self-forming independence clade of Radix Caulophylli category Radix Caulophylli, show good monosystem
Property.See Fig. 2, in panax japonicus kind average genetic (0.018) be significantly less than its with it is non-belong to the average heredity of mixed adulterant inter-species away from
From interspecific difference is significantly greater than intraspecies variation.See Fig. 3, panax japonicus and its non-ITS2 secondary structures for belonging to mixed adulterant are with one
Centered on a big multi-branched ring (center ring), surrounding, which extends, 4 arms, is labeled as I, II, III, IV arm in the direction of the clock,
The unpaired base in side protrudes to form bulge loop on arm, and each unpaired base in arm top forms hairpin loop, and each arm stem ring number is poor
Different, unpaired base forms outer shroud between arm and arm；Such as Fig. 3, the panax japonicus ITS2 constructional appearances extremely phase from different regions
Seemingly, in panax japonicus kind ITS2 structures have it is well-conserved, each arm stem ring distribution, outer shroud, hairpin loop and central rings are completely the same；
Compared with panax japonicus, it is non-it is equal belong to mix adulterant secondary structure face shaping, outer shroud, each arm stem ring number, stem ring distribution and ring
Irregular different apparent (Fig. 3).Such as outer shroud is larger between Radix Caulophylli and I arm of aizoon stonecrop and II arm and difference is most apparent, red-spotted stonecrop three
Seven contain 2 outer shrouds, and Root of Tall Monkshood, small Dysosma versipellis and III arm of Dysosma Pleiantha all have apparent bulge loop, Phnom Penh seven, Tibet Dysosma versipellis, river eight
Outer shroud is not present for Jiao Lian, small Dysosma versipellis, Guizhou Dysosma versipellis and Dysosma Pleiantha and I arm is considerably longer than panax japonicus.
It can be seen that passing through the calculating of ITS2 sequence genetic distances, the structure of phylogenetic tree and ITS2 secondary structures
The various aspects such as resolution be mutually authenticated discriminating, ITS2 sequences can quick and precisely and efficiently differentiate panax japonicus and its it is non-belong to it is mixed
Adulterant.
Description of the drawings：
（1）Fig. 1 is panax japonicus and its non-belongs to mixed adulterant NJ tree graphs；
Fig. 2 is panax japonicus and its non-belongs to mixed adulterant average genetic；
Fig. 3 panax japonicuses and its non-belong to mixed adulterant secondary structure；
（2）Sequence table
<110>Guangdong medical university
<120>Panax japonicus and its non-method for belonging to mixed adulterant are identified in DNA level
<210> X1
<211> 230
<212> DNA
<213>Panax japonicus (Panax japonicus C.A. Mey.)
<308> MH370860
<400> X1
cgcatcgcgt cgccccccaa cccatcactc ccttgcggga gtcgaggcgg aggggcggat 60
aatggcctcc cgtgtctcac cgcgcggttg gcccaaatgc gagtccttgg cgatggacgt 120
cacgacaagt ggtggttgta aaaggccctc ttctcatgtc gtgcggtgac ctgtcgccgg 180
caaaagctct catgaccctg ttgcgccgtc ctcgacgcgc gctccgaccg 230
<210> X2
<211> 230
<212> DNA
<213>Panax japonicus (Panax japonicus C.A. Mey.)
<308> MH381784
<400> X2
cgcatcgcgt cgccccccaa cccatcactc ccttgcggga gtcgaggcgg aggggcggat 60
aatggcctcc cgtgtctcac cgcgcggttg gcccaaatgc gagtccttgg cgatggacgt 120
cacgacaagt ggtggttgta aaaggccctc ttctcatgtc gtgcggtgac ctgtcgccgg 180
caaaagctct catgaccctg ttgcgccgtc ctcgacgcgc gctccgaccg 230
Claims (2)
1. a kind of based on ITS2 sequence Rapid identification panax japonicuses and its non-method for belonging to mixed adulterant, it is characterised in that this method packet
Include following steps：
（1）Panax japonicus sample DNA to be measured is extracted, PCR amplification contains the ITS2 sequences of rDNA, and PCR product forward directions are surveyed
Sequence obtains panax japonicus ITS2 sequences by ITS2 database shearings；
（2）Multiple sequence alignments are carried out using ClustalW methods, using 6.06 software building NJ phylogenetic trees of MEGA
（Neighbor-Joining tree）, 1000 replicate analysis are carried out using Bootstrap methods, examine each systematic growth branch
Supporting rate, analyzes whether each species branch has monosystem；
（3）It is based on two-parameter model Kimura two-parameter (K2P) using 6.06 softwares of MEGA and calculates kind of an interior and kind
Between minimum, maximum and average genetic distance；
（4）Pass through ITS2 database (http://its2.bioapps.biozentrum.uni-wuerzburg.de) it is pre-
Survey panax japonicus and its mixed adulterant ITS2 secondary structures；
（5）If together, average genetic is significantly less than bamboo in panax japonicus kind for the ITS2 Sequence clusterings of panax japonicus in NJ trees
Section participates in its non-inter-species average genetic for belonging to mixed adulterant and panax japonicus secondary structure belongs to mixed adulterant secondary structure with non-
Difference is big, illustrates that ITS2 sequences can quick and precisely identify panax japonicus and its non-belong to mixed adulterant.
2. according to claim 1 a kind of based on ITS2 sequence Rapid identification panax japonicuses and its non-side for belonging to mixed adulterant
Method, it is characterised in that step（1）Described in panax japonicus DNA extraction method be：Take panax japonicus medicinal material sample dry weight tissue about 30
Mg is added liquid nitrogen and fully mills and fully after centrifugation, utilize plant tissue DNA's rapid extraction kit（Tiangeng DP305）Extraction
Total DNA；PCR amplification uses ITS2 universal primers S2F：5 '-ATGCGATACTTGGTGTGAAT-3 ' and S3R: 5′-
GACGCTTCTCCAGACTACAAT-3′；Amplified reaction uses 50 μ L systems, including 4 μ L of template DNA, forward primer and reversed
Each 0.7 μ L, PrimeSTAR HS Premix, 25 μ L of primer（Purchased from TAKARA companies）, 19.6 μ L of ddH2O；PCR amplification journey
Sequence is 94 DEG C of 2 min of pre-degeneration, 1 cycle；98 DEG C of 10 s of denaturation, 55 DEG C of 10 s of annealing, 72 DEG C of 30 s of extension, 40 are followed
Ring；72 DEG C of 5 min of last extension carry out 1 cycle, 4 DEG C of preservation amplified productions；1% agarose gel electrophoresis of PCR products
Testing result, and positive sequencing is carried out, finally pass through ITS2 database shearings and obtains panax japonicus ITS2 sequences.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810560240.5A CN108715904A (en) | 2018-06-03 | 2018-06-03 | A method of panax japonicus is identified based on ITS2 and its non-belongs to mixed adulterant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810560240.5A CN108715904A (en) | 2018-06-03 | 2018-06-03 | A method of panax japonicus is identified based on ITS2 and its non-belongs to mixed adulterant |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108715904A true CN108715904A (en) | 2018-10-30 |
Family
ID=63912803
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810560240.5A Pending CN108715904A (en) | 2018-06-03 | 2018-06-03 | A method of panax japonicus is identified based on ITS2 and its non-belongs to mixed adulterant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108715904A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438215A (en) * | 2019-06-28 | 2019-11-12 | 西安医学院 | A method of identifying cottonweed kind using ITS2 sequence |
| CN111349711A (en) * | 2019-10-09 | 2020-06-30 | 广东医科大学 | Method for rapidly identifying Kochiae and mixed counterfeit products thereof based on ITS2 sequence |
| CN112877462A (en) * | 2021-03-10 | 2021-06-01 | 宁波城市职业技术学院 | Molecular method for rapidly identifying panax japonicus from different producing areas |
-
2018
- 2018-06-03 CN CN201810560240.5A patent/CN108715904A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438215A (en) * | 2019-06-28 | 2019-11-12 | 西安医学院 | A method of identifying cottonweed kind using ITS2 sequence |
| CN110438215B (en) * | 2019-06-28 | 2023-05-30 | 西安医学院 | Method for identifying affine plant variety by using ITS2 sequence |
| CN111349711A (en) * | 2019-10-09 | 2020-06-30 | 广东医科大学 | Method for rapidly identifying Kochiae and mixed counterfeit products thereof based on ITS2 sequence |
| CN112877462A (en) * | 2021-03-10 | 2021-06-01 | 宁波城市职业技术学院 | Molecular method for rapidly identifying panax japonicus from different producing areas |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103142669B (en) | Enzyme method for extracting ginsenoside and obtained ginsenoside extractive | |
| CN108715904A (en) | A method of panax japonicus is identified based on ITS2 and its non-belongs to mixed adulterant | |
| Gao et al. | Chinese herbal medicine resources: Where we stand | |
| CN105624291A (en) | Method for detecting whether Araliaceae plant components exist in sample and whether sample is adulterate | |
| CN103776926A (en) | Establishment of HPLC (High Performance Liquid Chromatography) fingerprint spectrum of rabdosia lophanthide medicinal materials and fingerprint spectrum of of rabdosia lophanthide medicinal materials | |
| CN104004818A (en) | Method for identifying Chinese angelica and its adulterants by utilizing ITS sequence | |
| Guo et al. | Investigating the authenticity of Ophiopogonis Radix and its Chinese patent medicines by using a nucleotide signature | |
| CN113267578B (en) | Quality control method of peony and licorice decoction | |
| CN111349711A (en) | Method for rapidly identifying Kochiae and mixed counterfeit products thereof based on ITS2 sequence | |
| CN102225180A (en) | Traditional Chinese medicine composition having anticancer effect and preparation method thereof | |
| CN112080574B (en) | Development of panax japonicus EST-SSR primer group and application of panax japonicus EST-SSR primer group in aspects of genetic diversity and the like | |
| CN116287149B (en) | Method, primer and probe for identifying panax angustifolius and application of method and primer and probe | |
| Liu et al. | Genetic and phytochemical diversities of Cynomorium songaricum Rupr. in Northwest China indicated by ISSR markers and HPLC-fingerprinting | |
| CN114891131B (en) | Extraction and purification process of vermicelli sedge polysaccharide | |
| Xie et al. | Determination of the species status of Fallopia multiflora, Fallopia multiflora var. angulata and Fallopia multiflora var. ciliinervis based on morphology, molecular phylogeny, and chemical analysis | |
| CN109696513A (en) | A method of identifying ginseng type and its growth year using ginsenoside component content and its ratio | |
| CN114994220A (en) | Construction method of fingerprint of Qiqing toxin-vanquishing granules, determination method of component content of Qiqing toxin-vanquishing granules and application of Qiqing toxin-vanquishing granules | |
| CN115184492A (en) | Establishing method of fingerprint spectrum of Qingjin Yiqi granules and component content measuring method thereof | |
| CN112076151B (en) | A Chinese medicinal oral liquid for treating diabetes due to deficiency of both qi and yin, and its preparation method and quality control method | |
| CN110097976B (en) | Biological component analysis method of traditional Chinese medicine compound preparation | |
| CN103115976A (en) | Method for measuring content of in-blood chemical component-allantoin in medicinal material-psammosilene tunicoides | |
| CN104740566B (en) | A kind of preparation for mitigating scytitis, preparation method and applications | |
| CN107951900B (en) | Traditional Chinese medicine polysaccharide for treating acute liver injury and preparation method thereof | |
| CN106645489A (en) | Method for determining components of common wedgelet fern herb by adopting quantitative analysis multi-components by single marker | |
| CN107468777B (en) | Compound saussurea involucrata capsule and its preparation method and device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181030 |