CN108707671A - A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes - Google Patents
A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes Download PDFInfo
- Publication number
- CN108707671A CN108707671A CN201810600174.XA CN201810600174A CN108707671A CN 108707671 A CN108707671 A CN 108707671A CN 201810600174 A CN201810600174 A CN 201810600174A CN 108707671 A CN108707671 A CN 108707671A
- Authority
- CN
- China
- Prior art keywords
- probe
- sequence
- primer
- egfr
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kind of primer combination of probe objects and kit for blood EGFR C797S abrupt climatic changes.The primer combination of probe object and kit of the present invention includes sense primer, downstream primer, target-probe and retardance sequence；Wherein, the sequence of sense primer such as SEQ ID NO:Shown in 1, the sequence such as SEQ ID NO of downstream primer:Shown in 2, the sequence such as SEQ ID NO of target-probe:Shown in 3, block sequence such as SEQ ID NO:Shown in 4.Detection of the primer combination of probe object and kit of the present invention for EGFR gene C797S mutation, detection speed is fast, high sensitivity, high specificity.
Description
Technical field
The invention belongs to technological field of biochemistry, specifically, are related to a kind of for blood EGFR C797S mutation inspections
The primer combination of probe object and kit of survey.
Background technology
Lung cancer is the highest malignant tumour of morbidity and mortality, wherein non-small cell lung cancer in worldwide
(NSCLC) 80% or so of whole lung cancer is accounted for.Individualized treatment pattern is advocated in the treatment of lung cancer.It is the driving based on patients with lung cancer
Gene expression status is based only upon pathology treatment mode according to patients with lung cancer with the presence or absence of the individualized treatment of driving gene
It can no longer meet the treatment of modern lung cancer.Wherein, EGFR mutation are important cancer driven factor, China patients with lung cancer EGFR
Mutation rate is up to 30% or more.More common in non-smoking, women, adenocarcinoma patients, there are about 50% or so mutation rates.
EGFR is distributed widely in the cells table such as mammalian epithelial cell, fibroblast, spongiocyte, horn cell
Face is the receptor of epidermal growth factor (EGF) cell Proliferation and signal transduction.The protein tyrosine kinases such as EGFR afunction or
The activity or cellular localization of key factor are abnormal in its associated signal paths, with the proliferation of tumour cell, angiogenesis, tumors invading
It attacks, shift and the inhibition of Apoptosis is related.Currently, the targeted therapy for EGFR has obtained larger progress, act on
The tyrosine kinase inhibitor (TKI) of the kinase regions EGFR is clinically widely used to be mutated in non-small cell lung cancer EGFR
In the treatment of patient, and achieve preferable effect.Iressa, Erlotinib, Kai Meina etc. belong to the EGFR-TKI targets of the first generation
To medicine.But the first and second generation targeted drug is although significant in efficacy, but 2/3 patient can be resisted using drug 1-2
Pharmacological property.The T790M mutation of EGFR20 exons are considered as the first generation, the second generation targeting common medicament-resistant mutation of medicine.The target of a new generation
To drug such as AZD9291, Rociletinib (Co-1686) shows sensitive to T790M.But at 10 months or so, patient
Still it will produce drug resistance.Some researches show that C797S is the important drug resistance reason of these third generations EGFR targeted drugs at present
One of.Therefore, great to the Clinical significance of detecting in 20 sites exon C797S EGFR.
Exist in the blood of most of (and not all) advanced NSCLC patients of studies have shown that cycle dissociative DNA (cfDNA,
cell free DNA).CfDNA is mainly derived from apoptosis or the cell of necrosis, including normal cell and tumour cell, if come
It is known as Circulating tumor DNA (ctDNA) from tumour cell.But dissociative DNA in blood segment is usually shorter, late blood of patients with cancer
Concentration is extremely low in liquid, averagely about 17 μ g/L.Therefore, very high to the requirement of detection sensitivity.Have many blood at present
The report of the method for EGFR genetic mutation detection, such as high-resolution melting point curve analytic approach (HRM), Denaturing high performance liquid chromatography
(DHPLC), the sequencing of two generations, digital pcr method etc..Digital pcr has higher sensitive in the detection of blood plasma EGFR genetic mutation
Degree and specificity, but this method detection EGFR genetic mutation site relatively limited (19 Exon deletions, 21 extras reported at present
Aobvious sub- L858R mutation and 20 exon T790M mutation), it is still in and gropes, accumulates experience the stage；Its to operating personnel and
Environment has higher requirement.The depth of detection in Gene Mutation has been expanded with the new technology that two generation sequencing technologies (NGS) are representative
And range, but its clinical Transformation Application needs more data accumulations.Therefore, it is high to be badly in need of a kind of sensitivity at present, high specificity,
The method of easy-to-use EGFR C797S abrupt climatic changes.
Invention content
For overcome the deficiencies in the prior art, the purpose of the present invention is to provide one kind for blood EGFR C797S mutation
The primer combination of probe object and kit of detection.The primer combination of probe object and kit of the present invention is used for EGFR gene C797S
The detection of mutation, detection speed is fast, high sensitivity, high specificity.
Technical scheme of the present invention is specifically described as follows.
The present invention provides a kind of primer combination of probe object for blood EGFR C797S abrupt climatic changes comprising draws upstream
Object, downstream primer, target-probe and retardance sequence；Wherein, the sequence of sense primer such as SEQ ID NO:Shown in 1, downstream primer
Sequence such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of target-probe:Shown in 3, block sequence such as SEQ ID NO:4
It is shown.
The present invention also provides a kind of kits for blood EGFR C797S abrupt climatic changes comprising claim 1 institute
The primer combination of probe object for blood EGFR C797S abrupt climatic changes stated.Preferably, further include PCR reaction solution, PCR is anti-
It includes Taq enzyme, dNTP, PCR buffer solution and MgCl to answer liquid2。
In the present invention, the detailed process of blood EGFR C797S mutation detection methods is as follows：
(1) 20 exon C797S mutation of EGFR gene are directed to, specific primer and probe are designed.
(2) DNA in extraction blood plasma detection sample
(3) reaction system of fluorescent PCR amplification mutant gene sequence is prepared；
(4) gene order for using the primer amplification of step (1) offer to be measured, the probe provided with step (1) and retardance sequence
Row and the products thereof that is expanded, and detect the fluorescence signal of the fluorophor of reaction system, by calculate the size of △ Ct into
Row judges, if CT (the external control) > of sample DNA to be checked;30, it prompts sample DNA concentration too low or degrades serious, it is proposed that replace sample
Or DNA is extracted again；If the CT (external control)≤30 of sample DNA to be checked, its Δ CT (CT (mutation)-CT (external control)) is calculated；If
ΔCT>8 (or CT (mutation) is without displays), are judged as wild type；If Δ CT≤8, are judged as saltant type.
Compared with prior art, the beneficial effects of the present invention are：Present invention joint uses ARMS technologies, establishes blood
Detect the Real-Time PCR quantitation method of 797 codon mutation of EGFR gene.The method of the present invention high sensitivity, detection sensitivity is up to thousand
/ mono-, it is suitable with digital pcr, but it is easy to operate, detection speed is fast；Compared with PCR sequencing PCR, the result of the method for the present invention can
Observation in real time, product do not need detected through gel electrophoresis, and complete stopped pipe operation significantly reduces the risk of PCR product pollution；This
Inventive method detection speed is fast, is suitable for high-throughput pattern detection.
Description of the drawings
Fig. 1 is sensitivity analysis experimental result picture.
Fig. 2 is clinical sample EGFR gene C797S positives PCR figures.
Fig. 3 is clinical sample EGFR gene C797S feminine genders PCR figures.
Specific implementation mode
It describes in detail with reference to the accompanying drawings and examples to technical scheme of the present invention.
Embodiment 1
Detection limit, sensitivity and the specificity experiments of detection primer, probe.
1. preparing negative (wild type) control plasmid and positive (saltant type) control plasmid
1) wild plasmid is built：Whole blood genome is extracted, with corresponding amplimer wild type sense primer, open country in table
Raw type downstream primer (table 1) is expanded, and amplified production is connect with pMD18-T Vector, then connection product is added to 100
Microlitre DH5 α competent cells in, placed 30 minutes in ice, be added 500 microlitres of SOC culture mediums.In 37 degree of incubators, culture
60 minutes, after culture, culture solution is coated on the L- Agar Platings containing X-Gal, IPTG, AMP and is trained overnight
It supports, forms single bacterium colony, selects white colony, carry out sequence verification.Proof has successfully built the plasmid of C797S wild types.
2) mutant plasmids are built：Using wild plasmid as template, drawn with corresponding amplimer saltant type upstream in table
Object, saltant type downstream primer 1, saltant type downstream primer 2 (table 1) are expanded, by amplified production DpnI enzymic digestions 2 hours
Afterwards, glue recycles digestion products, retells recovery product and is added in 100 microlitres of DH5 α competent cells, subsequent processes are same as above.
1 primer sequence of table
| Variation type | Primer sequence (5 ' -3 ') |
| Wild type sense primer | AAGCCACACTGACGTGCCT |
| Wild type downstream primer | ATATTGGCTCCCAGTACCTG |
| Saltant type sense primer | TGTCACTTCACAGCCCTGC |
| Saltant type downstream primer 1 | CTCATGCCCTTCGGCAGCC |
| Saltant type downstream primer 2 | CATGCCCTTCGGCTCCCTCCT |
2. sensitivity experiment
1) 1 times, 10 times, 100 times, 1000 times of dilutions are carried out to mutant plasmid with wild plasmid sample
2) primer probe sequence：
Sense primer:5'-GCTCATGCCCTTCGGGA-3'(SEQ ID NO:1)；
Downstream primer:5'-CTGATTACCTTTGCGATCT-3'(SEQ ID NO:2)；
Target-probe:ACTATGTCCGGGAACACAAAGAC(SEQ ID NO:3)；
Block sequence:GCTCATGCCCTTCGGGT-PO4(SEQ ID NO:4)
3) pcr amplification reaction liquid (table 2) is prepared according to following proportioning：
2 pcr amplification reaction liquid of table
| Raw material | (μl) |
| 10*Buffer | 12.5 |
| MgCl2 | 10 |
| dNTP | 2.5 |
| Taq enzyme | 1 |
| Sense primer | 2.5 |
| Downstream primer | 2.5 |
| Block sequence | 2.5 |
| Target-probe | 1.25 |
| H2O | 90.25 |
4) PCR reaction systems：23 μ l reaction solutions, 2 μ lDNA templates；
5) amplification of PCR and signal collection：Sense primer and downstream primer expand gene order to be measured, target-probe and
Retardance sequence and the products thereof expanded；It opens instrument and window is set, by following settings PCR amplification and signal collection program.
A) first stage：94 DEG C, 10 minutes
B) second stage：95 DEG C, 15 seconds, 40 cycles
C) phase III：60 DEG C, 30 seconds, 40 cycles
D) fourth stage：72 DEG C, 1 minute, 40 cycles
Signal collection：FAM signals are collected when 72 DEG C of fourth stage.
6) the results are shown in Figure 1, and the lowest detection for obtaining site is limited to 0.1%.
3. sensibility and specificity is tested：
After carrying out 100 times of dilutions to mutant plasmid with wild plasmid sample, with the primer, probe and PCR of above-mentioned design
Sample is detected after 100 parts of dilutions of kit pair, as a result shows 98 parts of C797S mutation detection, sensibility 98%.To wild
Type plasmid sample carries out specific assay with the primer of above-mentioned design, probe and PCR kit.Do 100 parts of repetitions, experimental result
Show 1 part of C797S mutation detection, specificity is 99%.
Embodiment 2
Acquire the plasma sample of 5 Patients with Non-small-cell Lung
1. sample DNA extracts：Plasma sample DNA uses the dissociative DNA extracts kit of QIAGEN, is determined after extracting
Amount, is stored in -80 DEG C of refrigerator；
2. primed probe group is as follows：
Sense primer:5'-GCTCATGCCCTTCGGGA-3'(SEQ ID NO:1),
Downstream primer:5'-CTGATTACCTTTGCGATCT-3'(SEQ ID NO:2)；
Target-probe:ACTATGTCCGGGAACACAAAGAC(SEQ ID NO:3)；
Block sequence:GCTCATGCCCTTCGGGT-PO4(SEQ ID NO:4)
The preparation of 3.PCR reaction solutions, such as table 3：
3 pcr amplification reaction liquid of table
| Raw material | 5 person-portions (μ l) |
| 10*Buffer | 12.5 |
| MgCl2 | 10 |
| dNTP | 2.5 |
| Taq enzyme | 1 |
| Sense primer | 2.5 |
| Downstream primer | 2.5 |
| Block sequence | 2.5 |
| Target-probe | 1.25 |
| H2O | 90.25 |
4.PCR reaction systems：23 μ l reaction solutions, 2 μ lDNA templates；
The amplification of 5.PCR and signal collection：Sense primer and downstream primer expand gene order to be measured, target-probe and
Retardance sequence and the products thereof expanded；It opens instrument and window is set, by following settings PCR amplification and signal collection program.
A) first stage：94 DEG C, 10 minutes
B) second stage：95 DEG C, 15 seconds, 40 cycles
C) phase III：60 DEG C, 30 seconds, 40 cycles
D) fourth stage：72 DEG C, 1 minute, 40 cycles
Signal collection：When 72 DEG C of fourth stage:Collect FAM signals.
6. the explanation of inspection result：Size by calculating △ Ct is judged：
If 1) CT (the external control) > of sample DNA to be checked;30, it prompts sample DNA concentration too low or degrades serious, it is proposed that more vary
This extracts DNA again；
If 2) CT (external control)≤30 of sample DNA to be checked, its Δ CT (CT (mutation)-CT (external control)) is calculated；If Δ CT>
8, it is judged as wild type (Fig. 3)；If Δ CT≤8, it is judged as saltant type (Fig. 2).
Sequence table
<110>Shanghai Pu Mei biological medicines Science and Technology Ltd.
<120>A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 1
gctcatgccc ttcggga 17
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 2
ctgattacct ttgcgatct 19
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 3
actatgtccg ggaacacaaa gac 23
<210> 4
<211> 17
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 4
gctcatgccc ttcgggt 17
Claims (3)
1. a kind of primer combination of probe object for blood EGFR C797S abrupt climatic changes, which is characterized in that it includes that upstream is drawn
Object, downstream primer, target-probe and retardance sequence；Wherein, the sequence of sense primer such as SEQ ID NO:Shown in 1, downstream primer
Sequence such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of target-probe:Shown in 3, block sequence such as SEQ ID NO:4
It is shown.
2. a kind of kit for blood EGFR C797S abrupt climatic changes, which is characterized in that it includes described in claim 1
Primer combination of probe object for blood EGFR C797S abrupt climatic changes.
3. kit according to claim 2, which is characterized in that it further includes PCR reaction solution, and PCR reaction solution includes
Taq enzyme, dNTP, PCR buffer solution and MgCl2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810600174.XA CN108707671A (en) | 2018-06-12 | 2018-06-12 | A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810600174.XA CN108707671A (en) | 2018-06-12 | 2018-06-12 | A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108707671A true CN108707671A (en) | 2018-10-26 |
Family
ID=63872565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810600174.XA Pending CN108707671A (en) | 2018-06-12 | 2018-06-12 | A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108707671A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055312A (en) * | 2019-04-09 | 2019-07-26 | 嘉兴雅康博医学检验所有限公司 | For detecting primer, probe and the kit of the mutation of EGFR gene C797S and T790M cis-trans |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103255201A (en) * | 2012-02-16 | 2013-08-21 | 北京宏微特斯生物科技有限公司 | Method of detecting gene mutation based on Blocker primers and ARMS primers, and kit |
| CN103436613A (en) * | 2013-08-21 | 2013-12-11 | 中国人民解放军第二军医大学 | Fluorescent PCR (Polymerase Chain Reaction) detection kit for IDH1/IDH2 (isocitrate dehydrogenase 1/isocitrate dehydrogenase 2) gene mutation and application thereof |
| CN107083438A (en) * | 2017-06-12 | 2017-08-22 | 上海捷易生物科技有限公司 | Detect primer, probe and the method for EGFR gene 20 extron T790M and C797S mutation |
| WO2018102162A1 (en) * | 2016-11-30 | 2018-06-07 | Exosome Diagnostics, Inc. | Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients |
-
2018
- 2018-06-12 CN CN201810600174.XA patent/CN108707671A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103255201A (en) * | 2012-02-16 | 2013-08-21 | 北京宏微特斯生物科技有限公司 | Method of detecting gene mutation based on Blocker primers and ARMS primers, and kit |
| CN103436613A (en) * | 2013-08-21 | 2013-12-11 | 中国人民解放军第二军医大学 | Fluorescent PCR (Polymerase Chain Reaction) detection kit for IDH1/IDH2 (isocitrate dehydrogenase 1/isocitrate dehydrogenase 2) gene mutation and application thereof |
| WO2018102162A1 (en) * | 2016-11-30 | 2018-06-07 | Exosome Diagnostics, Inc. | Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients |
| CN107083438A (en) * | 2017-06-12 | 2017-08-22 | 上海捷易生物科技有限公司 | Detect primer, probe and the method for EGFR gene 20 extron T790M and C797S mutation |
Non-Patent Citations (2)
| Title |
|---|
| JING ZHAO等: "A sensitive and practical method to detect the T790M mutation in the epidermal growth factor receptor", 《ONCOLOGY LETTERS》 * |
| LIN WANG等: "Quantification of plasma EGFR mutations in patients with lung cancers: Comparison of the performance of ARMS-Plus and droplet digital PCR", 《LUNG CANCER》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055312A (en) * | 2019-04-09 | 2019-07-26 | 嘉兴雅康博医学检验所有限公司 | For detecting primer, probe and the kit of the mutation of EGFR gene C797S and T790M cis-trans |
| CN110055312B (en) * | 2019-04-09 | 2022-11-15 | 嘉兴雅康博医学检验所有限公司 | Primer, probe and kit for detecting cis-trans mutation of EGFR gene C797S and T790M |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946739B (en) | EGFR genetic mutation detection kit and its application | |
| CN104818320B (en) | Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene | |
| CN104818318B (en) | Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene | |
| CN107083438A (en) | Detect primer, probe and the method for EGFR gene 20 extron T790M and C797S mutation | |
| CN108949990A (en) | A kind of kit and method detecting EGFR genetic mutation | |
| CN105112522A (en) | Detection primer combination and kit for HER2 (human epidermal growth factor receptor 2) gene amplification | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN108841953A (en) | The kit of 22 kinds of EGFR gene mutation is detected using digital pcr technology | |
| CN109234394A (en) | A kind of diagnosing cancer of liver marker and its screening technique | |
| CN110904239A (en) | Detection kit and detection method for lung cancer related molecular marker gene mutation | |
| CN106480201A (en) | Metastasis in Breast Cancer assesses test kit | |
| CN105671187A (en) | Set of genes for head and neck squamous cell carcinoma (HNSCC) molecular typing and application thereof | |
| CN105219881A (en) | The test kit of a kind of detection by quantitative ERCC1-202 and application | |
| CN106498029A (en) | The method for improving the diagnosis efficiency of the T790M mutation of EGFR | |
| CN108707671A (en) | A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes | |
| CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
| CN108130362A (en) | Kit and application for EGFR genetic mutation detection | |
| CN107365867A (en) | A kind of Primer composition and its application for being used to detect genome target region | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN105441405A (en) | A BMX spliceosome and applications thereof in lung cancer drug resistance | |
| CN110438206A (en) | Primer, probe and the kit of one group of 19 Exon deletion of detection EGFR gene mutation | |
| CN106755400A (en) | A kind of detection method of blood EGFR gene T790M mutation | |
| CN116377036A (en) | CRISPR/Cas12 a-based lung cancer patient peripheral blood EGFR gene mutation detection system and method | |
| CN103451303B (en) | Kit for detecting expression level of human ERCC1 (excision repair cross complementation 1) through PCR (polymerase chain reaction) method | |
| CN105821120B (en) | A kind of T790M mutation detection methods based on the compound COLD-PCR of nido |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181026 |
|
| RJ01 | Rejection of invention patent application after publication |