CN108707671A - A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes - Google Patents

A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes Download PDF

Info

Publication number
CN108707671A
CN108707671A CN201810600174.XA CN201810600174A CN108707671A CN 108707671 A CN108707671 A CN 108707671A CN 201810600174 A CN201810600174 A CN 201810600174A CN 108707671 A CN108707671 A CN 108707671A
Authority
CN
China
Prior art keywords
probe
sequence
primer
egfr
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810600174.XA
Other languages
Chinese (zh)
Inventor
张群
祝琳
雷豪志
王煜蘅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Pu Mei Biotechnology Co Ltd
Original Assignee
Shanghai Pu Mei Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Pu Mei Biotechnology Co Ltd filed Critical Shanghai Pu Mei Biotechnology Co Ltd
Priority to CN201810600174.XA priority Critical patent/CN108707671A/en
Publication of CN108707671A publication Critical patent/CN108707671A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of primer combination of probe objects and kit for blood EGFR C797S abrupt climatic changes.The primer combination of probe object and kit of the present invention includes sense primer, downstream primer, target-probe and retardance sequence;Wherein, the sequence of sense primer such as SEQ ID NO:Shown in 1, the sequence such as SEQ ID NO of downstream primer:Shown in 2, the sequence such as SEQ ID NO of target-probe:Shown in 3, block sequence such as SEQ ID NO:Shown in 4.Detection of the primer combination of probe object and kit of the present invention for EGFR gene C797S mutation, detection speed is fast, high sensitivity, high specificity.

Description

A kind of primer combination of probe object and examination for blood EGFR C797S abrupt climatic changes Agent box
Technical field
The invention belongs to technological field of biochemistry, specifically, are related to a kind of for blood EGFR C797S mutation inspections The primer combination of probe object and kit of survey.
Background technology
Lung cancer is the highest malignant tumour of morbidity and mortality, wherein non-small cell lung cancer in worldwide (NSCLC) 80% or so of whole lung cancer is accounted for.Individualized treatment pattern is advocated in the treatment of lung cancer.It is the driving based on patients with lung cancer Gene expression status is based only upon pathology treatment mode according to patients with lung cancer with the presence or absence of the individualized treatment of driving gene It can no longer meet the treatment of modern lung cancer.Wherein, EGFR mutation are important cancer driven factor, China patients with lung cancer EGFR Mutation rate is up to 30% or more.More common in non-smoking, women, adenocarcinoma patients, there are about 50% or so mutation rates.
EGFR is distributed widely in the cells table such as mammalian epithelial cell, fibroblast, spongiocyte, horn cell Face is the receptor of epidermal growth factor (EGF) cell Proliferation and signal transduction.The protein tyrosine kinases such as EGFR afunction or The activity or cellular localization of key factor are abnormal in its associated signal paths, with the proliferation of tumour cell, angiogenesis, tumors invading It attacks, shift and the inhibition of Apoptosis is related.Currently, the targeted therapy for EGFR has obtained larger progress, act on The tyrosine kinase inhibitor (TKI) of the kinase regions EGFR is clinically widely used to be mutated in non-small cell lung cancer EGFR In the treatment of patient, and achieve preferable effect.Iressa, Erlotinib, Kai Meina etc. belong to the EGFR-TKI targets of the first generation To medicine.But the first and second generation targeted drug is although significant in efficacy, but 2/3 patient can be resisted using drug 1-2 Pharmacological property.The T790M mutation of EGFR20 exons are considered as the first generation, the second generation targeting common medicament-resistant mutation of medicine.The target of a new generation To drug such as AZD9291, Rociletinib (Co-1686) shows sensitive to T790M.But at 10 months or so, patient Still it will produce drug resistance.Some researches show that C797S is the important drug resistance reason of these third generations EGFR targeted drugs at present One of.Therefore, great to the Clinical significance of detecting in 20 sites exon C797S EGFR.
Exist in the blood of most of (and not all) advanced NSCLC patients of studies have shown that cycle dissociative DNA (cfDNA, cell free DNA).CfDNA is mainly derived from apoptosis or the cell of necrosis, including normal cell and tumour cell, if come It is known as Circulating tumor DNA (ctDNA) from tumour cell.But dissociative DNA in blood segment is usually shorter, late blood of patients with cancer Concentration is extremely low in liquid, averagely about 17 μ g/L.Therefore, very high to the requirement of detection sensitivity.Have many blood at present The report of the method for EGFR genetic mutation detection, such as high-resolution melting point curve analytic approach (HRM), Denaturing high performance liquid chromatography (DHPLC), the sequencing of two generations, digital pcr method etc..Digital pcr has higher sensitive in the detection of blood plasma EGFR genetic mutation Degree and specificity, but this method detection EGFR genetic mutation site relatively limited (19 Exon deletions, 21 extras reported at present Aobvious sub- L858R mutation and 20 exon T790M mutation), it is still in and gropes, accumulates experience the stage;Its to operating personnel and Environment has higher requirement.The depth of detection in Gene Mutation has been expanded with the new technology that two generation sequencing technologies (NGS) are representative And range, but its clinical Transformation Application needs more data accumulations.Therefore, it is high to be badly in need of a kind of sensitivity at present, high specificity, The method of easy-to-use EGFR C797S abrupt climatic changes.
Invention content
For overcome the deficiencies in the prior art, the purpose of the present invention is to provide one kind for blood EGFR C797S mutation The primer combination of probe object and kit of detection.The primer combination of probe object and kit of the present invention is used for EGFR gene C797S The detection of mutation, detection speed is fast, high sensitivity, high specificity.
Technical scheme of the present invention is specifically described as follows.
The present invention provides a kind of primer combination of probe object for blood EGFR C797S abrupt climatic changes comprising draws upstream Object, downstream primer, target-probe and retardance sequence;Wherein, the sequence of sense primer such as SEQ ID NO:Shown in 1, downstream primer Sequence such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of target-probe:Shown in 3, block sequence such as SEQ ID NO:4 It is shown.
The present invention also provides a kind of kits for blood EGFR C797S abrupt climatic changes comprising claim 1 institute The primer combination of probe object for blood EGFR C797S abrupt climatic changes stated.Preferably, further include PCR reaction solution, PCR is anti- It includes Taq enzyme, dNTP, PCR buffer solution and MgCl to answer liquid2
In the present invention, the detailed process of blood EGFR C797S mutation detection methods is as follows:
(1) 20 exon C797S mutation of EGFR gene are directed to, specific primer and probe are designed.
(2) DNA in extraction blood plasma detection sample
(3) reaction system of fluorescent PCR amplification mutant gene sequence is prepared;
(4) gene order for using the primer amplification of step (1) offer to be measured, the probe provided with step (1) and retardance sequence Row and the products thereof that is expanded, and detect the fluorescence signal of the fluorophor of reaction system, by calculate the size of △ Ct into Row judges, if CT (the external control) &gt of sample DNA to be checked;30, it prompts sample DNA concentration too low or degrades serious, it is proposed that replace sample Or DNA is extracted again;If the CT (external control)≤30 of sample DNA to be checked, its Δ CT (CT (mutation)-CT (external control)) is calculated;If ΔCT>8 (or CT (mutation) is without displays), are judged as wild type;If Δ CT≤8, are judged as saltant type.
Compared with prior art, the beneficial effects of the present invention are:Present invention joint uses ARMS technologies, establishes blood Detect the Real-Time PCR quantitation method of 797 codon mutation of EGFR gene.The method of the present invention high sensitivity, detection sensitivity is up to thousand / mono-, it is suitable with digital pcr, but it is easy to operate, detection speed is fast;Compared with PCR sequencing PCR, the result of the method for the present invention can Observation in real time, product do not need detected through gel electrophoresis, and complete stopped pipe operation significantly reduces the risk of PCR product pollution;This Inventive method detection speed is fast, is suitable for high-throughput pattern detection.
Description of the drawings
Fig. 1 is sensitivity analysis experimental result picture.
Fig. 2 is clinical sample EGFR gene C797S positives PCR figures.
Fig. 3 is clinical sample EGFR gene C797S feminine genders PCR figures.
Specific implementation mode
It describes in detail with reference to the accompanying drawings and examples to technical scheme of the present invention.
Embodiment 1
Detection limit, sensitivity and the specificity experiments of detection primer, probe.
1. preparing negative (wild type) control plasmid and positive (saltant type) control plasmid
1) wild plasmid is built:Whole blood genome is extracted, with corresponding amplimer wild type sense primer, open country in table Raw type downstream primer (table 1) is expanded, and amplified production is connect with pMD18-T Vector, then connection product is added to 100 Microlitre DH5 α competent cells in, placed 30 minutes in ice, be added 500 microlitres of SOC culture mediums.In 37 degree of incubators, culture 60 minutes, after culture, culture solution is coated on the L- Agar Platings containing X-Gal, IPTG, AMP and is trained overnight It supports, forms single bacterium colony, selects white colony, carry out sequence verification.Proof has successfully built the plasmid of C797S wild types.
2) mutant plasmids are built:Using wild plasmid as template, drawn with corresponding amplimer saltant type upstream in table Object, saltant type downstream primer 1, saltant type downstream primer 2 (table 1) are expanded, by amplified production DpnI enzymic digestions 2 hours Afterwards, glue recycles digestion products, retells recovery product and is added in 100 microlitres of DH5 α competent cells, subsequent processes are same as above.
1 primer sequence of table
Variation type Primer sequence (5 ' -3 ')
Wild type sense primer AAGCCACACTGACGTGCCT
Wild type downstream primer ATATTGGCTCCCAGTACCTG
Saltant type sense primer TGTCACTTCACAGCCCTGC
Saltant type downstream primer 1 CTCATGCCCTTCGGCAGCC
Saltant type downstream primer 2 CATGCCCTTCGGCTCCCTCCT
2. sensitivity experiment
1) 1 times, 10 times, 100 times, 1000 times of dilutions are carried out to mutant plasmid with wild plasmid sample
2) primer probe sequence:
Sense primer:5'-GCTCATGCCCTTCGGGA-3'(SEQ ID NO:1);
Downstream primer:5'-CTGATTACCTTTGCGATCT-3'(SEQ ID NO:2);
Target-probe:ACTATGTCCGGGAACACAAAGAC(SEQ ID NO:3);
Block sequence:GCTCATGCCCTTCGGGT-PO4(SEQ ID NO:4)
3) pcr amplification reaction liquid (table 2) is prepared according to following proportioning:
2 pcr amplification reaction liquid of table
Raw material (μl)
10*Buffer 12.5
MgCl2 10
dNTP 2.5
Taq enzyme 1
Sense primer 2.5
Downstream primer 2.5
Block sequence 2.5
Target-probe 1.25
H2O 90.25
4) PCR reaction systems:23 μ l reaction solutions, 2 μ lDNA templates;
5) amplification of PCR and signal collection:Sense primer and downstream primer expand gene order to be measured, target-probe and Retardance sequence and the products thereof expanded;It opens instrument and window is set, by following settings PCR amplification and signal collection program.
A) first stage:94 DEG C, 10 minutes
B) second stage:95 DEG C, 15 seconds, 40 cycles
C) phase III:60 DEG C, 30 seconds, 40 cycles
D) fourth stage:72 DEG C, 1 minute, 40 cycles
Signal collection:FAM signals are collected when 72 DEG C of fourth stage.
6) the results are shown in Figure 1, and the lowest detection for obtaining site is limited to 0.1%.
3. sensibility and specificity is tested:
After carrying out 100 times of dilutions to mutant plasmid with wild plasmid sample, with the primer, probe and PCR of above-mentioned design Sample is detected after 100 parts of dilutions of kit pair, as a result shows 98 parts of C797S mutation detection, sensibility 98%.To wild Type plasmid sample carries out specific assay with the primer of above-mentioned design, probe and PCR kit.Do 100 parts of repetitions, experimental result Show 1 part of C797S mutation detection, specificity is 99%.
Embodiment 2
Acquire the plasma sample of 5 Patients with Non-small-cell Lung
1. sample DNA extracts:Plasma sample DNA uses the dissociative DNA extracts kit of QIAGEN, is determined after extracting Amount, is stored in -80 DEG C of refrigerator;
2. primed probe group is as follows:
Sense primer:5'-GCTCATGCCCTTCGGGA-3'(SEQ ID NO:1),
Downstream primer:5'-CTGATTACCTTTGCGATCT-3'(SEQ ID NO:2);
Target-probe:ACTATGTCCGGGAACACAAAGAC(SEQ ID NO:3);
Block sequence:GCTCATGCCCTTCGGGT-PO4(SEQ ID NO:4)
The preparation of 3.PCR reaction solutions, such as table 3:
3 pcr amplification reaction liquid of table
Raw material 5 person-portions (μ l)
10*Buffer 12.5
MgCl2 10
dNTP 2.5
Taq enzyme 1
Sense primer 2.5
Downstream primer 2.5
Block sequence 2.5
Target-probe 1.25
H2O 90.25
4.PCR reaction systems:23 μ l reaction solutions, 2 μ lDNA templates;
The amplification of 5.PCR and signal collection:Sense primer and downstream primer expand gene order to be measured, target-probe and Retardance sequence and the products thereof expanded;It opens instrument and window is set, by following settings PCR amplification and signal collection program.
A) first stage:94 DEG C, 10 minutes
B) second stage:95 DEG C, 15 seconds, 40 cycles
C) phase III:60 DEG C, 30 seconds, 40 cycles
D) fourth stage:72 DEG C, 1 minute, 40 cycles
Signal collection:When 72 DEG C of fourth stage:Collect FAM signals.
6. the explanation of inspection result:Size by calculating △ Ct is judged:
If 1) CT (the external control) &gt of sample DNA to be checked;30, it prompts sample DNA concentration too low or degrades serious, it is proposed that more vary This extracts DNA again;
If 2) CT (external control)≤30 of sample DNA to be checked, its Δ CT (CT (mutation)-CT (external control)) is calculated;If Δ CT> 8, it is judged as wild type (Fig. 3);If Δ CT≤8, it is judged as saltant type (Fig. 2).
Sequence table
<110>Shanghai Pu Mei biological medicines Science and Technology Ltd.
<120>A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 1
gctcatgccc ttcggga 17
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 2
ctgattacct ttgcgatct 19
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 3
actatgtccg ggaacacaaa gac 23
<210> 4
<211> 17
<212> DNA
<213>Artificial sequence (artificial sequence)
<400> 4
gctcatgccc ttcgggt 17

Claims (3)

1. a kind of primer combination of probe object for blood EGFR C797S abrupt climatic changes, which is characterized in that it includes that upstream is drawn Object, downstream primer, target-probe and retardance sequence;Wherein, the sequence of sense primer such as SEQ ID NO:Shown in 1, downstream primer Sequence such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of target-probe:Shown in 3, block sequence such as SEQ ID NO:4 It is shown.
2. a kind of kit for blood EGFR C797S abrupt climatic changes, which is characterized in that it includes described in claim 1 Primer combination of probe object for blood EGFR C797S abrupt climatic changes.
3. kit according to claim 2, which is characterized in that it further includes PCR reaction solution, and PCR reaction solution includes Taq enzyme, dNTP, PCR buffer solution and MgCl2
CN201810600174.XA 2018-06-12 2018-06-12 A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes Pending CN108707671A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810600174.XA CN108707671A (en) 2018-06-12 2018-06-12 A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810600174.XA CN108707671A (en) 2018-06-12 2018-06-12 A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes

Publications (1)

Publication Number Publication Date
CN108707671A true CN108707671A (en) 2018-10-26

Family

ID=63872565

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810600174.XA Pending CN108707671A (en) 2018-06-12 2018-06-12 A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes

Country Status (1)

Country Link
CN (1) CN108707671A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110055312A (en) * 2019-04-09 2019-07-26 嘉兴雅康博医学检验所有限公司 For detecting primer, probe and the kit of the mutation of EGFR gene C797S and T790M cis-trans

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103255201A (en) * 2012-02-16 2013-08-21 北京宏微特斯生物科技有限公司 Method of detecting gene mutation based on Blocker primers and ARMS primers, and kit
CN103436613A (en) * 2013-08-21 2013-12-11 中国人民解放军第二军医大学 Fluorescent PCR (Polymerase Chain Reaction) detection kit for IDH1/IDH2 (isocitrate dehydrogenase 1/isocitrate dehydrogenase 2) gene mutation and application thereof
CN107083438A (en) * 2017-06-12 2017-08-22 上海捷易生物科技有限公司 Detect primer, probe and the method for EGFR gene 20 extron T790M and C797S mutation
WO2018102162A1 (en) * 2016-11-30 2018-06-07 Exosome Diagnostics, Inc. Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103255201A (en) * 2012-02-16 2013-08-21 北京宏微特斯生物科技有限公司 Method of detecting gene mutation based on Blocker primers and ARMS primers, and kit
CN103436613A (en) * 2013-08-21 2013-12-11 中国人民解放军第二军医大学 Fluorescent PCR (Polymerase Chain Reaction) detection kit for IDH1/IDH2 (isocitrate dehydrogenase 1/isocitrate dehydrogenase 2) gene mutation and application thereof
WO2018102162A1 (en) * 2016-11-30 2018-06-07 Exosome Diagnostics, Inc. Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients
CN107083438A (en) * 2017-06-12 2017-08-22 上海捷易生物科技有限公司 Detect primer, probe and the method for EGFR gene 20 extron T790M and C797S mutation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JING ZHAO等: "A sensitive and practical method to detect the T790M mutation in the epidermal growth factor receptor", 《ONCOLOGY LETTERS》 *
LIN WANG等: "Quantification of plasma EGFR mutations in patients with lung cancers: Comparison of the performance of ARMS-Plus and droplet digital PCR", 《LUNG CANCER》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110055312A (en) * 2019-04-09 2019-07-26 嘉兴雅康博医学检验所有限公司 For detecting primer, probe and the kit of the mutation of EGFR gene C797S and T790M cis-trans
CN110055312B (en) * 2019-04-09 2022-11-15 嘉兴雅康博医学检验所有限公司 Primer, probe and kit for detecting cis-trans mutation of EGFR gene C797S and T790M

Similar Documents

Publication Publication Date Title
CN104946739B (en) EGFR genetic mutation detection kit and its application
CN104818320B (en) Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene
CN104818318B (en) Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene
CN107083438A (en) Detect primer, probe and the method for EGFR gene 20 extron T790M and C797S mutation
CN108949990A (en) A kind of kit and method detecting EGFR genetic mutation
CN107663533A (en) A kind of lung cancer EGFR L858R and 19Del ddPCR detection methods and application
CN103710460A (en) Kit for quantitatively detecting EGFR (Epidermal Growth Factor Receptor) gene mutation and application thereof
CN102776286B (en) Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation
CN108841953A (en) The kit of 22 kinds of EGFR gene mutation is detected using digital pcr technology
CN106755297A (en) One group is based on primer sets that ARMS fluorescence quantitative PCR detection EGFR genes T790M is mutated and preparation method thereof
CN109234394A (en) A kind of diagnosing cancer of liver marker and its screening technique
CN106480201A (en) Metastasis in Breast Cancer assesses test kit
CN105671187A (en) Set of genes for head and neck squamous cell carcinoma (HNSCC) molecular typing and application thereof
CN105219881A (en) The test kit of a kind of detection by quantitative ERCC1-202 and application
CN117305452B (en) Application of human SNRK mRNA in non-small cell lung cancer diagnosis, targeted therapy and prognosis evaluation and kit
CN108707671A (en) A kind of primer combination of probe object and kit for blood EGFR C797S abrupt climatic changes
CN107365867A (en) A kind of Primer composition and its application for being used to detect genome target region
CN105441405B (en) BMX spliced body and its application in drug resistance of lung cancer
CN103773763B (en) The method of a kind of gene mutation abundance detection, composition and application
CN110144386A (en) For detecting the primer, probe and kit of POLE gene mutation
CN110438206A (en) Primer, probe and the kit of one group of 19 Exon deletion of detection EGFR gene mutation
CN106755400A (en) A kind of detection method of blood EGFR gene T790M mutation
CN109082468A (en) Detect the kit and method of 19 exons mutation of EGFR gene
CN116377036A (en) CRISPR/Cas12 a-based lung cancer patient peripheral blood EGFR gene mutation detection system and method
CN103451303B (en) Kit for detecting expression level of human ERCC1 (excision repair cross complementation 1) through PCR (polymerase chain reaction) method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20181026

RJ01 Rejection of invention patent application after publication