CN108707659A

CN108707659A - LncRNA is diagnosed as URSA in serum and pregnancy outcome assesses the application of marker

Info

Publication number: CN108707659A
Application number: CN201810602044.XA
Authority: CN
Inventors: 李霞; 王彬; 赵霖; 张华�; 魏然; 尹训强; 张云虹; 张振; 郭强; 朱肖肖
Original assignee: INSTITUTE OF BASIC MEDICINE SAMS
Current assignee: INSTITUTE OF BASIC MEDICINE, SAMS; Shandong University of Traditional Chinese Medicine
Priority date: 2018-06-12
Filing date: 2018-06-12
Publication date: 2018-10-26
Anticipated expiration: 2038-06-12
Also published as: CN108707659B

Abstract

The invention discloses LncRNA ENST00000514235 in serum as URSA diagnosis and the application of pregnancy outcome's assessment marker, and diagnosis and pregnancy outcome assess marker using LncRNA ENST00000514235 as URSA, develop corresponding detection kit, the kit detection sensitivity is high, specificity is high, easy to detect, meet the detection demand of diagnosis patient URSA, accuracy rate of diagnosis is high according to clinical verification.

Description

LncRNA is diagnosed as URSA in serum and pregnancy outcome assesses the application of marker

Technical field

The invention belongs to biomedical sectors, and in particular in serum LncRNAENST00000514235 as reason not Bright property recurrent spontaneous (URSA) diagnosis and the application of pregnancy outcome's assessment marker.

Background technology

Spontaneous abortion recurs 2 times or 2 times referred above to recurrent miscarriage (recurrent spontaneous Abortion, RSA), incidence is about the 1%~5% of the women of child-bearing age, and the cause of disease is complicated, except a small number of chromosomes, endocrine, solution It cuts open, infect etc. outside factors, about 80% etiology unknown, referred to as unexplained recurrent spontaneous abortion (unexplained recurrent Spontaneous abortion, URSA).URSA serious harm women of child-bearing age's healthy reproductions, but current still shortage high specificity, The good biological indicator of high sensitivity, stability, clinical intervention treatment there is no clearly unified standard, gestation can not be effectively predicted Final result.Therefore, at present it is necessary to seek the marker of new effective URSA clinical diagnosises, treatment and prognosis detection, to diagnose, It treats URSA and research and development related drugs provides foundation.

Recent research indicate that 90% subgenomic transcription is at non-coding RNA.Non-coding RNA is considered as initially that " transcription is made an uproar Sound "；However, more and more evidences show that non-coding RNA has important role in many pathological processes.Non-coding RNA can be divided into short chain non-coding RNA (being less than 200bp) and long-chain non-coding RNA (being longer than 200bp).Long-chain non-coding RNA (LncRNA) it can be divided into antisense long non-coding RNA, intron non-coding RNA (LincRNA), promoter correlation LncRNA and non- Translated region LncRNA.Previous result of study shows that LncRNA plays an important role in various kinds of cell and biological process, example Such as cell Proliferation, cell cycle, chromosome remodeling and histone modification.In addition, the unconventionality expression of LncRNA and kinds of tumors phase It closes, including breast cancer, gastric cancer, hepatocellular carcinoma and prostate cancer etc..Although there is LncRNAs to be applied to recurrent miscarriage at present The report of assisting in diagnosis and treatment, but its diagnosis efficiency is relatively low.Such as, what Lu Chuncheng, model Yun et al. were studied is one group for acatalepsia The serum LncRNA markers of reason recurrent miscarriage, ROC analysis results show, Lnc-CHAC1-1, Lnc-FMN1-1, Lnc-TAX1BP1-4, Lnc-C2CD4A-3, Lnc-CES1-1, Lnc-ATF3-3 are combined normal control with 73.3% AUC multiple Hair property abortion cases group separates.

Therefore, it is necessary to further seek significantly more efficient long-chain non-coding RNA as URSA clinical diagnosises, treatment at present With the marker of prognosis detection, foundation is provided to diagnose, treating URSA and research and development related drugs.

Invention content

For the above prior art, inventor passes through a large amount of technical research and long-term clinical practice, provides one kind The Related product of diagnosis and/or assessment URSA Pregnancies, and LncRNAENST00000514235 is provided as URSA Diagnosis and the application of pregnancy outcome's assessment marker.

In the first aspect of the invention, LncRNAENST00000514235 is provided as URSA diagnosis and/or URSA Pregnancy assesses marker and is preparing for diagnosing URSA and/or for assessing in URSA Pregnancies product Using.

Wherein, the nucleic acid sequence of the LncRNA ENST00000514235 is as follows：

ATTCTGGCAACTGAACGTTGGCAGTAAACGCAGCTTAGTTGTCTCAGAGGACTCACAATGGGATGTGCT TATAGTTGTTGCCTCGAAGTGTGTTGTGGCGAGGATGAAATAGTGTATCCTAGGATGCCAGGGGAATCCACCGTCTG CCACCGCGAGCGTGAGAAGCCAATCACCTATCACTGATTACGATGAGGACCTGGTGCAGGAAGCTTCATCTGAAGAT GTCCTGGGCGTTCATATGGTGGACAAAGACACAGAGAGAGACAGTACGTATTCTGGAATCACCCCTATGCTGAGGAA AAATTCTAGTGTTGACAAAGGTGACACTTTCTTGCCTCATTTTTTCTGGAGAGCCACTCTGGTTTGAACTTCCTGCC AGAAATGTGGTTCAAGCACTTTTGTCTTGACAAGTGAAGAACCTGGTCAAGAAATGTGACCGTTGACTCTGGTGCTT GGAAGGAACAGGGTCATTTGGATAGAAGAGGGTGTTGTGAATCAGAGTTGGGAGGTATGGAGGAATGAGTCAATGTG GAATGATTGTGAATGTCTCTGCGAGTTTGTGTGCTTTTCCCCAGAAAATA

Further, the LncRNA ENST00000514235 are the LncRNA in serum sample ENST00000514235。

The second aspect of the invention provides the kit or genetic chip of detection LncRNA ENST00000514235 It is preparing for diagnosing URSA and/or for assessing the application in URSA Pregnancies product.

Further, the kit includes at least the forward primer 5&apos for LncRNA ENST00000514235;- GGAGAGCCACTCTGGTTTGA-3'With reverse primer 5'-CACCAGAGTCAACGGTCACA-3'.

Further, the genetic chip includes at least and the nucleic acid array hybridizing of LncRNA ENST00000514235 Probe.

Further, the product can be examined by LncRNA ENST00000514235 expressions in detection serum Whether disconnected patient suffers from URSA, the high occurrence and development expressed with URSA of LncRNA ENST00000514235 and pregnancy outcome's phase It closes.

Further, the product of the expression of the detection LncRNA ENST00000514235 includes：Pass through RT- PCR, real-time quantitative PCR, in situ hybridization, genetic chip or gene sequencing detect the expression water of LncRNA ENST00000514235 It puts down to diagnose URSA and/or assess the product of URSA Pregnancies.

The third aspect of the invention provides a kind of for diagnosing URSA and/or assessing URSA Pregnancies The characteristics of product, the product is：The product can express water by the LncRNA ENST00000514235 detected in serum It puts down and shows LncRNA to diagnose URSA and/or assessment URSA Pregnancies, high-throughput testing result ENST00000514235 is expressed in URSA groups and is significantly increased compared with normal pregnant women.

Further, the product is chip or detection kit；Its chips includes at least and LncRNA The probe of the nucleic acid array hybridizing of ENST00000514235.

Further, the detection kit includes reagent for preparing reverse transcription reaction system and for preparing qPCR The reagent of reaction system.

The fourth aspect of the invention provides LncRNA ENST00000514235 in the drug for preparing treatment URSA Using.

Further, the drug is the inhibitor of LncRNA ENST00000514235.

Compared with prior art, the advantageous effect of technical scheme of the present invention is：

(1) present invention obtains LncRNA by high-throughput chip and Big Clinical Samples expression verification, screening ENST00000514235 can be up to 95.10% as the marker of diagnosis URSA, diagnosis efficiency.

(2) for the present invention by high-throughput chip, screening, which obtains LncRNA ENST00000514235, to be used as URSA to suffer from The marker of person pregnancy outcome assessment, diagnosis efficiency are up to 91.50%.

(3) present invention develops for future inhibits the drug of LncRNA ENST00000514235 target spots to provide foundation.

(4) marker that the present invention is assessed using LncRNA ENST00000514235 as diagnosis URSA and pregnancy outcome, Corresponding detection kit is developed, the kit detection sensitivity is high, specificity is high, easy to detect, meets diagnosis URSA diseases The detection demand of people, accuracy rate of diagnosis is high according to clinical verification.

Description of the drawings

The Figure of description for constituting the part of the present invention is used to provide further understanding of the present invention, and of the invention shows Meaning property embodiment and its explanation are not constituted improper limitations of the present invention for explaining the present invention.

Fig. 1：URSA patient screens with normal pregnant women peripheral blood difference LncRNA.

Fig. 2：URSA patient verifies with normal pregnant women peripheral blood LncRNA ENST00000514235 expression.

Fig. 3：Pregnancy failure group is expressed with Pregnancy Success group peripheral blood LncRNA ENST00000514235 in URSA patient Verification.

Fig. 4：URSA patient schemes with normal pregnant women ROC Curve, and A is LncRNA ENST00000514235ROC bent Line chart, B are progestational hormone ROC curve figure.

Fig. 5：Pregnancy failure group is schemed with Pregnancy Success group ROC Curve in URSA patient, A LncRNA ENST00000514235ROC curve graphs, B are progestational hormone ROC curve figure.

Specific implementation mode

It is noted that described further below be all exemplary, it is intended to provide further instruction to the present invention.Unless another It indicates, all technical and scientific terms used herein has usual with general technical staff of the technical field of the invention The identical meanings of understanding.

It should be noted that term used herein above is merely to describe specific implementation mode, and be not intended to restricted root According to exemplary embodiments of the present invention.As used herein, unless the context clearly indicates otherwise, otherwise singulative It is also intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet Include " when, indicate existing characteristics, step, operation and/or combination thereof.

Term is explained：

LncRNA ENST00000514235：Long-chain non-encoding ribonucleic acid LncRNA ENST00000514235, nucleic acid Sequence such as SEQ ID NO:Shown in 1.

As background technology is introduced, use progestational hormone etc. as diagnosis URSA and pregnancy outcome's assessment in the prior art There are certain deficiencies, and in order to solve technical problem as above, the present invention obtains LncRNA by high-throughput chip, screening ENST00000514235 can be used as URSA diagnosis and pregnancy outcome to assess marker.

In the another embodiment of the present invention, the LncRNA ENST00000514235 are in serum sample LncRNA ENST00000514235.

In one particular embodiment of the present invention, the specific technical solution being related to includes：

(1) URSA patient and normal pregnant women venous blood (every group each 6) are collected, mononuclearcell is detached, using height Flux cDNA microarray difference LncRNA.

(2) enlarged sample amount (every group each 60), fluorescence real-time quantitative PCR (qPCR) verification screening difference LncRNA tables It reaches.

(3) clinical data (age, gender) is analyzed.

(4) Logistic analysis of regression model.

(5) ROC curve analytical control efficiency and best cutoff values.

In the exemplary embodiment of the present invention, the kit of detection LncRNA ENST00000514235 is provided Or genetic chip is being prepared for the application in diagnosing URSA and/or assessing URSA Pregnancies product.

In the specific embodiment of the present invention, the kit, which includes at least, is directed to LncRNA The forward primer 5&apos of ENST00000514235;-GGAGAGCCACTCTGGTTTGA-3'With reverse primer 5'- CACCAGAGTCAACGGTCACA-3'。

In the specific embodiment of the present invention, the genetic chip includes at least and LncRNA ENST0000051 The probe of 4235 nucleic acid array hybridizing.

In the specific embodiment of the present invention, the product can be by detecting LncRNA in serum Whether ENST00000514235 expressions suffer from URSA to diagnose patient, LncRNA ENST00000514235 high expression with The occurrence and development of URSA and pregnancy outcome are related.

In the another embodiment of the present invention, LncRNA ENST00000514235 in the detection serum The product of expression includes：It is detected by RT-PCR, real-time quantitative PCR, in situ hybridization, genetic chip or gene sequencing The expression of LncRNA ENST00000514235 is to diagnose URSA and/or assess the product of URSA Pregnancies.

Wherein, the gene sequencing can detect the opposite variation of gene expression dose, such as Illumina sequencings. Illumina platforms are a kind of sequencing sides based on the sequencing technologies (Sequencing-By-Synthesis, SBS) in synthesis Method.Since reversible block technology may be implemented only to synthesize a base every time, and mark fluorescent group, recycle corresponding laser Fluorophor is excited, exciting light is captured, to read base information.The original image data file that high-flux sequence obtains is through alkali Base identification (Base Calling) analysis be converted into primitive sequencer sequence, referred to as Raw Data or Raw Reads, as a result with FASTQ (referred to as fq) stored in file format.Clean Reads and specified reference gene group are subjected to sequence using hisat2 It compares, obtains the location information in reference gene group or gene, and the sequencing distinctive sequence signature information of sample.One base Because the directly embodiment of expression is exactly the abundance situation of its transcript, Transcript abundance degree is higher, then gene expression dose It is higher.In transcript profile sequencing analysis, can by navigate to transcript exon 1 sequencing sequence (reads) counting come Estimate the expression of gene.The calculating of transcript expression quantity uses FPKM methods (Fragments Per kb Per Million Reads), it is fragments numbers in every million fragments from a certain transcript per kilobase length.FPKM is simultaneously The influence that sequencing depth and transcript length count fragments is considered, common transcript expression water is presently the most Flat evaluation method.FPKM calculation formula are as follows：

In the exemplary embodiment of the present invention, provide a kind of for diagnosing URSA and/or assessment URSA patient The characteristics of product of pregnancy outcome, the product is：The product can be by detecting the LncRNA in serum ENST00000514235 expressions show to diagnose URSA and/or assessment URSA Pregnancies, high-throughput testing result LncRNA ENST00000514235 are expressed in URSA groups and are significantly increased compared with normal pregnant women.

In the specific embodiment of the present invention, the product is chip or detection kit；Its chips is at least It include the probe with the nucleic acid array hybridizing of LncRNA ENST00000514235.

In the specific embodiment of the present invention, for detection kit, detection architecture includes reverse transcription reaction body System and qPCR reaction systems, the detection kit include reagent for preparing reverse transcription reaction system and for preparing qPCR The reagent of reaction system.

In one particular embodiment of the present invention, reverse transcription is included at least for preparing the reagent of reverse transcription reaction system Buffer solution (MLV-5 × buffer), dNTP mixed liquors, RNA enzyme protein inhibitor (RNAsin), reverse transcription enzyme solution (M-MLV) With poly thymidine (OligodT).

In one particular embodiment of the present invention, for prepare qPCR reaction systems reagent include at least be directed to The forward primer liquid and reverse primer liquid of LncRNA ENST00000514235 further includes SYBR Green mixed liquors, free nucleic acid Enzyme pure water.

In the typical embodiment of the present invention, LncRNA ENST00000514235 are provided and are preparing treatment Application in the drug of URSA.

In the specific embodiment of the present invention, the drug is the inhibition of LncRNA ENST00000514235 Agent, the inhibitor of the LncRNA ENST00000514235 are to refer to reduce LncRNA ENST00000514235 expression water Flat product, the product include：The inhibition LncRNA obtained by the Knockdown strategy that siRNA and CRISPR is mediated The SiRNA expression vector and Cas9-sgRNA coexpression vectors of ENST00000514235 expressions, and reduce LncRNA Compound, compositions or agents of ENST00000514235 expressions etc..Wherein, inhibit LncRNA tables by striking low method It has been commercialized up to horizontal SiRNA expression vector and Cas9-sgRNA coexpression vectors, can also pass through conventional technology It is prepared.

In order to enable those skilled in the art can clearly understand technical scheme of the present invention, below with reference to tool The embodiment of the body technical solution that the present invention will be described in detail.

In following embodiments, if not specially show that reagent used is that analysis is pure, and agents useful for same can be from commercial channel It obtains.Test method without specific conditions in text, the science that such as J. Pehanorm Brookers are write usually according to normal condition What publishing house year published《Molecular Cloning:A Laboratory guide》Condition described in one book, or according to the condition proposed by manufacturer.It removes Non- separately to define, all professional and scientific terms used in text have the same meanings as commonly understood by one of ordinary skill in the art.This Outside, any method and material similar or impartial to described content all can be applied in the present invention.

1. experimental subjects is included in and exclusion criteria：

(1) case source

All cases derive from 01 month 2016 to 06 month 2017 gynaecology of Hospital Attached to Shandong Chinese Medical Univ. and are hospitalized With outpatient, totally 60.Normal group blood sample both from Hospital Attached to Shandong Chinese Medical Univ. normal pregnancy physical examination person, Not to be in the mood for, brain, lung, liver, kidney diaseases and thrombotic diseases, no known effect research index disease, totally 60.

(2) inclusion criteria：

(1) URSA patient selections standard：

1. patient has 2 times or 2 times or more history of spontaneous abortion, no life birth history；

2. Mr. and Mrs both sides and (or) embryo chromosome are normal, no family's hereditary disease and consanguineous marriage history；

3. the inspections exclusion patient such as the inspection of gynaecological examination leukorrhea, ultrasonic examination and (or) hysterosalpingography organic disease, Reproductive organs anatomical abnormalities and infectious factors；

4. the menstrual cycle is normal, basal body temperature two-phase, ultrasonic monitoring ovulation is normal；

5. bridegroom's or husband's side semen analysis is normal；

6. the Endocrinological inspections such as sex hormone, thyroid function, blood glucose, insulin are normal；

7. autoantibody such as antinuclear antibodies, anticardiolipin antibodies, anti-thyroid antibody, anti-2- glycoprotein I Antibodies check equal It is negative；

8. the related inspection of prethrombotic state, including d-dimer, fibrin (original) catabolite, blood clotting are serial, complete Haemanalysis is normal；

9. Torch series IgM is negative；

10. not carrying out active immunity treatment in the past.

(2) normal control inclusion criteria：

Normal pregnancy physical examination women within gestation 12 weeks, previously without spontaneous abortion, stillborn foetus, stillbirth history, no heredity, dissection, It is abnormal in terms of endocrine, no infection, autoimmune disease history；The threatened abortions such as this gestation Non-vaginal bleeding, abdominal pain Sings and symptoms；Ultrasound confirms that embryonic development is normal, and intentionally pipe is beaten.

2. high-throughput chip detection：

URSA and normal pregnant women peripheral blood are collected, total serum IgE utilizes NanoDrop ND-2000 (Thermo Scientific) quantitative and complete through Agilent Bioanalyzer 2100 (Agilent Technologies) detections RNA Property.After RNA quality inspection qualifications, total serum IgE reverse transcription is marked at double-strand cDNA, further synthesis Cyanine-3-CTP (Cy3) cRNA.CRNA and Agilent Human lncRNA Microrray V6 (4*180K, the Design ID marked:084410) Chip hybridization obtains original graph after elution using Agilent Scanner G2505C (Agilent Technologies) scannings Picture.

It is handled using Feature Extraction softwares (version10.7.1.1, Agilent Technologies) Original image extracts initial data.Followed by Genespring softwares (version 13.1, Agilent Technologies quantile standardization and subsequent processing) are carried out.Data after standardization are filtered, every for what is compared At least one group 100% probe labeled as " P " leaves carry out subsequent analysis in group sample.Become using the T p values examined and multiple Change value carries out difference circRNA and LncRNA, the standard of screening be raise or lower fold change value >=2.0 and P values≤ 0.05。

3.qPCR verifies difference LncRNA expression：

(1) cell extraction RNA：

Take 5 × 10⁶~1 × 10⁷A cell is added 1ml Trizon, mixes well, be stored at room temperature 5~10min；It is added 200 μ l/1mlTrizon chloroforms cover tightly EP and manage and acutely sway 15s；4 DEG C of centrifugations：12000rpm × 10min takes upper strata aqueous phase In a new EP pipes；Isometric isopropanol is added, mildly overturns mixing, is placed at room temperature for 10min；4 DEG C of centrifugations：12000rpm× 10min；Supernatant is abandoned, 1ml 75 (v/v) % ethyl alcohol (absolute ethyl alcohols are added：DNase/RDase-free water=3:1), gently Mixing；4 DEG C of centrifugations：12000rpm×5min；Supernatant is abandoned, 1ml absolute ethyl alcohols are added；4 DEG C of centrifugations, 12000rpm × 5min；It abandons Supernatant (as possible removes residual liquid), 10~20min of room temperature or vacuum drying；Appropriate DNase/ is added according to RNA precipitate amount RDase-free water (being usually 30-50 μ l) dissolving RNA；Concentration is surveyed after mixing and is recorded, and reverse transcription is carried out.

(2) RT is tested

0.2mlEP pipe marker samples titles and date are taken, RNA, DNase/RDase-free water, OligodT are pressed It is required that being added in the EP pipes marked；Operation RT-1 programs, 70 DEG C, 5min (table 1)；By the prepared MLV-5 of system × The MIX of buffer, dNTP, RNAsin, M-MLV are added in above-mentioned EP pipes, run RT-2 programs, and 42 DEG C, 1h obtains cDNA, Carry out PCR experiment (table 2).

Table 1.RNA and OligodT

System volume	20μl
		RNA	11μl
DNase/RDase-free water	11-V1
		OligodT	1μl
RNA uses volume V1	2000ng/C1

2. reverse transcription reaction system of table

System volume	20μl
		MLV-5×buffer	4μl
dNTP	2μl
		RNAsin	1μl
M-MLV	1μl
		RNA+OligodT	11μl

(3) qPCR is tested：After SYBR, primer and cDNA dissolvings, brief centrifugation, mixing is placed on ice；DNase/RDase- free water。

Table 3.PCR reaction systems (20 μ l)

Reaction system	20μl
		Primers F (10 μm)	1.2μl
Primer R (10 μm)	1.2μl
		SYBR	10μl
cDNA	2μl
		DNase/RDase-free water	5.6μl

Brief centrifugation；Run 7500 programs, the setting of condition according to the form below.

Table 4.PCR programs

Table 5.LncRNA ENST00000514235 primer sequences

LncRNA ENST00000514235	Sequence(5'->3')
		Forward primer	GGAGAGCCACTCTGGTTTGA(SEQ ID NO:2)
Reverse primer	CACCAGAGTCAACGGTCACA(SEQ ID NO:3)
		Product length	178bp

4. statistical analysis：

Using SPSS22.0 softwares (SPSS Inc., USA).Continuous variable is using the peaceful mean value ± of median (Median) Standard deviation () indicate；Measurement data is examined using t, and enumeration data uses χ²It examines.It is special by drawing subject's work Sign (ROC) curve judges diagnosis capability with corresponding area under the curve (AUC) is calculated.Best cutoff values are chosen for sensitivity With the value corresponding to the sum of specificity maximum.Using medcale10.4.7.0 comparison area under the curve AUC othernesses.P< 0.05 (bilateral) is to have significant difference.Using R software analytical control efficiency and sample size, R >=0.8 is to be imitated with inspection Energy.

As a result

1. high-throughput testing result

It is high-throughput the results show that circ_0079591, circ_0082660, LncRNA NONHSAT167899.1, LncRNA ENST00000514235 are dramatically different in the more normal pregnancy controls group of URSA groups expression, wherein as shown in Figure 1, LncRNA ENST00000514235 express more normal pregnancy controls group in URSA groups and significantly increase, P<0.05.And about circ_ 0082660, the specific technical solution of circ_0079591 and LncRNA NONHSAT167899.1, applicant have been made It is protected for other patent applications.

2.qPCR verifies LncRNA ENST00000514235 expression

As shown in Fig. 2, compared with Normal group, URSA group LncRNA ENST00000514235 expression significantly increases (P <0.05)；As shown in figure 3, in URSA patient, LncRNA ENST00000514235 are in Pregnancy failure group compared with Pregnancy Success group table It is increased up to notable, P<0.05.

3. analysis of clinical between group

(1) age：Not statistically significant (the P&gt of age comparing difference between group;0.05), there is comparativity (being shown in Table 6, table 7).

6. normal groups of table is between URSA group groups compared with the age

Note：The age carries out t inspections, P&gt between two groups;0.05.

In table 7.URSA between Pregnancy Success and ineffective group group compared with the age

Note：The age carries out t inspections, P&gt between two groups;0.05.

4.Logistic regression analyses：Normal pregnancy group is shown in Table with URSA group Logistic regression analyses in 8, URSA pregnant Success group is shown in Table 9 with Pregnancy failure group Logistic regression analyses.

8. normal pregnancy group of table and URSA group Logistic regression analyses

Model1:Single factor test Logistic regression models are built by independent variable of LncRNA ENST00000514235；

Model2:Using age, LncRNA ENST00000514235 Influencing factors mould is built as independent variable Type；

Single factor test Logistic regression models are built using LncRNA ENST00000514235 as independent variable and are corrected simultaneously Constructed Influencing factors model result is shown after age, and correcting and not correcting obtained statistical result is Consistent, it is thus determined that LncRNA ENST00000514235 have the potentiality of diagnosis URSA.

Pregnancy Success group and Pregnancy failure group Logistic regression analyses in table 9.URSA

Single factor test Logistic regression models are built using LncRNA ENST00000514235 as independent variable and are corrected simultaneously Constructed Influencing factors model result is shown after age, and correcting and not correcting obtained statistical result is Consistent, it is thus determined that LncRNA ENST00000514235 have the potentiality of prediction URSA pregnancy outcomes.

5.ROC tracing analysis power of test and best cutoff values：

The results are shown in Figure 4, and LncRNA ENST00000514235ROC area under the curve is 0.951, is higher than progestational hormone (0.703), p<0.05.LncRNA ENST00000514235 relative expression quantities are higher than 1.833, are diagnosed as URSA；Relative expression Amount is less than 1.833, is not diagnosed as URSA；Diagnosis efficiency is 95.10%.

The results are shown in Figure 5, and LncRNA ENST00000514235ROC area under the curve is 0.915, is higher than progestational hormone (0.838), p<0.05.LncRNA ENST00000514235 relative expression quantities are pregnant higher than 1.783, URSA Prognostics It is pregnent unsuccessfully；Relative expression quantity is Pregnancy Success less than 1.783, URSA Prognostics；Prognosis evaluation efficiency is 91.50%.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, it is other it is any without departing from the spirit and principles of the present invention made by changes, modifications, substitutions, combinations, simplifications, Equivalent substitute mode is should be, is included within the scope of the present invention.

SEQUENCE LISTING

<110>Basic Medical Science Inst., Shandong Prov. Academy of Medical Science

<120>LncRNA is diagnosed as URSA in serum and pregnancy outcome assesses the application of marker

<130> 2018

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 581

<212> DNA

<213>LncRNA ENST00000514235 sequences

<400> 1

attctggcaa ctgaacgttg gcagtaaacg cagcttagtt gtctcagagg actcacaatg 60

ggatgtgctt atagttgttg cctcgaagtg tgttgtggcg aggatgaaat agtgtatcct 120

aggatgccag gggaatccac cgtctgccac cgcgagcgtg agaagccaat cacctatcac 180

tgattacgat gaggacctgg tgcaggaagc ttcatctgaa gatgtcctgg gcgttcatat 240

ggtggacaaa gacacagaga gagacagtac gtattctgga atcaccccta tgctgaggaa 300

aaattctagt gttgacaaag gtgacacttt cttgcctcat tttttctgga gagccactct 360

ggtttgaact tcctgccaga aatgtggttc aagcactttt gtcttgacaa gtgaagaacc 420

tggtcaagaa atgtgaccgt tgactctggt gcttggaagg aacagggtca tttggataga 480

agagggtgtt gtgaatcaga gttgggaggt atggaggaat gagtcaatgt ggaatgattg 540

tgaatgtctc tgcgagtttg tgtgcttttc cccagaaaat a 581

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

ggagagccac tctggtttga 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<400> 3

caccagagtc aacggtcaca 20

Claims

1.LncRNA ENST00000514235 are diagnosed as URSA and/or prepared by URSA Pregnancies assessment marker For diagnosing URSA and/or for assessing the application in URSA Pregnancies product.

2. application as described in claim 1, it is characterized in that：The LncRNA ENST00000514235 are in serum sample LncRNA ENST00000514235。

3. the kit or genetic chip that detect LncRNA ENST00000514235 are being prepared for diagnosing URSA and/or assessment Application in URSA Pregnancies product.

4. application as claimed in claim 3, it is characterized in that：The kit, which includes at least, is directed to LncRNA The forward primer 5&apos of ENST00000514235;-GGAGAGCCACTCTGGTTTGA-3'With reverse primer 5'- CACCAGAGTCAACGGTCACA-3'。

5. application as claimed in claim 3, it is characterized in that：The genetic chip includes at least and LncRNA The probe of the nucleic acid array hybridizing of ENST00000514235.

6. application as claimed in claim 3, it is characterized in that：The product can be by detecting LncRNA in serum Whether ENST00000514235 expressions diagnose patient with URSA and/or assessment URSA Pregnancies.

7. application as claimed in claim 6, it is characterized in that：The table of LncRNA ENST00000514235 in the detection serum Include up to horizontal product：LncRNA is detected by RT-PCR, real-time quantitative PCR, in situ hybridization, genetic chip or gene sequencing The expression of ENST00000514235 is to diagnose URSA and assess the product of URSA Pregnancies.

8. a kind of product for diagnosing URSA and/or assessing URSA Pregnancies, it is characterized in that：The product can lead to It crosses and detects the LncRNA ENST00000514235 expressions in serum to diagnose URSA and/or assessment URSA patient's gestation knot Office.

9. product as claimed in claim 8, it is characterized in that：The product is chip or detection kit；Its chips is at least It include the probe with the nucleic acid array hybridizing of LncRNA ENST00000514235；The detection kit is included at least and is directed to The forward primer 5&apos of LncRNA ENST00000514235;-GGAGAGCCACTCTGGTTTGA-3'With reverse primer 5'- CACCAGAGTCAACGGTCACA-3'。

Applications of the 10.LncRNA ENST00000514235 in the drug for preparing treatment URSA, it is characterized in that：The drug is The inhibitor of LncRNA ENST00000514235.