CN108676812B

CN108676812B - Method for obtaining plants with improved yield by using CRISPR/Cas9 system mutation OsHXK1

Info

Publication number: CN108676812B
Application number: CN201810257507.3A
Authority: CN
Inventors: 庄楚雄; 郑少燕
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2018-03-27
Filing date: 2018-03-27
Publication date: 2020-12-08
Anticipated expiration: 2038-03-27
Also published as: CN108676812A

Abstract

The invention belongs to the field of rice genetic engineering, and relates to a method for editing and mutating a rice hexokinase OsHXK1 gene by using a CRISPR/Cas9 system gene to improve a yield plant. The invention designs a target sequence according to OsHXK1 gene, constructs pU3-gRNA and pU6-gRNA vectors containing target sequence fragments, constructs pCRISPR/Cas9 vectors containing target sequence fragments, and obtains transgenic seedlings. The plant in which the OsHXK1 is knocked out by the method has the same phenotype as the OsHXK1-RNAi transgenic plant, the rice yield is improved without transgenic components through artificial cultivation, and meanwhile, the method has no essential difference with the method in which the OsHXK1-RNAi transgenic plant is utilized, has strong purposiveness, can obviously improve the rice yield, and has wide application prospect in rice molecular design breeding.

Description

Method for obtaining plants with improved yield by using CRISPR/Cas9 system mutation OsHXK1

Technical Field

The invention belongs to the field of rice genetic engineering, and particularly relates to a method for obtaining a plant with improved yield by using a CRISPR/Cas9 system mutation OsHXK1, a gene edited by the method, and a protein encoded by the gene.

Background

Rice (Oryza sativa L.) is an important food crop and monocot model plant. Currently, the number of global population increases, the cultivated land area decreases, the environmental pollution is serious, extreme climates frequently occur, and the improvement of rice yield faces a serious challenge. Therefore, the concept of molecular design breeding of rice is proposed to realize the conversion from 'empirical breeding' to 'directed, efficient and accurate breeding' (Peleman et al, 2003; Wanjianmen, 2006; Wanjiangkang et al, 2011). In recent years, genome fixed-point editing technologies represented by CRISPR/Cas9(Clustered differentiated short palindromic repeats and CRISPR associated) technologies become new research hotspots of plant breeding technologies, and a safe and efficient new approach is provided for rice germplasm resource innovation (Xu et al, 2016; Ma et al, 2015). The CRISPR/Cas9 technology is used for editing and controlling genes related to rice yield at fixed points, and creating some non-transgenic new rice varieties with important values and mutants for basic research of water supply rice, thereby laying a foundation for expanding the cultivation and the basic research of new rice varieties and having important theoretical and practical significance.

Reference to the literature

Peleman J.D and vander Voort J.R.,2003,Breeding by design,Trends Plant Sci,8(7):330-334

Feng Z Y,Zhang B T,Ding W N,et al.Efficient genome editing in plants using a CRISPR/Cas9system[J].Cell Research，2013，23(10):1229-1232.Ma X L,Zhang Q Y,Zhu Q L,et al.Arobust CRISPR/Cas9system for convenient，high-efficiency multiplex genome editing in monocot and dicot plants[J].Molecular Plant,2015,8(8):1274-1284.

2006, molecular design and breeding of crops, academic newspaper, 32(3): 455-462-

Wangjiangkang, Li Hui, Zhang Zhi, Yi Chang bin, Li Yu, Ma Zhi, Li Xinhai, Qili Juan, Wanjian Min, 2011, molecular design and breeding of Chinese crops, journal of crops, 37(2):191-

Disclosure of Invention

The invention aims to provide a method for improving rice yield.

The invention also aims to provide application of the OsHXK1 gene in rice yield.

The invention also aims to provide a method for knocking out OsHXK1 by using a CRISPR/Cas9 system to improve rice yield.

The above object of the present invention is achieved by the following technical means:

the invention provides a method for improving rice yield by reducing the expression level of OsHXK1 protein or blocking the generation of OsHXK1 protein.

OsHXK1 is a member of the hexokinase family, in plants, hexoses must undergo phosphorylation to enter glycolysis process, providing energy for plant growth and development, and the enzymes catalyzing hexose phosphorylation are collectively called Hexokinase (HXK). HXK is also involved in the perception of sugar signaling in plants. It has been confirmed that the rice hexokinase family has 10 members in total, named OsHXK1 through OsHXK 10.

OsHXK1 is known to be related to the growth and development of plants and provides energy for the growth and development of plants. According to the invention, a large number of researches show for the first time that the mutation of the OsHXK1 gene is unexpectedly found to reduce the expression quantity of the OsHXK1 protein or block the generation of the OsHXK1 protein, so that the yield of rice can be increased from multiple traits.

The protein expressed by the OsHXK1 gene has an amino acid sequence shown in SEQ ID No. 1. As an alternative, the OsHXK1 gene has the nucleic acid sequence shown in SEQ ID No. 2.

Amino acid sequence of SEQ ID NO.1OsHXK1 protein

MAAAAVAADQKVVTMTSLREGCACAAPPAAAAPPMPKMAAAQRVVAELREACATPAARLAEVAAAMAGEMEAGLAVEGGSSEMKMIVSYVDSLPTGGEEGSYYALDLGGTNFRVLRVRLAGGGVAERVAREVPIPPGLMSGGGATSECLFGFIASALAEFVGEEEEEGGLDGGERELGFTFSFPVHQTSIASGTLIRWTKAFAVDDAIGEDVVAALQAAMSERGLDMRVSALINDTVGTLAAGSYYDEDVVAAVILGTGTNAAYVEDATAIAKLHPSQLPASNTMVINTEWGSFASPCLPLTEFDEALDQESLNPGEQTYEKLISGMYLGEIVRRVLLKISSRCPSLLGGAGELATPFVLRTPDVSAMHHDETPDLSIVGEKLERTLGIRGTSPEARRMVVEVCDIVATRAARLAAAGIVGILKKIGRVDGGEGRRRRSVVAVDGGLFEHYGKFRRCMESAVRELLGEAAAERVVVKLASDGSGLGAALVAAAHSQRA.

SEQ ID NO.2OsHXK1cDNA nucleotide sequence

ATGGCGGCGGCGGCGGTGGCGGCAGATCAGAAGGTGGTGACGATGACGAGCCTCCGGGAGGGCTGCGCTTGCGCGGCGCCTCCTGCTGCAGCTGCGCCGCCGATGCCGAAGATGGCGGCGGCGCAGAGGGTGGTGGCGGAGCTGAGAGAAGCGTGCGCGACGCCGGCGGCGAGGCTGGCGGAGGTGGCCGCGGCGATGGCCGGCGAGATGGAGGCCGGGCTGGCGGTGGAGGGCGGCAGCAGCGAGATGAAGATGATCGTGTCGTACGTCGACAGCCTCCCCACCGGCGGCGAGGAGGGGTCGTACTACGCGCTCGACCTCGGCGGCACCAACTTCCGCGTCCTCCGCGTGCGGCTTGCCGGCGGCGGCGTCGCCGAGCGCGTGGCGAGGGAGGTCCCGATCCCTCCCGGCCTCATGTCCGGCGGCGGCGCCACCTCGGAGTGCCTCTTCGGCTTCATCGCCTCCGCGCTAGCCGAGTTCGTCGGCGAGGAGGAAGAAGAAGGCGGCCTCGACGGCGGCGAGAGGGAGCTTGGGTTCACCTTCTCCTTCCCCGTGCACCAAACCTCCATCGCGTCGGGGACGCTCATCCGGTGGACGAAGGCGTTCGCCGTCGACGACGCGATCGGCGAGGACGTCGTGGCGGCGCTGCAGGCGGCCATGTCGGAGCGGGGGCTCGACATGCGCGTGTCGGCGCTCATCAACGACACCGTCGGGACGCTCGCCGCGGGCAGCTACTACGACGAGGACGTCGTGGCCGCCGTCATCCTCGGCACCGGCACGAACGCCGCCTACGTCGAGGACGCCACCGCCATCGCCAAGCTACACCCATCGCAGCTGCCAGCATCGAACACCATGGTGATCAACACCGAGTGGGGCAGCTTCGCCTCGCCGTGCCTCCCATTGACGGAGTTCGACGAAGCACTCGATCAGGAGAGCCTCAACCCCGGCGAGCAGACCTACGAGAAGCTCATCTCCGGGATGTACCTCGGCGAGATCGTCAGGAGGGTCCTCCTCAAGATCTCCTCCCGGTGCCCCTCCCTCCTCGGCGGCGCCGGCGAGCTCGCGACGCCGTTCGTCCTCAGGACACCCGACGTGTCCGCGATGCACCACGACGAGACGCCCGACCTGAGCATCGTCGGCGAGAAGCTGGAACGCACGCTGGGCATCCGCGGCACGTCGCCGGAGGCGAGGAGGATGGTCGTCGAGGTGTGCGACATCGTCGCCACGAGGGCCGCCCGGCTGGCCGCGGCGGGGATCGTCGGGATCCTGAAGAAGATCGGGAGGGTCGACGGCGGCGAGGGGCGGAGGAGGAGGTCGGTGGTCGCCGTGGACGGCGGGCTGTTCGAGCACTACGGCAAGTTCCGGCGGTGCATGGAGAGCGCGGTGAGGGAGCTGCTCGGAGAGGCGGCGGCGGAGAGGGTGGTCGTCAAGCTCGCCAGCGACGGCTCCGGGCTCGGCGCCGCCCTGGTTGCAGCTGCTCACTCGCAGAGAGCATAA As an embodiment, the present invention reduces the expression level of OsHXK1 protein or blocks the production of OsHXK1 protein by mutating the OsHXK1 gene.

Wherein, the mutation is to add, substitute or delete one or more bases of the nucleic acid sequence shown in SEQ ID No. 2.

The mutation may be performed by using a gene editing method in the prior art, such as ZFN, TALEN, or CRISPR gene editing technology, or may be performed by using a new gene editing technology that has not yet been developed, and in short, addition, substitution, or deletion of one or more bases of a nucleic acid sequence may be performed.

As a preferred embodiment, the OsHXK1 mutation by using the CRISPR/Cas9 system improves the rice yield. Specifically, an sgRNA sequence based on CRISPR/Cas9 is designed aiming at the OsHXK1 gene, a DNA fragment containing the sgRNA sequence is connected to a vector carrying the CRISPR/Cas to transform rice, and the site-directed mutation of the OsHXK1 gene of the rice is realized.

The OsHXK1 gene is numbered in different databases as: GenBank at NCBI (http:// www.ncbi.nlm.nih.gov /) accession number Os07g 0446800; at Rice Genome Annotation Project (RGAP) site: http:// rice. plant biology. msu. edu/its number LOC _ Os07g 26540.

As a preferred embodiment, the target sequence (sgRNA) has 5' -N_X-the structure of NGG-3'; or may be 5' -N_X-NAG-3 'or 5' -N_X-NGA-3’；

Wherein N represents any one of A, T, C and G;

wherein X represents a base sequence.

The post-mutation features an insertion of a base between the 3 rd and 4 th bases upstream of NGG or NAG or NGA or a loss of a base 5 'and/or 3' thereof.

As an exemplary embodiment of the present invention, the target sequence has a nucleic acid sequence shown in SEQ ID NO.5 or SEQ ID NO. 15.

More specifically, the method for improving the rice yield by using the CRISPR/Cas9 system mutation OsHXK1 specifically comprises the following steps:

(1) constructing an sgRNA vector containing a target sequence fragment;

specifically, in the step (1), firstly, a target primer pair with a sticky end is synthesized, and an adapter primer is denatured and then is moved to room temperature to be cooled to complete annealing; linking the annealed primer to the sgRNA vector after enzyme digestion, and verifying positive plasmids through PCR amplification and sequencing;

in a preferred embodiment, in the step (1), the sgRNA vector is pU3-gRNA and/or pU 6-gRNA;

as a preferred embodiment, in step (1), the target primer pair with sticky ends has the nucleic acid sequences shown as SEQ ID NO.6 and SEQ ID NO. 7; or has the nucleic acid sequences shown in SEQ ID NO.16 and SEQ ID NO. 17;

(2) constructing a pCRISPR/Cas9 vector containing a target sequence fragment;

specifically, the step (2) is that the sgRNA expression cassette containing the target site sequence fragment is cut from the sgRNA vector and then is connected to the pCRISPR/Cas9 vector containing the Cas9 expression cassette;

alternatively, one or more target sequences can be ligated to a pCRISPR/Cas9 vector containing the Cas9 expression cassette.

If a target sequence is ligated to the pCRISPR/Cas9 vector containing the Cas9 expression cassette, then only one sgRNA vector needs to be constructed at step (2); if multiple target sequences are ligated to the pCRISPR/Cas9 vector containing the Cas9 expression cassette, then only the corresponding target number sgRNA vector needs to be constructed at step (1), and at step (2), the multiple target sequences are excised from the sgRNA vector and ligated together to the pCRISPR/Cas9 vector of one Cas9 expression cassette.

In a preferred embodiment, the target sequence has the nucleic acid sequence shown in SEQ ID NO.5 and/or SEQ ID NO. 15.

As a more preferred embodiment, the target sequences shown in both SEQ ID NO.5 and SEQ ID NO.15 are ligated to the pCRISPR/Cas9 vector containing the Cas9 expression cassette.

(3) Transformation;

specifically, the pCRISPR/Cas9 vector containing the target is transformed into rice callus, and the rice callus is screened, differentiated, rooted and grown into seedlings, and the transgenic plants are planted in a net room; identifying the positive transgenic plant by hygromycin;

as a preferred embodiment, in step (3), the pCRISPR/Cas9 vector is transformed into rice callus by Agrobacterium-mediated genetic transformation or biolistic transformation;

as a preferred embodiment, the method further comprises:

(4) identifying a mutation site;

specifically, the step (4) is to extract the DNA of the positive plant, design and identify primers to amplify the DNA, purify, sequence and analyze mutation conditions.

As a preferred embodiment, in step (4), the primer set shown in SEQ ID No.3 and SEQ ID No.4 is used for identification.

Compared with the prior art, the invention has the advantages and beneficial effects that:

1. the invention discovers for the first time that the OsHXK1 gene is related to the rice yield, carries out mutation on the gene, reduces the expression quantity of the OsHXK1 protein or blocks the generation of the OsHXK1 protein, can improve the rice yield from multiple traits, and can be used as an effective target spot of rice genetic breeding.

2. The method for obtaining the yield-improved plant by using the CRISPR/Cas9 system mutation OsHXK1 provides an effective way for improving the rice yield; the mutant has no essential difference with mutants obtained by chemical and physical mutagenesis, but has strong purpose and small damage to genome, and avoids possible risks brought by transgenosis;

3. the yield regulation gene has good regulation effect, and compared with the wild type, the plant grain length is increased, the number of grains per ear is increased, the rice yield can be obviously improved, and non-transgenic materials can be obtained. This is achieved by

4. The technology of the invention can improve the yield from a plurality of yield characters, and the number of main spike grains is increased; the tillering number is increased; the grain length is obviously increased, and the yield is improved from 1-3 yield traits in the prior art. For example, the rice yield can be improved only from the grain length, only from the grain width, or from the optimized fertilization mode, such as the improvement of the nitrogen utilization rate.

The present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.

Drawings

FIG. 1 is a phenotype of spikelets of CHXK1-1 obtained in the present invention, in which ZH11 represents wild type rice Zhonghua 11, and CHXK1-1 represents mutant OsHXK1 transgenic line;

FIG. 2 is a phenotype showing comparison of the number of tillering of CHXK1-1 obtained in the present invention, wherein ZH11 represents wild type rice Zhonghua 11, ZH11-CHK1-1, ZH11-CHK1-2 represent transgenic lines of Target-HXK1-U3 and Target-HXK1-U6 of OsHXK1 mutations, respectively;

FIG. 3 is a phenotype of statistics of the number of grains per ear of CHXK1-1 obtained in the present invention, wherein ZH11 represents wild type rice Zhonghua 11, ZH11-CHK1-1, ZH11-CHK1-2 represent the transgenic lines of Target-HXK1-U3 and Target-HXK1-U6 of mutant OsHXK1, respectively;

FIG. 4 shows the phenotype of grain length of CHXK1-1 obtained in the present invention, in which ZH11 represents wild type rice Zhonghua 11, ZH11-CHK1-1, ZH11-CHK1-2 represent the transgenic lines of Target-HXK1-U3 and Target-HXK1-U6 of mutant OsHXK1, respectively.

FIG. 5 is a statistics of the individual plant yields of CHXK1-1 obtained in the present invention, wherein ZH11 represents wild type rice Zhonghua 11, ZH11-CHK1-1 represents the transgenic lines of Target-HXK1-U3 and Target-HXK1-U6 of mutant OsHXK 1.

Detailed Description

The following experimental examples are further illustrative of the present invention and are not intended to limit the present invention. The following examples are given without specifying the particular experimental conditions and methods, and the technical means employed are generally conventional means well known to those skilled in the art.

Example 1 in japonica rice variety flower 11, a CRISPR/Cas9 system is used to mutate OsHXK1 to obtain a plant with improved yield, which comprises the following specific steps:

(1) designing a target sequence:

Target-HXK1-U3(SEQ ID NO.5)：GTGACGATGACGAGCCTCC

(2) construction of a pU3-gRNA vector containing Target-HXK 1-U3:

first, Target primer pair with cohesive ends, Target-HXK1-U3F (SEQ ID NO.6), was synthesized: GTTGGTGACGATGACGAGCCTCC, Target-HXK1-U3R (SEQ ID NO. 7): AAACGGAGGCTCGTCATCGTCAC, respectively; after the joint primer is denatured, the joint primer is moved to room temperature and cooled to finish annealing, and the annealed primer is linked to the digested pU3-gRNA vector; positive plasmids are verified by PCR amplification and sequencing;

(3) construction of pCRISPR/Cas9 vector containing Target-HXK1 fragment:

the expression cassette containing the Target-HXK1-U3 fragment is cut from the pU3-gRNA vector and then is connected to the pCRISPR/Cas9 vector containing the Cas9 expression cassette;

(4) obtaining of transgenic plants:

transforming the pCRISPR/Cas9 vector containing the target into the callus of the rice variety flower 11(ZH11) by an agrobacterium-mediated genetic transformation method; screening, differentiating, rooting and seedling growing, planting the transgenic plant in a net room, and identifying the positive transgenic plant by hygromycin;

(5) identification of mutation sites of transgenic plants:

extracting the genome DNA of the positive plant, and carrying out the extraction by using a primer C1F (SEQ ID NO. 3): ATGGCGGCGGCGGCGGTGGC and C1R (SEQ ID NO. 4): GAACCCAAGCTCCCTCTCGC amplifying the above genome DNA, purifying the product, sequencing, and comparing the sequencing result with the wild plant sequence before transgenosis, specifically referring to SEQ ID NO.8-SEQ ID NO. 14; analyzing the mutation condition;

WT(SEQ ID NO.8)：

GGTGGCGGCAGATCAGAAGGTGGTGACGATGACGAGCCTCCGGGAGGGCTGCGCTTGCGCGGCGCCTCC

CHXK1-1(SEQ ID NO.9)：

GGTGGCGGCAGATCAGAAGGTGGTGACGATGACGAG*CTCCGGGAGGGCTGCGCTTGCGCGGCGCCTCC

CHXK1-2(SEQ ID NO.10)：

GGTGGCGGCAGATCAGAAGGTGGTGACGATGACGAG*CTTCCGGGAGGGCTGCGCTTGCGCGGCGCCTCC

CHXK1-3(SEQ ID NO.11)：

GGTGGCGGCAGATCAGAAGGTGGCGA*GAGGGAGCTTGGGTTCGGAGGGCTGCGCTTGCGCGGCGCCTCC

CHXK1-4(SEQ ID NO.12)：

**********GATCAGAAGGTGGTGACGATGACGAGGCTCCGGGAGAGCTGCGCTTGCGCGGCGCCTCC

CHXK1-5(SEQ ID NO.13)：

GGTGGCGGCAGATCAGAAGGTGGTGACGATGACGAGCCA***************************CC

CHXK1-6(SEQ ID NO.14)：

GGTGGCGGCAGATCAGAAGGTGGTGACGATGACGAGCC****************************CC

wherein CHXK1-1, CHXK1-2, CHXK1-3, CHXK1-4, CHXK1-5 and CHXK1-6 represent different transgenic lines; WT means a wild type; in sequence "A”、“G"indicates a mutated base," indicates a base deletion; the deletion and mutation of the base indicate that the site-directed mutation is successful. As can be seen from the sequences of SEQ ID NO.9-SEQ ID NO.14, the transgenic plants of the invention all succeed in site-directed mutagenesis.

Example 2 mutation of OsHXK1 by using CRISPR/Cas9 system in flower 11 of japonica rice variety to obtain a plant with improved yield comprises the following specific steps:

the method comprises the following specific steps:

(1) designing a target sequence:

Target-HXK1-U6(SEQ ID NO.15)：ATCCCTCCCGGCCTCATGTC

(2) constructing a pU6-gRNA vector containing Target-HXK1-U6 fragment,

first, Target primer pair with cohesive ends, Target-HXK1-U6F (SEQ ID NO.16), was synthesized: GGCATCCCTCCCGGCCTCATGTC, Target-HXK1-U6R (SEQ ID NO. 17): AAACGACATGAGGCCGGGAGGGA, respectively; after the joint primer is denatured, the joint primer is moved to room temperature and cooled to finish annealing, and the annealed primer is linked to the digested pU6-gRNA vector; positive plasmids are verified by PCR amplification and sequencing;

(3) construction of pCRISPR/Cas9 vector containing Target-HXK1 fragment:

the expression cassette containing the Target-HXK1-U6 fragment is cut from the pU6-gRNA vector and then is connected to the pCRISPR/Cas9 vector containing the Cas9 expression cassette;

(4) obtaining of transgenic plants:

(5) identification of mutation sites of transgenic plants:

extracting the genome DNA of the positive plant, and carrying out the extraction by using a primer C1F (SEQ ID NO. 3): ATGGCGGCGGCGGCGGTGGC and C1R (SEQ ID NO. 4): GAACCCAAGCTCCCTCTCGC amplifying the above genome DNA, purifying the product, sending to company for sequencing, comparing the sequencing result with the wild plant sequence before transgenosis, specifically referring to SEQ ID NO.18-SEQ ID NO. 23; analyzing the mutation condition;

WT(SEQ ID NO.18)：

GTGGCGAGGGAGGTCCCGATCCCTCCCGGCCTCATGTCCGGCGGCGGCGCCACCTCGGAG

CHXK2-1(SEQ ID NO.19)：

GTGGCGAGGGAGGTCCCGATCCCTCCCGGC*****GTCCGGCGGCGGCGCCACCTCGGAG

CHXK2-2(SEQ ID NO.20)：

GTGGCGAGGGAGGTCCCGATACCTCCCGGCCTCGTGTGTCGCGATCC*GCGCCACCTCGGAG

CHXK2-3(SEQ ID NO.21)：

GTGGCGAGGGAGGTCCCGATCCCTCC*GGCCTC**GAC*GGCGGCGGCGCCACCTCGGAG

CHXK2-4(SEQ ID NO.22)：

GTGGCGAGGGAGGTCCCGATACCTCCCGGCCTCGTGTCCGGCGGCGGCGCCACCTCGGAG

CHXK2-5(SEQ ID NO.23)：

GTGGCGAGGGAGGTCCCGAAGCCTCC*GGCCTCATGTCCGGCGGCGGCGCCACCTCGGAG

wherein CHXK2-1, CHXK2-2, CHXK2-3, CHXK2-4 and CHXK2-5 represent different transgenic lines; WT means a wild type; in sequence "A”、“G"indicates a mutated base," indicates a base deletion; the deletion and mutation of the base indicate that the site-directed mutation is successful. As can be seen from the sequences of SEQ ID NO.19 to SEQ ID NO.23, the transgenic plants of the present invention all succeeded in site-directed mutagenesis.

As can be seen from examples 1 and 2, the target sequence involved in the present invention was able to successfully mutate the OsHXK1 gene regardless of whether the vector was constructed using pU3-gRNA or pU 6-gRNA.

Example 3 identification of the yield traits of transgenic plants obtained by mutation of OsHXK1 by using CRISPR/Cas9 system

The transgenic plants identified as positive by PCR are cultured to be mature, the plant morphology at different periods is observed, the result is shown in figure 1, and the obtained homozygous line transgenic plants show the phenotype that the grain number per spike is obviously increased. Compared with a control plant and a flower 11 in a japonica rice variety, the transformed plant has obvious changes in the following four yield traits: the number of main spike grains increases (see fig. 3); the breeding number is increased (see figure 2); increased grain length (see fig. 4); the yield of the individual plants was increased (see FIG. 5).

The rice with OsHXK1 mutation has multiple yield traits and can comprehensively improve the yield of the rice. Compared with wild rice without mutation OsHXK1, the main ear grain number is increased by 10-20%, and the tillering number is increased by 10-20%; the grain length is increased by 8 percent; the yield of the single plant is increased by 5 percent.

Rice yield depends on three factors, i.e., the number of ears per unit area, the number of grains per ear, and the grain weight. The grain size of the rice is a determinant factor of grain weight, the grain size is usually longer, and the grain can be heavier. The increase of the number of grains per ear can also significantly increase the yield of rice.

The above-described embodiments are merely preferred embodiments of the present invention, and it should be noted that, for those skilled in the art, several modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> method for obtaining plants with improved yield by using CRISPR/Cas9 system mutation OsHXK1

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 498

<212> PRT

<213> Rice (Oryza sativa L.)

<400> 1

Met Ala Ala Ala Ala Val Ala Ala Asp Gln Lys Val Val Thr Met Thr

1 5 10 15

Ser Leu Arg Glu Gly Cys Ala Cys Ala Ala Pro Pro Ala Ala Ala Ala

20 25 30

Pro Pro Met Pro Lys Met Ala Ala Ala Gln Arg Val Val Ala Glu Leu

35 40 45

Arg Glu Ala Cys Ala Thr Pro Ala Ala Arg Leu Ala Glu Val Ala Ala

50 55 60

Ala Met Ala Gly Glu Met Glu Ala Gly Leu Ala Val Glu Gly Gly Ser

65 70 75 80

Ser Glu Met Lys Met Ile Val Ser Tyr Val Asp Ser Leu Pro Thr Gly

85 90 95

Gly Glu Glu Gly Ser Tyr Tyr Ala Leu Asp Leu Gly Gly Thr Asn Phe

100 105 110

Arg Val Leu Arg Val Arg Leu Ala Gly Gly Gly Val Ala Glu Arg Val

115 120 125

Ala Arg Glu Val Pro Ile Pro Pro Gly Leu Met Ser Gly Gly Gly Ala

130 135 140

Thr Ser Glu Cys Leu Phe Gly Phe Ile Ala Ser Ala Leu Ala Glu Phe

145 150 155 160

Val Gly Glu Glu Glu Glu Glu Gly Gly Leu Asp Gly Gly Glu Arg Glu

165 170 175

Leu Gly Phe Thr Phe Ser Phe Pro Val His Gln Thr Ser Ile Ala Ser

180 185 190

Gly Thr Leu Ile Arg Trp Thr Lys Ala Phe Ala Val Asp Asp Ala Ile

195 200 205

Gly Glu Asp Val Val Ala Ala Leu Gln Ala Ala Met Ser Glu Arg Gly

210 215 220

Leu Asp Met Arg Val Ser Ala Leu Ile Asn Asp Thr Val Gly Thr Leu

225 230 235 240

Ala Ala Gly Ser Tyr Tyr Asp Glu Asp Val Val Ala Ala Val Ile Leu

245 250 255

Gly Thr Gly Thr Asn Ala Ala Tyr Val Glu Asp Ala Thr Ala Ile Ala

260 265 270

Lys Leu His Pro Ser Gln Leu Pro Ala Ser Asn Thr Met Val Ile Asn

275 280 285

Thr Glu Trp Gly Ser Phe Ala Ser Pro Cys Leu Pro Leu Thr Glu Phe

290 295 300

Asp Glu Ala Leu Asp Gln Glu Ser Leu Asn Pro Gly Glu Gln Thr Tyr

305 310 315 320

Glu Lys Leu Ile Ser Gly Met Tyr Leu Gly Glu Ile Val Arg Arg Val

325 330 335

Leu Leu Lys Ile Ser Ser Arg Cys Pro Ser Leu Leu Gly Gly Ala Gly

340 345 350

Glu Leu Ala Thr Pro Phe Val Leu Arg Thr Pro Asp Val Ser Ala Met

355 360 365

His His Asp Glu Thr Pro Asp Leu Ser Ile Val Gly Glu Lys Leu Glu

370 375 380

Arg Thr Leu Gly Ile Arg Gly Thr Ser Pro Glu Ala Arg Arg Met Val

385 390 395 400

Val Glu Val Cys Asp Ile Val Ala Thr Arg Ala Ala Arg Leu Ala Ala

405 410 415

Ala Gly Ile Val Gly Ile Leu Lys Lys Ile Gly Arg Val Asp Gly Gly

420 425 430

Glu Gly Arg Arg Arg Arg Ser Val Val Ala Val Asp Gly Gly Leu Phe

435 440 445

Glu His Tyr Gly Lys Phe Arg Arg Cys Met Glu Ser Ala Val Arg Glu

450 455 460

Leu Leu Gly Glu Ala Ala Ala Glu Arg Val Val Val Lys Leu Ala Ser

465 470 475 480

Asp Gly Ser Gly Leu Gly Ala Ala Leu Val Ala Ala Ala His Ser Gln

485 490 495

Arg Ala

<210> 2

<211> 1497

<212> DNA

<213> Rice (Oryza sativa L.)

<400> 2

atggcggcgg cggcggtggc ggcagatcag aaggtggtga cgatgacgag cctccgggag 60

ggctgcgctt gcgcggcgcc tcctgctgca gctgcgccgc cgatgccgaa gatggcggcg 120

gcgcagaggg tggtggcgga gctgagagaa gcgtgcgcga cgccggcggc gaggctggcg 180

gaggtggccg cggcgatggc cggcgagatg gaggccgggc tggcggtgga gggcggcagc 240

agcgagatga agatgatcgt gtcgtacgtc gacagcctcc ccaccggcgg cgaggagggg 300

tcgtactacg cgctcgacct cggcggcacc aacttccgcg tcctccgcgt gcggcttgcc 360

ggcggcggcg tcgccgagcg cgtggcgagg gaggtcccga tccctcccgg cctcatgtcc 420

ggcggcggcg ccacctcgga gtgcctcttc ggcttcatcg cctccgcgct agccgagttc 480

gtcggcgagg aggaagaaga aggcggcctc gacggcggcg agagggagct tgggttcacc 540

ttctccttcc ccgtgcacca aacctccatc gcgtcgggga cgctcatccg gtggacgaag 600

gcgttcgccg tcgacgacgc gatcggcgag gacgtcgtgg cggcgctgca ggcggccatg 660

tcggagcggg ggctcgacat gcgcgtgtcg gcgctcatca acgacaccgt cgggacgctc 720

gccgcgggca gctactacga cgaggacgtc gtggccgccg tcatcctcgg caccggcacg 780

aacgccgcct acgtcgagga cgccaccgcc atcgccaagc tacacccatc gcagctgcca 840

gcatcgaaca ccatggtgat caacaccgag tggggcagct tcgcctcgcc gtgcctccca 900

ttgacggagt tcgacgaagc actcgatcag gagagcctca accccggcga gcagacctac 960

gagaagctca tctccgggat gtacctcggc gagatcgtca ggagggtcct cctcaagatc 1020

tcctcccggt gcccctccct cctcggcggc gccggcgagc tcgcgacgcc gttcgtcctc 1080

aggacacccg acgtgtccgc gatgcaccac gacgagacgc ccgacctgag catcgtcggc 1140

gagaagctgg aacgcacgct gggcatccgc ggcacgtcgc cggaggcgag gaggatggtc 1200

gtcgaggtgt gcgacatcgt cgccacgagg gccgcccggc tggccgcggc ggggatcgtc 1260

gggatcctga agaagatcgg gagggtcgac ggcggcgagg ggcggaggag gaggtcggtg 1320

gtcgccgtgg acggcgggct gttcgagcac tacggcaagt tccggcggtg catggagagc 1380

gcggtgaggg agctgctcgg agaggcggcg gcggagaggg tggtcgtcaa gctcgccagc 1440

gacggctccg ggctcggcgc cgccctggtt gcagctgctc actcgcagag agcataa 1497

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcggcgg cggcggtggc 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaacccaagc tccctctcgc 20

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtgacgatga cgagcctcc 19

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gttggtgacg atgacgagcc tcc 23

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gttggtgacg atgacgagcc tcc 23

<210> 8

<211> 69

<212> DNA

<213> Rice (Oryza sativa L.)

<400> 8

ggtggcggca gatcagaagg tggtgacgat gacgagcctc cgggagggct gcgcttgcgc 60

ggcgcctcc 69

<210> 9

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggtggcggca gatcagaagg tggtgacgat gacgagctcc gggagggctg cgcttgcgcg 60

gcgcctcc 68

<210> 10

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ggtggcggca gatcagaagg tggtgacgat gacgagcttc cgggagggct gcgcttgcgc 60

ggcgcctcc 69

<210> 11

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggtggcggca gatcagaagg tggcgagagg gagcttgggt tcggagggct gcgcttgcgc 60

ggcgcctcc 69

<210> 12

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gatcagaagg tggtgacgat gacgaggctc cgggagagct gcgcttgcgc ggcgcctcc 59

<210> 13

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggtggcggca gatcagaagg tggtgacgat gacgagccac c 41

<210> 14

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggtggcggca gatcagaagg tggtgacgat gacgagcccc 40

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atccctcccg gcctcatgtc 20

<210> 16

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggcatccctc ccggcctcat gtc 23

<210> 17

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aaacgacatg aggccgggag gga 23

<210> 18

<211> 60

<212> DNA

<213> Rice (Oryza sativa L.)

<400> 18

gtggcgaggg aggtcccgat ccctcccggc ctcatgtccg gcggcggcgc cacctcggag 60

<210> 19

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gtggcgaggg aggtcccgat ccctcccggc gtccggcggc ggcgccacct cggag 55

<210> 20

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gtggcgaggg aggtcccgat acctcccggc ctcgtgtgtc gcgatccgcg ccacctcgga 60

g 61

<210> 21

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gtggcgaggg aggtcccgat ccctccggcc tcgacggcgg cggcgccacc tcggag 56

<210> 22

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gtggcgaggg aggtcccgat acctcccggc ctcgtgtccg gcggcggcgc cacctcggag 60

<210> 23

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gtggcgaggg aggtcccgaa gcctccggcc tcatgtccgg cggcggcgcc acctcggag 59

Claims

1. A method for improving rice yield is characterized in that OsHXK1 gene is mutated to reduce OsHXK1 protein expression quantity or block OsHXK1 protein generation;

designing a target sequence sgRNA sequence based on CRISPR/Cas9 aiming at the OsHXK1 gene, connecting a DNA fragment containing a coding sgRNA sequence to a vector carrying CRISPR/Cas9, transforming rice, and realizing the knockout of the OsHXK1 gene of the rice;

the target sequence is a nucleic acid sequence shown as SEQ ID NO. 5;

the OsHXK1 protein is an amino acid sequence shown in SEQ ID No. 1.

2. The method according to claim 1, wherein the OsHXK1 gene is the nucleic acid sequence as set forth in SEQ ID No. 2.

3. The method according to claim 1, characterized in that it comprises in particular the steps of:

(1) constructing an sgRNA vector containing a target sequence fragment;

in the step (1), firstly synthesizing a target primer pair with a sticky end, denaturing a joint primer, and then cooling to room temperature to finish annealing; linking the annealed primer to the sgRNA vector after enzyme digestion, and verifying positive plasmids through PCR amplification and sequencing;

(2) constructing a pCRISPR/Cas9 vector containing a target sequence fragment;

step (2) is to cut the sgRNA expression cassette containing the target site sequence fragment from the sgRNA vector and then connect the sgRNA expression cassette to a pCRISPR/Cas9 vector containing a Cas9 expression cassette;

(3) transformation;

step (3) transforming the pCRISPR/Cas9 vector containing the target into rice callus, screening, differentiating, rooting and seedling, and planting the transgenic plant in a net room; identifying the positive transgenic plant by hygromycin;

in the step (3), the pCRISPR/Cas9 vector is transformed to the rice callus by agrobacterium-mediated genetic transformation or gene gun method;

the method further comprises the following steps:

(4) identifying a mutation site;

in the step (4), the primers shown as SEQ ID No.3 and SEQ ID No.4 are adopted for identification.

4. The method according to claim 3, wherein in step (1), the vector for the sgRNA is pU3-gRNA and/or pU 6-gRNA.

5. The method according to claim 3, wherein in step (1), the target primer pair with sticky ends is a nucleic acid sequence as shown in SEQ ID No.6 and SEQ ID No. 7.