CN108676738A - One plant of production alkali protease Halophiles and its application - Google Patents

Abstract

The invention discloses a kind of ornithine bacillus of the thermophilic salt of moderateOrnithinibacillussp. LCB256, preserving number are KCTC 33862.Identify etc. that polyphase sorts means determine that the bacterial strain is new species through Physiology and biochemistry.The strain of the present invention has the enzymatic activitys such as oxidizing ferment, catalase, esterase (C4), leucine arylamine enzyme, naphthols AS BI phosphohydrolases, α glucuroides, β glucuroides, alkaline phosphatase, lipoid esterase (C8) and chymotrypsin, can be widely used in the associated production field of different kind organism engineering enzyme preparation.Meanwhile the strain can generate the alkali protease with greater activity under up to 10%NaCl salinity, can develop and applied to the related enzyme preparation industry for adapting to extreme hypersaline environment.Attached drawing is to observe recorded morphological feature under transmission electron microscope after negative staining for the strain.

Description

One plant of production alkali protease Halophiles and its application

Technical field

The present invention relates to microorganism fungus kind and its application fields, specifically, can produce basic protein the present invention relates to a kind of The ornithine bacillus of enzyme and its technical field of application.

Background technology

Alkali protease (Alkaline protease) refer to that one kind can be in pH value meta-alkalescence（Optimum pH is 9-11） The enzyme of aminosal peptide bond in range.Alkali protease is the industrial enzymes of a kind of great potential value, field of food, Leather industry, feed processing and detergent industry etc. have extensive utilization.All it is extracellular by the produced alkali protease of microorganism Enzyme, the needs for being more suitable for modern industrial process in contrast with plant and animal material have that of low cost, yield is big, raw Produce the advantages such as efficient, with short production cycle.

In the alkali protease producing strains having been found that, most of is bacillus, including clothing bacillus (Bacillus licheniformis), bacillus subtilis (Bacillus subtilis), bacillus amyloliquefaciens (Bacillus amyloliquefaciens), bacillus pumilus (Bacillus pumilus) and Bacillus alcalophilus （Bacillus basophilus）.Moreover, it has been found that part streptomycete such as streptomyces griseus (streptomyces griseus), Fei Shi streptomycetes (Streptomyces fradiae) etc. and certain sickle-like bacteria moulds, mould can also produce alkaline egg White enzyme.

Currently, Studies on Microbial Alkaline Protease is widely used in the industries such as washing, process hides, food, the market demand both at home and abroad The situation that supply falls short of demand is presented, therefore improving the basic protein production of enzyme of Research for Industrial Microbial Germ and vigor becomes developer and research The solution route of person.The mainly traditional physics of early stage research, chemokines are individually or compound mutation breeding improves production to reach The purpose of enzyme amount, enzyme activity and environmental resistance etc. with the fast development of biotechnology, utilizes gene since the last few years Engineering and protein engineering means achieve remarkable effect to carry out the stronger industrial microorganism directive breeding of purpose, and And further investigation is also expanded to enzymatic structure and enzymatic mechanism mechanism in the process.

After the 1980s, the research direction of Studies on Microbial Alkaline Protease is gradually to catalytic mechanism, gene structure, egg The structure of white matter and Structure and Function etc. are dressed.Most Studies on Microbial Alkaline Protease are because of its activated centre Be referred to as containing serine serine protease (Serine protease), Gu Dangqi encounters diisopropyl fluorophosphate (DFP) (DFP) Therewith serine chemical reaction can occur and inactivate.In addition, the required Mn of alkali protease²⁺ 、Mg²⁺ 、Zn²⁺、Co²⁺ 、Fe²⁺ The activation of equal metal ions just has enzyme activity.

It is exactly the presence of signal peptide by unique obvious characteristic that cytoplasmic protein and output albumen distinguish.It is sent out by studying It is existing, inBacillus amyloliquefaciens、B. subtilis、B. stearothermophilusThe neutrality of expression Protease withB. amyloliqufaciens、B. subtilis、B. 1icheniformisThe alkali protease of middle secretion The conserved sequence that signal peptide fragment has degree of homology very high.This kind of signal peptide conserved sequence is in positively charged N-terminal, thereafter tightly Then one section of hydrophobic residue, and then there is a consensus sequence cleavage site, i.e. Ala- ×-Ala, cutting in the polar areas C Point is normally at behind C-terminal Ala, the two Ala residues would generally be replaced by other short peptide chain amino acid residues, therein × Position also tends to preferentially select bulky amino acid residue.

Hypersaline environment is apparent for the toxic action of common micro-organisms, main cause be hyperosmosis stress under cell membrane It is destroyed with enzyme, and then inhibits the physiological activity of microorganism.And Halophiles forms and is metabolized tune with its special physiological structure Control mechanism can inhabit breeding in extreme environment with high salt.Salt of the Halophiles long term growth in higher concentrations such as salt lake, saline-alkali soil Under environment, along with spore process, unique bioactive substance synthesis or metabolic pathway, new regulatory mechanism are formd And with the relevant new gene of these Physiology and biochemistries, and then the biological active matter for adapting to extreme environment with high salt can be generated Matter.Therefore, alkali protease caused by Halophiles, have stronger casein hydrolysis ability, environment salt tolerant alkali ability and Higher temperature capacity and the deep concern by researchers, then more and more thermophilic saline alkali protease constantly studied And development and application.

Invention content

For the domestic and international present Research in relation to Studies on Microbial Alkaline Protease, the present invention provides a kind of new production basic protein Enzyme Halophiles.The production alkali protease Halophiles has oxidizing ferment, catalase, esterase (C₄), leucine arylamine enzyme, The enzymatic activitys such as beta-glucosidase, naphthols-AS-BI- phosphohydrolases and alkali protease, and with all effective publications The highest similitude of 16 S rRNA gene orders of related species is 97.93 %, this can be clearly distinguishable from its for disclosing report Its efficient bacterium.

The present invention provides the ornithine bacillus of one plant of thermophilic salt of moderateOrnithinibacillussp. LCB256。

The present invention divides using the Selective agar medium of high salt concentration as enrichment condition from the saline-alkali soil at Gansu Province Dunhuang Yumen Pass It is cultivated from purifying and obtains more plants of thermophilic salt salt-enduring strains, go out one plant of production alkali protease Halophiles, i.e. ornithine bud through multistage screening Spore bacillus LCB256 (Ornithinibacillussp. LCB256).The bacterial strain was preserved in Budapest item before the applying date About microorganism International Depository Authority：South Korea's Culture Collection (KCTC), preservation time are on November 28th, 2016, preservation Number it is KCTC 33862, the addresses KCTC are Taejon city, Korea scholar city South Korea's bioscience and biotechnology research institute, postcode are 305-806.The bacterium is Gram-positive, aerobic, motility bacillus.Oxidizing ferment and catalase are the positive.NaCl's is resistance to By ranging from 3-17 %（Best salinity is 10-15 %）, growth temperature range is 10-52 DEG C（Optimum growth temp is 25- 30 ℃）, pH growth scopes are 7.0-9.0（Optimum growh pH is 8.0）.Indoles generates experiment as the positive, but MR is tested, V-P is real It tests, H₂S is generated and nitrate reduction experiment is feminine gender.Energy gelatin hydrolysate, polysorbas20, polysorbate60 and Tween 80, cannot hydrolyze Starch, cellulose and urea.It can be utilized and having as sole carbon source：Dextrin, D-Maltose, D- trehaloses, D- fibers two Sugar, gentiobiose, sucrose, D- turanoses, lyxose, D- gossyposes, α-D- lactose, D- melibioses, β-formyl-D- glucosides, D- salicins, N- acetyl-d-glucosamine, N- acetyl-β-D-MANNOSE glycosides, N-acetyl-neuraminate, alpha-D-glucose, D- sweet dews Sugar, D-Fructose, 3- formyls glucose, L- rhamnoses, inosine, D-glucitol, PEARLITOL 25C, myo- inositols, glycerine, D- glucose -6- Phosphoric acid, D-Fructose -6- phosphoric acid, gelatin, glycyl-L-PROLINE, L-arginine, Pidolidone, L-Glutimic acid, L- ammonia Acid, pectin, D- galacturonic acids, L- galacturonics acid lactone, D- gluconic acids, D- glucuronic acids, glucuronamide, quininic acid, L- lactose, citric acid, L MALIC ACID, polysorbate40, acetoacetate and acetic acid, and N- acetyl-D-galactosamine, D- galactolipins, D- Fucose, L-fucose, D-arabitol, D-Asp, D-Ser, l-Alanine, L-Histidine, glactaric acid, D- saccharics Acid, p- Hydroxy-phenyl-acetic acids, methyl pyruvate, D-ALPHA-Hydroxypropionic acid methyl esters, α -one-glutaric acid, D-malic acid, bromo- succinic acid, γ-ammonia Base-butyric acid, Alpha-hydroxy-butyric acid, beta-hydroxy-D, L butyric acid, α -one-butyric acid, propionic acid and formic acid etc. cannot be then utilized as only One carbon source.

With reference to《Actinomyces systematics》With《Common bacteria system identification handbook》Standard method to the ornithine gemma bar BacteriumOrnithinibacillusSp.LCB256 completion morphologies feature, growth characteristics, physiological and biochemical property, polar lipid composition, Breathe the classification identification of indicator analysis such as quinone quinoid, fatty acid composition, whole cell peptidoglycan type and DNA (G+C) content.

The present invention is by extracting genomic DNA, and sample presentation is sequenced after PCR amplification 16S rRNA genes, then by its 16S rRNA The EzTaxon that gene order is uploaded to EzBioCloud carries out online BLAST comparisons analysis.According to analysis result, by 16S RRNA gene orders and the 16S rRNA gene orders of the associative mode bacterial strain closer with its homologous relationship are from EzTaxon's Database recalls, and recycles Clustal W to carry out Multiple Sequence Alignment, and by software MEGA5.2 with neighbouring connection method （Neighbor-Joining method, N-J）And maximum likelihood method（Maximum Likelihood method, ML）Its structure Phylogenetic tree is built to further determine that its classification position.

It is measured using Sanger methodsOrnithinibacillusThe 16S rRNA gene orders of sp.LCB256, the sequence of acquisition Row overall length is about 1525bp（GenBank accession number：KX008966）, based on the gene constructed phylogenetic tree analyses of 16S rRNA DisplayOrnithinibacillusSp.LCB256 withOrnithinibacillusThe associative mode strain of category flock together and It is in individually one.By the online BLAST of 16S rRNA gene orders compares analysis resultOrnithinibacillusSp.LCB256 and pattern bacteriumOrnithinibacillus contaminans CCUG 53201^T's Sequence similarity highest, highest similarity are 97.93 %.The amino acids characteristic of combination cell wall peptide glycan（Ornithine）, table The data such as type, Physiology and biochemistry and genotype are compared analysis, showOrnithinibacillusSp.LCB256 is ornithine A novel species for bacillus.

By implementing the particular technique index of the present invention, following desired effect can reach.

The ornithine bacillus of the present inventionOrnithinibacillusSp.LCB256 is that the aerobic leather of the thermophilic salt of moderate is blue Family name's positive bacteria.The strain has oxidizing ferment, catalase, esterase (C4), leucine arylamine enzyme, naphthols-AS-BI- phosphoric acid waters The enzymatic activitys such as enzyme, alpha-glucosidase, beta-glucosidase, alkaline phosphatase, lipoid esterase (C8) and chymotrypsin are solved, It can be widely used in the associated production field of different kind organism engineering enzyme preparation.Meanwhile the strain can be in up to 10 % NaCl The alkali protease with greater activity is generated under salinity, can be developed and applied to the relevant enzyme system for adapting to extreme hypersaline environment Agent industry.

Description of the drawings：Fig. 1 is the ornithine bacillus of the present inventionOrnithinibacillusSp.LCB256 is through negative staining Recorded morphological feature is observed under 25000 times of transmission electron microscope afterwards.

It names embodiment and illustrates the present invention, but the present invention is not limited to the following embodiments.

Specific implementation method

Embodiment one：OrnithinibacillusThe screening and separation of sp.LCB256

Salt affected soil picks up from Gansu Province Dunhuang Yumen Pass by this laboratory.The test tube equipped with 9 mL sterile waters is added in 1 g soil samples In, then vortex oscillation pipettes 1 mL suspensions to the test tube that 9 mL sterile waters are housed with liquid-transfering gun, is configured to 10 successively^-1~10^-6 The soil dilution suspension of multiple pipettes 100 μ L and is coated on screening and culturing medium tablet, is inverted at 37 DEG C and cultivates 72 h respectively Afterwards, the upgrowth situation and Morphological Features for observing bacterium colony are transferred to fresh LB+10 % (w/v) with sterile bamboo stick picking single bacterium colony NaCl (pH=8.0) solid medium carries out scribing line purifying, is cultivated under the same terms, picks out single bacterium colony and purify again, weight Multiple multiple, last picking single bacterium colony is forwarded to LB slant mediums, is placed in 4 DEG C of short term storages, while fresh cultured object being taken to be added 20 % (w/v) glycerine of sterilizing, is placed in -80 DEG C and makees long term storage.The single bacterium colony that number is LCB256 after purification is carried out more Phase taxonomic identification.Used medium formula is as follows：

Enrichment and screening and culturing medium：Weigh respectively 5 g casein peptones, 5 g peptones, 10 g yeast extracts, 3 g sodium citrates, 100 g NaCl、20 g MgSO₄•7H₂O, 1000 mL distilled water are added in 2 g KCl, adjust pH to 8.0, add 20 g fine jades After the dissolving of cosmetics agitating and heating, packing is placed in 20 min of high pressure steam sterilization at 121 DEG C.

Purifying and basal medium：10 g tryptones, 5 g yeast extracts, 100 g NaCl are weighed respectively, are added 1000 ML distilled water is stirred to dissolving, adjusts pH to 8.0, and after adding the dissolving of 20 g agar powder agitating and heatings, packing is placed in 121 20 min of high pressure steam sterilization at DEG C.

Strain describes：

Cell is Gram-positive, aerobic, motility bacillus.In 30 DEG C on the solid plate of LB+10 % (w/v) NaCl After cultivating 3 d, bacterium colony is opaque round, is in plum grey, surface is smooth and slightly protrusion, regular edges, single bacterium colony are straight Diameter about 1-2 mm.Cell size is 3.0-6.0 × 0.5-0.7 μm, and has peritrichous.Oxidizing ferment and catalase It is the positive.The tolerance range of NaCl is 3-17 %（Best salinity is 10-15 %）, growth temperature range is 10-52 DEG C （Optimum growth temp is 25-30 DEG C）, pH growth scopes are 7.0-9.0（Optimum growh pH is 8.0）.Indoles generates experiment The positive, but MR experiments, V-P experiments, H₂S is generated and nitrate reduction experiment is feminine gender.It can gelatin hydrolysate, polysorbas20, tween 60 and Tween 80, starch, cellulose and urea cannot be hydrolyzed.Whole cell peptidoglycan contains ornithine as amino acids characteristic (A4 β), the main methylnaphthoquinone of cell membrane are MK-7.The polar lipid of full cell is by cardiolipin (DPG), phosphatidyl glycerol (PG), the ammoniacum (AL) of a kind of phosphatide of unknown structure (PL) and two kinds of unknown structures forms, and main fatty acid is anteiso-C_{15 : 0}And iso-C_{15 : 0}.Genomic DNA (G+C) content is 39.3 mol%.

Embodiment two：OrnithinibacillusThe NaCl concentration tolerance range of sp.LCB256

The LB liquid that NaCl is 0 %, 3 %, 5 %, 7 %, 10 %, 12 %, 15 %, 17 % and 20 % (w/v) NaCl is prepared respectively Body culture medium (pH=8.0), each gradient setting three is parallel, and fresh seeds liquid is quantitatively inoculated in every test tube, is placed in 30 DEG C, 48 h of shaking table culture under 180 rpm, take out and measure its OD₆₀₀Value, so that it is determined that the tolerance range of its NaCl concentration and best Growth concentration.The result shows that：OrnithinibacillusThe NaCl concentration growth scope of sp.LCB256 is 3-17 %, most preferably NaCl concentration growth scope 10-15 %.

Embodiment three：OrnithinibacillusThe enzymatic property of sp.LCB256

Oxidizing ferment is tested：1 % (w/v) tetramethyl-p-phenylenylendiamine hydrochloride fresh reagents are directly added dropwise in exponential growth In the single bacterium colony of phase, if it shows purple in 10 s, for oxidase positive；Conversely, if 60 s or more change colour or are non-discolouring For oxidase negative.Sometimes bacterial strain oxidase active is weaker, then developing time slightly postpones.Catalase is tested：It will experiment Bacterial strain LB+10 % (w/v) NaCl solid medium culture to exponential phase of growth, a little thalline of picking is applied to culture dish, The hydrogenperoxide steam generator of 5 % is added dropwise, observation has bubble-free generation, is catalase sun as there are a large amount of bubble generations in 30 s Property；Conversely, aerogenesis bubble is not then negative catalase.Urase is tested：By experimental strain LB+10 % (w/v) NaCl's It is cultivated on culture medium flat plate the 3rd day and the 7th day and carries out urase measurement, specific method is：The the 3rd or 7 day bacterium is scraped with inoculation shovel Body is configured to dense bacteria suspension, and a drop phenol red indicator is added, adjusts pH to 7.0, is that bacteria suspension turns yellow in orange red just When, then by its portion be two, a copy of it be not added with urea be used as blank control, in addition portion the urea crystallized on a small quantity is then added Reaction, takes on a red color as experimental group becomes alkalinity in a few minutes, then is the urase positive；Conversely, non-discolouring person is feminine gender.Cellulose water Solution experiment：Prepare cellulose hydrolyzing culture medium (0.5 g/L MgSO₄, 0.5 g/L K₂HPO₄, 1 g/L KNO₃, 30 g/L NaCl, 1000mL H₂O, pH 7.2) it sterilizes after packing test tube, sterile filter paper one end is immersed in fluid nutrient medium, is connect Kind is on the filter paper item more than liquid level, and after 30 DEG C are cultivated 30 days, whether observation filter paper item is degraded.Starch Hydrolysis is tested：Match LB+10 % (w/v) NaCl+1 % (w/v) soluble starch solid medium processed, sterilize 20 min at 121 DEG C, will be real Bacterial strain streak inoculation is tested in Starch Hydrolysis tablet, after being inverted in 30 DEG C of cultures 3 days, is added dropwise in well-grown periphery of bacterial colonies suitable The iodine solution of amount, whether observation periphery of bacterial colonies generates water white transparency circle, if there is transparent circle, illustrates that starch is hydrolyzed, amylase is It is positive；Then it is feminine gender conversely, without transparent circle.OrnithinibacillusOther enzymatic properties of sp.LCB256 then use API ZYM systems complete detection according to user's service manual of regulation.Test result showsOrnithinibacillussp.LCB256 With following enzymatic activity：Oxidizing ferment, catalase, esterase (C4), leucine arylamine enzyme, naphthols-AS-BI- phosphohydrolases, Alpha-glucosidase, beta-glucosidase, alkaline phosphatase, lipoid esterase (C8) and chymotrypsin.

Example IV：OrnithinibacillusThe 16S rRNA genic system developmental analysis of sp.LCB256

It is extracted using enzymatic isolation methodOrnithinibacillusThe genomic DNA of sp.LCB256, its 16S rRNA base of PCR amplification Because of sequence, sample presentation completes sequencing in Shanghai life work after electrophoresis detection qualification, then is committed to 16S rRNA gene orders are obtained The GenBank of NCBI, while its 16S rRNA gene order is uploaded to the EzTaxon progress of EzBioCloud online BLAST compares analysis.By the 16S rRNA of 16S rRNA gene orders and the associative mode bacterial strain closer with its homologous relationship Gene order is recalled from the database of EzTaxon, and Clustal W is recycled to carry out sequence alignment, and by software MEGA5.2 with Neighbouring connection method（Neighbor-Joining method,N-J）And maximum likelihood method（Maximum Likelihood method,ML）Its phylogenetic tree construction.Primer, reaction system and condition used in PCR are as follows in detail：

Bacterial universal primers 27F: 5'-AGAGTTTGATCCTGGCTCAG-3', 1492R: 5'- TACGGCTACCTTGTTACGACTT；25 μ L reaction systems：1 μ L DNA profilings, 2.5 mM Mg²⁺, 2.5 μ L 27F, 2.5 μ L 1492R, 0.75 μ L dNTPs, 13 μ L ddH₂O, 0.25 μ L Taq DNA polymerase, 2.5 μ L Taq Buffer；Reaction condition is set as：94 DEG C of pre-degenerations 3 min, 95 DEG C of denaturation 30 s, 52 DEG C of 30 s of annealing；72 DEG C extend 1 45 s of min, recycle 35 times, finally again 72 DEG C heat preservation 10 min.

Embodiment five：OrnithinibacillusThe application of sp.LCB256

Prepare skim milk agar medium（1 % skim milks powder+10 % NaCl+1.8 % Agar, pH8.0）, 115 DEG C Sterilize 20 min, is cooled to thermophilic and is down flat plate；Experimental strain is configured to the bacteria suspension of multiple concentration gradients with sterile water, is crossed It is inoculated in plating medium, 30 DEG C is inverted in and cultivates one week, observes the growth of bacterium colony and its production of proteolysis circle on tablet daily Raw situation simultaneously records.Test result finds that periphery of bacterial colonies has apparent casein hydrolysis circle, showsOrnithinibacillusSp.LCB256 can secrete the alkali protease for adapting to extreme environment with high salt.

Embodiment six：OrnithinibacillusThe application of sp.LCB256

The culture medium of LB+10 % (w/v) NaCl+12 % (w/v) gelatin is prepared, the fresh training of experimental strain is taken after sterilizing is cooling It supports object to puncture, is placed in 30 DEG C and cultivates 2,7,10,14,30 days, taking-up is placed in observation growth and gelatin solution in 20 DEG C of room temperatures below Change situation, if gelatin only has part grumeleuse or all dissolving, as gelatin liquefaction positive；If gelatin surface is without recess and is still Stable grumeleuse, as gelatin hydrolysis are negative.Test observes that apparent dissolving is presented in gelatin, showsOrnithinibacillusSp.LCB256 can make gelatin liquefaction.

Embodiment seven：OrnithinibacillusThe application of sp.LCB256

Prepare+0.02 % CaCO of 5 % skimmed milk powers₃The milk of+10 % NaCl solidifies and peptonizes culture medium, 115 DEG C of sterilizings 20 Min is inoculated with after cooling, in 30 DEG C of stationary cultures 5,10,20,30 days, milk solidification is observed and recorded and the degree that peptonizes, if ox It is to solidify, and there is a phenomenon where be hydrolyzed into liquid then to peptonize for grumeleuse after solidifying that grumeleuse phenomenon, which occurs, in milk.Ox is observed in test Milk appearance significantly solidifies and peptonizes phenomenon, showsOrnithinibacillusSp.LCB256, which has, makes milk solidify and peptonize Ability.

Sequence table

<110>Gan Longzhan

Tian Yongqiang

Zhang Heming

<120>16 S rRNA gene orders

<141> 2017-11-13

<160> 1

<170> SIPOSequenceListing 1.0

<210> 2

<211> 3

<212> DNA

<213>Ornithine bacillus (Ornithinibacillus sp. LCB256)

<400> 2

Claims (2)

1. one plant of production alkali protease HalophilesOrnithinibacillusSp.LCB256, deposit number KCTC 33862。

2. the ornithine bacillus as described in right 1OrnithinibacillusSp.LCB256, it is characterized in that gram is positive Property, it is aerobic, it is in elongated rod shape, cell size is 3.0-6.0 × 0.5-0.7 μm, has peritrichous, and colony colour is plum ash Color has oxidizing ferment, catalase, esterase (C4), leucine arylamine enzyme, naphthols-AS-BI- phosphohydrolases, phlorose The enzymatic activitys such as glycosides enzyme, beta-glucosidase, alkaline phosphatase, lipoid esterase (C8), chymotrypsin and alkali protease, The tolerance range of NaCl is 3-17 %（Best salinity is 10-15 %）, growth temperature range is 10-52 DEG C（Optimum growh temperature Degree is 25-30 DEG C）, pH growth scopes are 7.0-9.0（Optimum growh pH is 8.0）, indoles generates experiment as the positive, but MR is real It tests, V-P is tested, H₂S is generated and nitrate reduction experiment is feminine gender, energy gelatin hydrolysate, polysorbas20, polysorbate60 and Tween 80, Starch, cellulose and urea cannot be hydrolyzed, whole cell peptidoglycan contains ornithine as amino acids characteristic (A4 β), cell membrane Main methylnaphthoquinone is MK-7, and the polar lipid of full cell is by cardiolipin (DPG), phosphatidyl glycerol (PG), Yi Zhongwei Know the phosphatide (PL) of structure and aminolipid (AL) composition of two kinds of unknown structures, main fatty acid anteiso-C_{15 : 0}With iso-C_{15 : 0}, genomic DNA (G+C) content is 39.3 mol%.