CN108676719B

CN108676719B - Method for preserving ralstonia solanacearum bacteriophage

Info

Publication number: CN108676719B
Application number: CN201810465069.XA
Authority: CN
Inventors: 林志坚; 蔡学清; 胡方平
Original assignee: Fujian Agriculture and Forestry University
Current assignee: Fujian Agriculture and Forestry University
Priority date: 2018-05-16
Filing date: 2018-05-16
Publication date: 2021-10-22
Anticipated expiration: 2038-05-16
Also published as: CN108676719A

Abstract

The invention discloses a method for preserving ralstonia solanacearum phage, and the nontoxic ralstonia solanacearum RSsw326-2 disclosed by the invention is preserved in China center for type culture collection with the preservation number of CCTCC NO: M2018197. The invention relates to a nontoxic ralstonia solanacearum which is obtained by separating ralstonia solanacearum from a naturally-diseased tobacco plant and carrying out subculture on the ralstonia solanacearum, the phage stock solution adopted in the proposal is uniformly mixed with an equal amount of ralstonia solanacearum, and glycerol with the final concentration of 40% is added for storage at the temperature of minus 75 ℃ for 12 months, so that the titer is reduced, the storage time of the ralstonia solanacearum phage is long, and higher activity can be kept.

Description

Method for preserving ralstonia solanacearum bacteriophage

Technical Field

The invention relates to the field of biotechnology and microbial products, in particular to a method for preserving ralstonia solanacearum bacteriophage.

Background

Phage (phase) is a virus that attacks bacteria and is also a genetic material that confers a biological trait to a host bacterium. The phenomenon of bacterial killing by phages was discovered in 1915 by Frederick tewatt (Frederick w.twort), and thus the use of phages to control bacteria has been studied for nearly a hundred years. The phage must be parasitic in live bacteria with strict host specificity, which depends on the molecular structure and complementarity of the phage to adsorb organ and receptor on the surface of the recipient bacterium. Bacteriophages are the most prevalent and widely distributed group of viruses. Usually in some locations full of bacterial flora, such as: phages can be found in soil and in the intestinal tracts of animals. With the development of molecular biology technology, bacteriophage has been widely used in many fields such as disease diagnosis, water treatment, etc. Phage also has become an important tool for molecular and genetic research due to its ability to insert genes into host DNA. Using phage, many elaborate experiments can be designed.

However, in the above processes, the phage strains are required to be preserved, and the existing preservation method of the plant pathogenic bacteria, especially the ralstonia solanacearum phage, has the disadvantages of much reduced titer, short preservation time and undesirable effect, and seriously restricts the development of the application of the phage.

Disclosure of Invention

The invention aims to provide a method for preserving ralstonia solanacearum phage.

In order to achieve the purpose, the invention adopts the following technical scheme:

the method for preserving the ralstonia solanacearum phage comprises the steps of mixing a filtered phage stock solution with the ralstonia solanacearum suspension in a volume ratio of 1:1, adding glycerol with the final concentration of 40%, and preserving at the low temperature of-75 ℃.

The concentration of the ralstonia solanacearum suspension is 10⁸ CFU /mL。

The ralstonia solanacearum strain is ralstonia solanacearumRalstonia solanacearium) RSsw326-2 is preserved in China Center for Type Culture Collection (CCTCC) in 2018, 4 months and 12 days, and the preservation number is M2018197. The address is Wuhan university.

The invention has the advantages that:

the invention mixes the filtered pseudomonas solanacearum phage stock solution with the same amount of pseudomonas solanacearum, adds the glycerol with the final concentration of 40 percent, and stores the mixture at the low temperature of-75 ℃ until the phage still keeps higher activity. The preservation method is reasonable and convenient to operate, does not need a special stabilizer, can be preserved for a long time, and is suitable for phage preservation in a common laboratory.

Drawings

FIG. 1 is a colony map of strain RSsw 326-2.

FIG. 2 plaque assay.

FIG. 3 PCR amplification chart of ralstonia solanacearum specific primers 759F/760R (M: Marker 2000;1: avirulent strain RSsw326-2;2: wild ralstonia solanacearum).

Detailed Description

Example 1

1. Acquisition of ralstonia solanacearum: separating tobacco plants with natural diseases by a dilution coating separation method, selecting a single colony, and purifying for 3-5 times to obtain wild ralstonia solanacearum.

2. Screening of avirulent strains: the method comprises the steps of continuously culturing wild ralstonia solanacearum separated from a naturally-occurring tobacco plant for more than 20 generations, selecting a colony with poor liquidity, carrying out pathogenicity determination, and obtaining a determination result that the strain loses pathogenicity to tobacco, namely a variant strain of ralstonia solanacearum, which is named as RSsw 326-2.

3. Pathogenicity determination:single colonies of the mutant strain obtained by subculture were selected and cultured in NB broth (28 ℃ C., 180 rpm) with shaking to a concentration of about 10⁸CFU/mL, adopting root irrigation to inoculate 5 tobacco seedlings with true leaves, and 30 days after inoculation treatment, the inoculated tobacco does not show symptoms as the same as the tobacco inoculated by clear water contrast, which indicates that the obtained variant strain loses the pathogenicity to the tobacco, namely the avirulent strain Laurella (L) (A.solani)Ralstonia solanacearium）RSsw326-2。

4. Performing PCR amplification on ralstonia solanacearum specific primers: extracting genome DNA of the avirulent strain, and performing PCR amplification by using a ralstonia solanacearum specific primer 759F/760R (GTCGCCGTCAACTCACTTTCC/GTCGCCGTCAGCAATGCGGAATCG) under the following amplification conditions: pre-denaturation at 95 deg.C for 5 min; denaturation at 95 ℃ for 30 s; annealing at 59 ℃ for 30 s; extending at 72 ℃ for 1 min; after extension at 72 ℃ for 10 min. As a result, a specific band of 280bp in size was obtained. See fig. 3.

5. The non-virulent strain RSsw326-2 utilizes 3 disaccharides and 3 hexanols: in basal medium (NH)₄H₂PO₄1g、KCl 0.2 g、MgSO₄·7H₂0.2 g of O, 1.0 g of peptone, 80 mg of phenol red, 3 g of agar, adjusting the pH value to 7.4, adding deionized water, fixing the volume to 1L), respectively adding lactose, maltose, cellobiose, mannitol, sorbitol and sweet alcohol which are subjected to filtration sterilization to enable the final concentration to be 1%, subpackaging test tubes, and inoculating a nontoxic strain suspension (the concentration is about 10%) according to the proportion of 1% in each tube, wherein the lactose, maltose, cellobiose, mannitol, sorbitol and sweet alcohol are respectively added to enable the final concentration to be 1%, and the tubes are subpackaged by 3mL⁸CFU/mL) was placed in a 28 ℃ incubator. The results show that the strain can utilize lactose, maltose, cellobiose, mannitol, sorbitol and sweet alcohol. See table 1.

TABLE 1 utilization of trisaccharide triol by avirulent Strain RSsw326-2

RSsw326-2 has round colony on TTC medium (see figure 1), dark red center, milky white edge and poor fluidity, and 3 disaccharides and 3 hexanols are utilized by strain and ralstonia solanacearum specific primer PCR amplification nodeIdentification of the fruit as Laurella solanacearum: (Ralstonia solanacearium）。

Example 2 avirulent strain host range assay:

the avirulent strain host range was determined using the drop method. The specific operation is as follows:

taking 1mL Log stage Laurella solanacearum (L.), (Ralstonia solanacearium) Adding the culture into a CPG semi-solid culture medium, uniformly mixing, pouring onto a prepared CPG solid agar plate, after solidification, dropwise adding 0.5 mu L of phage stock solution onto the surface of the plate, blow-drying, performing inverted culture at 28 ℃ overnight, and observing the formation condition of the phage plaques at 2 d. The results showed that this strain can be parasitized by the bacterial phage Ralstonia (FIG. 2).

Example 3

(1) Inoculating the strain RSsw326-2 on a CPG plate, inverting, and culturing at 28 ℃ for 24-48h to grow a single colony.

(2) Single colonies of the strain RSsw326-2 were picked up in Erlenmeyer flasks containing 100mL NB medium, and cultured at 28 ℃ with shaking at 180rpm to a concentration of about 10⁸cfu/ml。

(3) Adding 1mL of phage stock solution, mixing, standing for 15min, culturing at 28 deg.C and 130rpm overnight with shaking to completely lyse bacteria.

(4) Centrifuging the co-culture solution at 12000rpm for 5min, and filtering the supernatant with 0.45 μm filter membrane to obtain phage stock solution.

(5) Taking the cultured phage stock solution, measuring the titer of the phage stock solution and recording the phage stock solution for later use.

(6) Titer-determined phage stock (2.29 x 10)¹⁰PFU/mL) was treated as follows: firstly, preserving stock solution at room temperature; ② preserving the stock solution at 4 ℃; ③ preserving the stock solution at-20 ℃; fourthly, preserving the stock solution at-75 ℃; fifthly, uniformly mixing the phage stock solution with the same amount of ralstonia solanacearum, adding glycerol with the final concentration of 40% and preserving at-75 ℃;

(7) the titer was determined at 3 months, 6 months, 9 months and 12 months after storage, respectively.

The experimental results are shown in table 2, the survival time and survival condition of the phage are different by different preservation methods, the phage stock solution is preserved for 3 months at normal temperature, and the phage cannot be detected; macrophageThe thallus stock solution is stored for 12 months at 4 ℃, and the titer is reduced by 5 orders of magnitude; the phage stock solution is stored for 12 months at-20 ℃ and 75 ℃, and the titer is reduced by 1 order of magnitude; and phage stock solution with equal amount of 10⁸CFU/mL strain RSsw326-2 is mixed evenly, and glycerol with the final concentration of 40% is added to be stored at the temperature of minus 75 ℃ for 12 months, the titer is in the same order of magnitude, namely the reduction is less, so that the storage method has long storage time on the bacteriophage and can keep higher activity.

TABLE 2 potency assay for Ralstonia solanacearum phages with different storage modes

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fujian agriculture and forestry university

<120> method for preserving ralstonia solanacearum phage

<130> 2

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<400> 1

gtcgccgtca actcactttc c 21

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence

<400> 2

gtcgccgtca gcaatgcgga atcg 24

Claims

1. A method for preserving ralstonia solanacearum phage is characterized in that: the filtered phage stock solution and the ralstonia solanacearum suspension are mixed in a volume ratio of 1:1Mixing, adding 40% glycerol, and storing at-75 deg.C; the concentration of the ralstonia solanacearum suspension is 10⁸CFU/mL; the ralstonia solanacearum is Laurella solanacearum (L.)Ralstonia solanacearium) RSsw326-2 is preserved in China Center for Type Culture Collection (CCTCC) in 2018, 4 months and 12 days, and the preservation number is M2018197.