CN108660246A - One group of horse family's shaddock InDel molecular labeling and its application in Citrus Cultivars seedling early stage distinguishes tertia horse man shaddock - Google Patents
One group of horse family's shaddock InDel molecular labeling and its application in Citrus Cultivars seedling early stage distinguishes tertia horse man shaddock Download PDFInfo
- Publication number
- CN108660246A CN108660246A CN201810491165.1A CN201810491165A CN108660246A CN 108660246 A CN108660246 A CN 108660246A CN 201810491165 A CN201810491165 A CN 201810491165A CN 108660246 A CN108660246 A CN 108660246A
- Authority
- CN
- China
- Prior art keywords
- shaddock
- horse
- tertia
- primer pair
- man
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Application the present invention provides one group of horse family's shaddock InDel molecular labeling and its in Citrus Cultivars seedling early stage distinguishes tertia horse man shaddock, belongs to genetic breeding field.Horse man shaddock InDel molecular labelings include the segment expanded by primer pair chr2.10 9584F/chr2.10 9584R and the segment that is expanded by primer pair p chr6.21 8689F/p chr6.21 8689R.Molecular labeling provided by the invention provides new molecular tool for the horse family's shaddock seedling and early screening for differentiating, breeding inheritance stability.Can be in the tertia horse shaddock during seedling early stage distinguishes Citrus Cultivars using InDel molecular labelings provided by the invention, the risk control in identification and the shaddock production of horse man to Citrus Cultivars is of great significance.
Description
Technical field
The invention belongs to genetic breeding fields, and in particular to a kind of horse family's shaddock InDel molecular labelings and its in Citrus Cultivars
Seedling early stage distinguishes the application in tertia horse man shaddock.
Background technology
Shaddock (Citrus grandis) is Rutaceae citrus fruit, there is long cultivation history in China.Shaddock is for I
Lucky fruit in state's traditional culture, is usually used in the activities such as wedding celebration, sacrifice.South China resident likes planting shaddock behind the house in front of the door
Son, for these situations mostly by Seedling propagation, cultivated since long forms abundant local varieties and strain in the process.But it is right at present
The genetic background of these shaddocks and source do not know often there is the case where synonym or homonym.Jiangxi Province Guangfeng County
And its surrounding area has the tradition of plantation shaddock, every household Around the house to have plantation.Jiangxi Province's shaddock class resource investigation in 1991
In be found that the features such as horse man shaddock, horse man shaddock have fruit type big, and pulp is red, and crushing juice rate is high, sour and sweet palatability, it is deep by consumers in general
Like.Horse man shaddock pulp is rich in lycopene, carotenoid, mineral element etc..
But with horse family's development of shaddock industry and going deep into for investigation, find horse man shaddock Morphologic Characters difference
It is very big, less stable, and horse man shaddock is divided into tertia fruit (peracid type) and thin follicarpium in production upper people (acidity is medium)
Two major classes, thin follicarpium is better than tertia fruit in flavor and taste, but is difficult to be distinguished with morphology in appearance in Seedling Stage, especially
It is during current horse man shaddock seedling breeding, tertia and thin skin type are usually easy to mix, and seedling factory has no idea to distinguish, and gives horse
Family's shaddock industry brings risk.If horse man shaddock starts after generally taking 4-5 as a result, finding that seedling is impure, has resulted in very after 5 years
Big loss, also brings problem for orchard management.
Invention content
In view of above-mentioned technical problem, the present invention provides one group of horse family's shaddock InDel molecular labeling and its in Citrus Cultivars kind
Seedling early stage distinguishes the application in tertia horse man shaddock.
The present invention provides one group of tertia horse man shaddock InDel molecular labelings, including by primer pair chr2.10-9584F/
Chr2.10-9584R expands the segment that tertia horse man shaddock genomic DNA obtains and by primer pair p-chr6.21-8689F/p-
The segment that chr6.21-8689R amplification tertia horses man shaddock genomic DNA obtains；
The nucleotide sequence 5 ' -3 ' of the primer pair chr2.10-9584F/chr2.10-9584R is respectively：
chr2.10-9584F：AGTGAAAGGGAGAGAAAGAAGC；
chr2.10-9584R：ATGGTGCCACATTGCGAGT；
The nucleotide sequence 5 ' -3 ' of the primer pair p-chr6.21-8689F/p-chr6.21-8689R is respectively：
p-chr6.21-8689F：GGGAGGGAGCTTGCTTGATT；
p-chr6.21-8689R：ACCCGATAAAGTCACGTACACA.
The present invention provides a kind of kits for distinguishing tertia horse man shaddock, including primer pair chr2.10-9584F/
Chr2.10-9584R and primer pair p-chr6.21-8689F/p-chr6.21-8689R.
The present invention also provides above-mentioned molecular labelings or kit in distinguishing tertia horse family shaddock and other kind citruses
Using other described kind citruses include in thin skin horse man You, Guanxi small stream honey shaddock, the local native shaddock of shatian pomelo or Jiangxi Province Guangfeng County
Any one or more.
Preferably, the application includes the following steps：
(1) genomic DNA of detected materials is extracted；
(2) respectively with primer pair chr2.10-9584F/chr2.10-9584R and primer pair p-chr6.21-8689F/p-
Chr6.21-8689R carries out PCR amplification to the genomic DNA of the detected materials, obtains two groups of amplified productions；
(3) two groups of amplified productions are obtained into electrophoretogram respectively into row agarose gel electrophoresis；
(4) judged according to the electrophoretogram：If the amplification of the primer pair chr2.10-9584F/chr2.10-9584R
There are a bright band, and the amplified production of the primer pair p-chr6.21-8689F/p-chr6.21-8689R in product electrophoretogram
There are two bright bands in electrophoretogram, then judges detected materials for tertia horse man shaddock.
Preferably, the reaction system of the PCR amplification is：The Mix liquid of 7 μ l, the forward primer of the 10mmol/L of 0.3 μ l,
The reverse primer of the 10mmol/L of 0.3 μ l, the ddH of the 100ng/ul template DNAs of 1.5 μ l and 6 μ l2O。
Preferably, the step of PCR amplification is：95 DEG C, 5min；35 cycles：94 DEG C, 30s, 55 DEG C, 30s, 72
DEG C, 35s；72 DEG C, 10min.
Preferably, the agarose gel electrophoresis uses the Ago-Gel of 2.0%~4.0% mass percent, voltage
100~150V, 10~30min of electrophoresis.
Advantageous effect：
The present invention provides one group of tertia horse man shaddock InDel molecular labelings, including by primer pair chr2.10-9584F/
Chr2.10-9584R expands the segment that tertia horse man shaddock genomic DNA obtains and by primer pair p-chr6.21-8689F/p-
The segment that chr6.21-8689R amplification tertia horses man shaddock genomic DNA obtains.The primer pair chr2.10-9584F/
Chr2.10-9584R carries out PCR amplification using tertia horse family's shaddock material Huo Guanxi small streams honey shaddock materials as template, and amplified production is through agarose
A bright band can be obtained in gel electrophoresis；The primer pair chr2.10-9584F/chr2.10-9584R is with other Citrus Cultivars materials
Material is that template carries out PCR amplification, and two bright bands can be obtained through agarose gel electrophoresis in amplified production；Utilize the primer pair
Chr2.10-9584F/chr2.10-9584R can distinguish tertia horse family shaddock and thin skin horse man shaddock in horse man shaddock kind, also may be used
To distinguish other Citrus Cultivars of tertia horse family shaddock Yu in addition to Guanxi small stream honey shaddocks.The primer pair p-chr6.21-8689F/p-
Chr6.21-8689R carries out PCR amplification by template of tertia horse family's shaddock material, and amplified production is available through agarose gel electrophoresis
Two bright bands；The primer pair p-chr6.21-8689F/p-chr6.21-8689R is carried out by template of Guanxi small streams honey shaddock material
A bright band can be obtained through agarose gel electrophoresis in PCR amplification, amplified production.Utilize the primer p-chr6.21-8689F/
P-chr6.21-8689R can distinguish tertia horse man You He Guanxi small stream honey shaddocks.
Primer pair chr2.10-9584F/chr2.10-9584R and primer pair p-chr6.21-8689F/ of the present invention
P-chr6.21-8689R is applied in combination, and can distinguish tertia horse family shaddock and other Citrus Cultivars.With this group of molecule marked differential
Horse family's shaddock major clique and large cultivation shaddock, can overcome the shortcomings that being selected by phenotype in traditional breeding method, reduce breeding
Workload, accelerates the process for cultivating pure major clique, and seedling guarantee is provided for industry development.
Horse man provided by the invention shaddock InDel molecular labelings can accurately filter out slightly from the kind of genetic background complexity
Skin horse man shaddock, and its application can assist variety selection that can exclude non-equipotential not by environmental influence in any growth period
Gene interaction and caused by interfere, have many advantages, such as that quick, economy, efficiency, accuracy are strong；Especially in Citrus Cultivars seedling
When early stage is difficult to distinguish kind by character, tertia Ma Jia can be assisted using horse provided by the invention man shaddock InDel molecular labelings
The differentiation of shaddock kind.
Description of the drawings
Fig. 1 is the testing result electrophoretogram of scheme described in the embodiment of the present invention 1, wherein 1 represents tertia horse man shaddock, 2 represent
Thin skin horse family shaddock (major clique), 3 represent the local native shaddock in Jiangxi Province Guangfeng County, and 4 Dai Biao Guanxi small stream honey shaddocks, 5 represent shatian pomelo, and M is represented
Marker；
Fig. 2 is the testing result electrophoretogram of scheme described in the embodiment of the present invention 2, wherein 1 represents tertia horse man shaddock, 2 represent
Guanxi small stream honey shaddocks, M represent Marker；
Fig. 3 is the testing result electrophoresis result of scheme described in the embodiment of the present invention 3, and wherein C represents tertia horse man shaddock, X generations
The thin skin horse man shaddock of table, 1-80 represent the seedling number selected at random in nursery；
Fig. 4 is the testing result electrophoresis result of scheme described in the embodiment of the present invention 4, and wherein C represents tertia horse man shaddock, G generations
Biao Guanxi small stream honey shaddocks, 1-38 represent the seedling number selected at random in nursery.
Specific implementation mode
The present invention provides one group of tertia horse man shaddock InDel molecular labelings, and the InDel molecular labelings include by primer pair
Chr2.10-9584F/chr2.10-9584R expands the segment that tertia horse man shaddock genomic DNA obtains and by primer pair p-
The segment that chr6.21-8689F/p-chr6.21-8689R amplification tertia horses man shaddock genomic DNA obtains.
In the present invention, the primer pair for expanding InDel labels designs by the following method obtains：(1)
Horse man shaddock DNA is sequenced using both-end sequencing approach (Pair-end Sequencing)；(2) use SamTools and
Obtained insertion/deletion site (InDel) information of GATK software verifications；(3) existed with 5.0 softwares of Primer Premier
The sites InDel both sides design primer, primer length are more than 20bp, and Tm is 50~60 DEG C；G/C content is 50%~60%；PCR is produced
Object size is between 150bp-500bp.Primer length is using 25bp as optimal selection.Tm is with 55 DEG C for optimal selection.
In the present invention, the nucleotide sequence 5 ' -3 ' of the primer pair chr2.10-9584F/chr2.10-9584R point
It is not：
chr2.10-9584F：agtgaaagggagagaaagaagc(SEQ ID NO:1)；
chr2.10-9584R：atggtgccacattgcgagt(SEQ ID NO:2).
In the present invention, the primer pair chr2.10-9584F/chr2.10-9584R is with tertia horse family shaddock material Huo Guanxi
When small stream honey shaddock material is that template carries out PCR amplification, a bright band can be obtained through agarose gel electrophoresis in amplified production；The primer
When carrying out PCR amplification as template using other Citrus Cultivars materials to chr2.10-9584F/chr2.10-9584R, amplified production warp
Two bright bands can be obtained in agarose gel electrophoresis.It can be with area using the primer pair chr2.10-9584F/chr2.10-9584R
Tertia horse family shaddock in point horse man shaddock kind and thin skin horse man shaddock can also distinguish its in addition to Guanxi small stream honey shaddocks of tertia horse family shaddock Yu
His Citrus Cultivars.
In the present invention, the nucleotide sequence 5 ' -3 ' of the primer pair p-chr6.21-8689F/p-chr6.21-8689R
Respectively：
chr6.21-8689F：gggagggagcttgcttgatt(SEQ ID NO:3)；
chr6.21-8689R：acccgataaagtcacgtacaca(SEQ ID NO:4).
In the present invention, the primer pair p-chr6.21-8689F/p-chr6.21-8689R is with tertia horse man shaddock material
When carrying out PCR amplification for template, two bright bands can be obtained through agarose gel electrophoresis in amplified production；The primer pair p-
When chr6.21-8689F/p-chr6.21-8689R carries out PCR amplification using Guanxi small stream honey shaddocks or thin skin horse family's shaddock material as template, expand
A bright band can be obtained through agarose gel electrophoresis in volume increase object.Utilize the primer p-chr6.21-8689F/p-chr6.21-
8689R can distinguish tertia horse man You He Guanxi small stream honey shaddocks.
In the present invention, the source of two groups of primer pairs does not have any restrictions, commission sequent synthesis company.In the present invention
In embodiment, two groups of primers entrust Beijing Qing Ke Bioisystech Co., Ltd to synthesize.
The present invention provides a kind of kits for distinguishing tertia horse man shaddock, including primer pair chr2.10-9584F/
Chr2.10-9584R and primer pair p-chr6.21-8689F/p-chr6.21-8689R.
The present invention also provides above-mentioned molecular labelings or kit in distinguishing tertia horse family shaddock and other kind citruses
Using.
In the present invention, other described kind citruses include thin skin horse man You, Guanxi small stream honey shaddock, shatian pomelo or Jiangxi Province Guangfeng
Any one or more in the local native shaddock in county.
In the present invention, application of the molecular labeling in Citrus Cultivars seedling early stage distinguishes tertia horse man shaddock is preferably wrapped
Include following steps：
(1) genomic DNA of detected materials is extracted；
(2) respectively with primer pair chr2.10-9584F/chr2.10-9584R and primer pair p-chr6.21-8689F/p-
Chr6.21-8689R carries out PCR amplification to the genomic DNA of detected materials, obtains two groups of amplified productions；
(3) two groups of amplified productions are obtained into electrophoretogram respectively into row agarose gel electrophoresis；
(4) judged according to the electrophoretogram：If the amplification of the primer pair chr2.10-9584F/chr2.10-9584R
There is a bright band in product electrophoretogram, meanwhile, the amplification of the primer pair p-chr6.21-8689F/p-chr6.21-8689R
There are two bright bands in product electrophoretogram, then judges detected materials for tertia horse man shaddock.
The present invention extracts the genomic DNA of detected materials.In the present invention, the detected materials preferably are difficult to pass through table
Type feature judges the seedling earlier blade of kind.After obtaining detected materials, the present invention extracts the genome of the detected materials
DNA.The present invention is not particularly limited the method for extracting the genomic DNA of detected materials, and this field routinely prepares genomic DNA
Method.
After obtaining the genomic DNA of detected materials, the present invention is using the genomic DNA of the detected materials as template, respectively
With p-chr6.21-8689F/p-chr6.21-8689R pairs of primer pair chr2.10-9584F/chr2.10-9584R and primer pair
The genomic DNA of detected materials carries out PCR amplification, obtains two groups of amplified productions.The present invention is to specific PCR amplification system and side
Method is not particularly limited, using this field standard PCR amplification method.In an embodiment of the present invention, the PCR amplification
Reaction system be 7 μ l Mix liquid, the forward primer of the 10mmol/L of 0.3 μ l, the reverse primer of the 10mmol/L of 0.3 μ l, 1.5
The ddH of the 100ng/ul template DNAs of μ l and 6 μ l2O.The Mix be Nanjing Vazyme Biotechnology Co., Ltd. provide 2 ×
Taq Plus Master Mix(Dye Plus)；The water is preferably the ultra-pure water to sterilize.The response procedures of the PCR amplification
For：95 DEG C, 5min；35 cycles：94 DEG C, 30s, 55 DEG C, 30s, 72 DEG C, 35s；72 DEG C, 10min.
After pcr amplification reaction, the present invention preserves after preferably cooling down amplified production.The temperature of the cooling is preferably
The time of 10~15 DEG C, more preferably 12 DEG C, the cooling is preferably 25~40min, more preferably 30min, the preservation
Temperature is preferably 2~8 DEG C, more preferably 4 DEG C.The present invention is not particularly limited specific PCR reactions with instrument, using ability
Domain conventional equipment.In an embodiment of the present invention, the PCR reaction units are PTC-200PCR instrument (MJ.Research
Inc., USA).
After obtaining two groups of amplified productions, the present invention respectively into row agarose gel electrophoresis, obtains two groups of amplified productions
To electrophoretogram.The present invention is not particularly limited the method for specific electrophoresis, this field conventional electrophoretic method.In the present invention
Embodiment in, the electrophoresis is specially：By amplified production, agarose gel electrophoresis detects on Horizontal electrophoresis tank, the electrophoresis
Using the Ago-Gel of 2.0%~4.0% mass percent, preferably 3.0% Ago-Gel；The voltage of the electrophoresis
For 100~150V, preferably 120V；The time of the electrophoresis is 10~30min, preferably 20min.Electrophoresis of the present invention
Buffer solution uses 1 × TAE buffer solutions (0.04M Tris-acetate, 0.001M EDTA, pH8.0).Electrophoresis finishes, the present invention
It takes pictures preservation it is preferable to use gel imaging system (UVP).
The present invention judges whether detected materials are tertia horse man shaddock according to electrophoresis result：If the primer pair chr2.10-
9584F/chr2.10-9584R amplified production electrophoretogram in have a bright band, and the primer pair p-chr6.21-8689F/
There are two bright bands in the amplified production electrophoretogram of p-chr6.21-8689R, then judges detected materials for tertia horse man shaddock.
Primer pair chr2.10-9584F/chr2.10-9584R and primer pair p-chr6.21-8689F/ of the present invention
P-chr6.21-8689R is applied in combination, and tertia horse man shaddock can be distinguished from Citrus Cultivars.Utilize InDel provided by the invention
Molecular labeling can be in the tertia horse shaddock during seedling early stage distinguishes Citrus Cultivars, the breeding to Citrus Cultivars and the shaddock life of horse man
Risk control in production is of great significance.In addition, molecular labeling provided by the invention is the Ma Jia for differentiating, breeding inheritance stability
Shaddock seedling and early screening provide new molecular tool.
With reference to embodiment, to one group of horse provided by the invention family's shaddock InDel molecular labelings and its in Citrus Cultivars kind
The application that seedling early stage is distinguished in tertia horse man shaddock is clearly and completely described.Based on the embodiments of the present invention, this field is general
All other embodiment that logical technical staff is obtained without making creative work belongs to what the present invention protected
Range
Embodiment 1
(1) thin skin horse family shaddock (major clique), tertia horse man You, Guanxi small stream honey shaddock, Shatian are prepared using the CTAB methods extraction of improvement
The genomic DNA of the local native shaddock of shaddock and Jiangxi Province Guangfeng County.
(2) genome of the above-mentioned all citruses of primer pair chr2.10-9584F/chr2.10-9584R Amplification Analysis is utilized
DNA.It is carried out amplification reaction in PTC -200PCR instrument (MJ.Research Inc., USA).The reaction system of PCR amplification is 7 μ l
Mix liquid, the forward primer of the 10mmol/L of 0.3 μ l, the reverse primer of the 10mmol/L of 0.3 μ l, the 100ng/ul of 1.5 μ l
The ddH of template DNA and 6 μ l2O.The specific steps are：95 DEG C of denaturation 5min；Followed by 35 cycles：94 DEG C, 30s, 55 DEG C, 30s,
72 DEG C, 35s；Last 72 DEG C, 10min, 12 DEG C, 30min, 4 DEG C preservations.
(3) by amplified production, 3.0% agarose gel electrophoresis detects on Horizontal electrophoresis tank, uses 1 × TAE buffer solutions
(0.04M Tris-acetate, 0.001M EDTA, pH8.0), voltage 120V, electrophoresis 20min.Electrophoresis finishes, gel imaging system
System (UVP) is taken pictures preservation.
Testing result is shown in Fig. 1：Amplified production is single bright band in the genomic DNA of tertia horse man shaddock.Chu Guanxi small stream honey
Without purpose band identical with this banding pattern in his Citrus Cultivars outside shaddock.
Embodiment 2
(1) genomic DNA of tertia horse man You He Guanxi small stream honey shaddocks is prepared using the CTAB method extractions of improvement.
(2) base of the above-mentioned all citruses of primer pair p-chr6.21-8689F/p-chr6.21-8689R Amplification Analysis is utilized
Because of a group DNA.It is carried out amplification reaction in PTC -200PCR instrument (MJ.Research Inc., USA).The reaction system of PCR amplification
For the Mix liquid of 7 μ l, the forward primer of the 10mmol/L of 0.3 μ l, the reverse primer of the 10mmol/L of 0.3 μ l, 1.5 μ l's
The ddH of 100ng/ul template DNAs and 6 μ l2O.The specific steps are：95 DEG C of denaturation 5min；Followed by 35 cycles：94 DEG C, 30s,
55 DEG C, 30s, 72 DEG C, 35s；Last 72 DEG C, 10min, 12 DEG C, 30min, 4 DEG C preservations.
(3) by amplified production, 3.0% agarose gel electrophoresis detects on Horizontal electrophoresis tank, uses 1 × TAE buffer solutions
(0.04M Tris-acetate, 0.001M EDTA, pH8.0), voltage 120V, electrophoresis 20min.Electrophoresis finishes, gel imaging system
System (UVP) is taken pictures preservation.
Testing result is shown in Fig. 2：Amplified production is two bright bands in the genomic DNA of tertia horse man shaddock.Er Guanxi small stream honey shaddocks
Genomic DNA in amplified production be a bright band.
Embodiment 3
(1) 80 seedling plants random from thin skin horse man shaddock (major clique) nursery for being mixed with tertia horse man shaddock are detection material
Material prepares the genomic DNA of above-mentioned detection material using the CTAB methods extraction of improvement.
(2) base of the above-mentioned all citruses of primer pair p-chr6.21-8689F/p-chr6.21-8689R Amplification Analysis is utilized
Because of a group DNA.It is carried out amplification reaction in PTC -200 PCR instruments (MJ.Research Inc., USA).The reaction system of PCR amplification
For the Mix liquid of 7 μ l, the forward primer of the 10mmol/L of 0.3 μ l, the reverse primer of the 10mmol/L of 0.3 μ l, 1.5 μ l's
The ddH of 100ng/ul template DNAs and 6 μ l2O.The specific steps are：95 DEG C of denaturation 5min；Followed by 35 cycles：94 DEG C, 30s,
55 DEG C, 30s, 72 DEG C, 35s；Last 72 DEG C, 10min, 12 DEG C, 30min, 4 DEG C preservations.
(3) by amplified production, 3.0% agarose gel electrophoresis detects on Horizontal electrophoresis tank, uses 1 × TAE buffer solutions
(0.04M Tris-acetate, 0.001M EDTA, pH8.0), voltage 120V, electrophoresis 20min.Electrophoresis finishes, gel imaging system
System (UVP) is taken pictures preservation.
Testing result is shown in Fig. 3.Fig. 3 shows that the seedling plants of number 24,63,66,71,72,78 and 79 are tertia Ma Jia
Shaddock judges remaining seedling plants for thin skin horse family shaddock (major clique).
Embodiment 4
(1) it is detection material to select 38 seedling plants at random from the tertia horse family shaddock nursery for being mixed with other kinds, is adopted
The genomic DNA of above-mentioned detection material is prepared with the CTAB methods extraction of improvement.
(2) base of the above-mentioned all citruses of primer pair p-chr6.21-8689F/p-chr6.21-8689R Amplification Analysis is utilized
Because of a group DNA.It is carried out amplification reaction in PTC -200PCR instrument (MJ.Research Inc., USA).The reaction system of PCR amplification
For the Mix liquid of 7 μ l, the forward primer of the 10mmol/L of 0.3 μ l, the reverse primer of the 10mmol/L of 0.3 μ l, 1.5 μ l's
The ddH of 100ng/ul template DNAs and 6 μ l2O.The specific steps are：95 DEG C of denaturation 5min；Followed by 35 cycles：94 DEG C, 30s,
55 DEG C, 30s, 72 DEG C, 35s；Last 72 DEG C, 10min, 12 DEG C, 30min, 4 DEG C preservations.
(3) by amplified production, 3.0% agarose gel electrophoresis detects on Horizontal electrophoresis tank, uses 1 × TAE buffer solutions
(0.04M Tris-acetate, 0.001M EDTA, pH8.0), voltage 120V, electrophoresis 20min.Electrophoresis finishes, gel imaging system
System (UVP) is taken pictures preservation.
Testing result is shown in Fig. 4.Fig. 4 shows that all tertia horse man shaddocks obtain two bright bands, Suo You Guanxi amplifiablely
Small stream honey shaddock amplifies a bright band.
Have been described in detail above embodiments of the present invention, but this is only to facilitate the example for understanding and lifting, it should not be by
It is considered as and limits the scope of the present invention.Equally, any person of ordinary skill in the field can the technique according to the invention
Various possible equivalent changes or replacement are made in the description of scheme and its preferred embodiment, but all these changes or replacement are all
The scope of the claims of the present invention should be belonged to.
Sequence table
<110>Hua Zhong Agriculture University
<120>One group of horse family's shaddock InDel molecular labeling and its application in Citrus Cultivars seedling early stage distinguishes tertia horse man shaddock
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
agtgaaaggg agagaaagaa gc 22
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
atggtgccac attgcgagt 19
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gggagggagc ttgcttgatt 20
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
acccgataaa gtcacgtaca ca 22
Claims (7)
1. one group of horse man shaddock InDel molecular labeling, which is characterized in that including by primer pair chr2.10-9584F/chr2.10-
9584R expands the segment that tertia horse man shaddock genomic DNA obtains and by primer pair p-chr6.21-8689F/p-chr6.21-
The segment that 8689R amplification tertia horses man shaddock genomic DNA obtains；
The nucleotide sequence 5 ' -3 ' of the primer pair chr2.10-9584F/chr2.10-9584R is respectively：
chr2.10-9584F：AGTGAAAGGGAGAGAAAGAAGC；
chr2.10-9584R：ATGGTGCCACATTGCGAGT；
The nucleotide sequence 5 ' -3 ' of the primer pair p-chr6.21-8689F/p-chr6.21-8689R is respectively：
p-chr6.21-8689F：GGGAGGGAGCTTGCTTGATT；
p-chr6.21-8689R：ACCCGATAAAGTCACGTACACA.
2. a kind of kit for distinguishing tertia horse man shaddock, which is characterized in that including primer pair chr2.10-9584F/
Chr2.10-9584R and primer pair p-chr6.21-8689F/p-chr6.21-8689R.
3. kit described in molecular labeling or claim 2 described in claim 1 is distinguishing tertia horse family shaddock and other kind mandarin oranges
Application in tangerine, other described kind citruses include thin skin horse man You, Guanxi small stream honey shaddock, the local soil of shatian pomelo or Jiangxi Province Guangfeng County
Any one or more in shaddock.
4. application according to claim 3, which is characterized in that include the following steps：
(1) genomic DNA of detected materials is extracted；
(2) respectively with primer pair chr2.10-9584F/chr2.10-9584R and primer pair p-chr6.21-8689F/p-
Chr6.21-8689R carries out PCR amplification to the genomic DNA of the detected materials, obtains two groups of amplified productions；
(3) two groups of amplified productions are obtained into electrophoretogram respectively into row agarose gel electrophoresis；
(4) judged according to the electrophoretogram：If the amplified production electricity of the primer pair chr2.10-9584F/chr2.10-9584R
There are a bright band, and the amplified production electrophoretogram of the primer pair p-chr6.21-8689F/p-chr6.21-8689R in swimming figure
In have two bright bands, then judge detected materials for tertia horse man shaddock.
5. application according to claim 4, which is characterized in that the reaction system of the PCR amplification is：The Mix liquid of 7 μ l,
The forward primer of the 10mmol/L of 0.3 μ l, the reverse primer of the 10mmol/L of 0.3 μ l, the 100ng/ul template DNAs and 6 of 1.5 μ l
The ddH of μ l2O。
6. application according to claim 5, which is characterized in that the step of PCR amplification is：95 DEG C, 5min；35 are followed
Ring：94 DEG C, 30s, 55 DEG C, 30s, 72 DEG C, 35s；72 DEG C, 10min.
7. application according to claim 4, which is characterized in that the agarose gel electrophoresis uses 2.0%~4.0% matter
Measure the Ago-Gel of percentage, 100~150V of voltage, 10~30min of electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810491165.1A CN108660246B (en) | 2018-05-21 | 2018-05-21 | InDel molecular markers of Ma (Citrus paradisi) pomelos and application of InDel molecular markers in early-stage differentiation of rough-peel Ma pomelos of citrus varieties |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810491165.1A CN108660246B (en) | 2018-05-21 | 2018-05-21 | InDel molecular markers of Ma (Citrus paradisi) pomelos and application of InDel molecular markers in early-stage differentiation of rough-peel Ma pomelos of citrus varieties |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108660246A true CN108660246A (en) | 2018-10-16 |
| CN108660246B CN108660246B (en) | 2021-01-22 |
Family
ID=63777312
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810491165.1A Active CN108660246B (en) | 2018-05-21 | 2018-05-21 | InDel molecular markers of Ma (Citrus paradisi) pomelos and application of InDel molecular markers in early-stage differentiation of rough-peel Ma pomelos of citrus varieties |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660246B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266776A (en) * | 2018-10-24 | 2019-01-25 | 华中农业大学 | Utilize the kit and method of InDel Marker Identification citrus shaddock hybrid generation |
| CN110669863A (en) * | 2019-10-30 | 2020-01-10 | 华中农业大学 | Citrus mitochondria InDel molecular marker and application thereof |
| CN110699477A (en) * | 2019-10-21 | 2020-01-17 | 华中农业大学 | Molecular marker for distinguishing raw material plants of exocarpium citri grandis and light exocarpium citri grandis and application of molecular marker |
| CN111286556A (en) * | 2020-04-03 | 2020-06-16 | 江西省农业科学院园艺研究所 | Method for identifying variety of golden orchid pomelo based on whole genome InDel marker |
| CN113355448A (en) * | 2021-07-09 | 2021-09-07 | 华中农业大学 | InDel molecular marker for identifying phyllanthus emblica and application thereof |
| CN114438249A (en) * | 2022-02-22 | 2022-05-06 | 江西省农业科学院园艺研究所 | Primer group, kit and identification method for identifying cultivation types of valium odoratum honey pomelos |
| CN117512166A (en) * | 2023-10-30 | 2024-02-06 | 上饶师范学院 | Molecular marker for identifying grapefruit and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060292248A1 (en) * | 2005-06-20 | 2006-12-28 | Bio-Germ Protection, Llc | Biological attack protection kit and method |
| CN105603096A (en) * | 2016-02-25 | 2016-05-25 | 华中农业大学 | Co-dominance InDel molecular marker for identifying single embryo and multiple embryos of citrus and application thereof |
-
2018
- 2018-05-21 CN CN201810491165.1A patent/CN108660246B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060292248A1 (en) * | 2005-06-20 | 2006-12-28 | Bio-Germ Protection, Llc | Biological attack protection kit and method |
| CN105603096A (en) * | 2016-02-25 | 2016-05-25 | 华中农业大学 | Co-dominance InDel molecular marker for identifying single embryo and multiple embryos of citrus and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| PRADOSH MAHADANI • SANKAR KUMAR GHOSH: "Utility of indels for species-level identification of a biologically complex plant group: a study with intergenic spacer in Citrus", 《MOL BIOL REP》 * |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266776A (en) * | 2018-10-24 | 2019-01-25 | 华中农业大学 | Utilize the kit and method of InDel Marker Identification citrus shaddock hybrid generation |
| CN110699477A (en) * | 2019-10-21 | 2020-01-17 | 华中农业大学 | Molecular marker for distinguishing raw material plants of exocarpium citri grandis and light exocarpium citri grandis and application of molecular marker |
| CN110699477B (en) * | 2019-10-21 | 2021-06-11 | 华中农业大学 | Molecular marker for distinguishing raw material plants of exocarpium citri grandis and light exocarpium citri grandis and application of molecular marker |
| CN110669863A (en) * | 2019-10-30 | 2020-01-10 | 华中农业大学 | Citrus mitochondria InDel molecular marker and application thereof |
| CN110669863B (en) * | 2019-10-30 | 2021-07-16 | 华中农业大学 | Citrus mitochondria InDel molecular marker and application thereof |
| CN111286556A (en) * | 2020-04-03 | 2020-06-16 | 江西省农业科学院园艺研究所 | Method for identifying variety of golden orchid pomelo based on whole genome InDel marker |
| CN113355448A (en) * | 2021-07-09 | 2021-09-07 | 华中农业大学 | InDel molecular marker for identifying phyllanthus emblica and application thereof |
| CN113355448B (en) * | 2021-07-09 | 2022-04-08 | 华中农业大学 | InDel molecular marker for identifying phyllanthus emblica and application thereof |
| CN114438249A (en) * | 2022-02-22 | 2022-05-06 | 江西省农业科学院园艺研究所 | Primer group, kit and identification method for identifying cultivation types of valium odoratum honey pomelos |
| CN115927712A (en) * | 2022-02-22 | 2023-04-07 | 江西省农业科学院园艺研究所 | Primer group, kit and method for identifying variety of jingganghua honey pomelo seedlings |
| CN115927713A (en) * | 2022-02-22 | 2023-04-07 | 江西省农业科学院园艺研究所 | Primer group, kit and method for identifying honey pomelo cultivars |
| CN115927713B (en) * | 2022-02-22 | 2023-09-19 | 江西省农业科学院园艺研究所 | Primer group, kit and method for identifying honey pomelo cultivar |
| CN115927712B (en) * | 2022-02-22 | 2023-10-13 | 江西省农业科学院园艺研究所 | Primer group, kit and method for identifying variety of Jinggang honey pomelo seedlings |
| CN117512166A (en) * | 2023-10-30 | 2024-02-06 | 上饶师范学院 | Molecular marker for identifying grapefruit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108660246B (en) | 2021-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108660246A (en) | One group of horse family's shaddock InDel molecular labeling and its application in Citrus Cultivars seedling early stage distinguishes tertia horse man shaddock | |
| CN105838785B (en) | SSR molecular marker and application with sesame black seed coat gene close linkage | |
| CN107557362B (en) | A kind of identification method of masson pine cpSSR polymorphism primer and its pine tree sibling species | |
| CN104805080B (en) | A kind of molecular labeling of siliqua of oilseed rape number main effect QTL and application | |
| CN104711361B (en) | The method of the red peaceful hybrid seed purity of Rapid identification new water melon breed and the primer and kit of use | |
| CN106755480A (en) | A kind of SSR molecular marker I for identifying Gala apple Progeny plants and its application | |
| CN108034752B (en) | InDel molecular labelings with eggplant fruit color epistatic gene P close linkages and application | |
| CN110305978A (en) | SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association | |
| CN104004833A (en) | EST-SSR core primer group developed on basis of transcriptome sequence of towel gourd and application thereof | |
| CN108384875A (en) | A kind of and the relevant insertion/deletion site of capsicum mellow fruit color gene, molecular labeling, molecular labeling primer and application | |
| CN107217099A (en) | A kind of SNP marker identified available for snakehead genetic sex and supermale fish and its application | |
| CN105925680A (en) | Method for developing marker through tetraploid potato high-throughput sequencing and application of method | |
| CN105331731B (en) | A kind of and SNP marker of sesame seed seed coat colour gene close linkage | |
| CN111304337A (en) | SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application | |
| CN106978504A (en) | A kind of preparation method and application of spinach SSR marker | |
| CN106498048A (en) | A kind of QTL related to soybean nodulation number, SNP marker and application | |
| CN106282341A (en) | For the primer system of Rhizoma Dioscoreae esculentae paternity test and screening technique thereof and test kit | |
| CN106350591A (en) | SSR primers for establishing colored-leaf goldenrain tree variety fingerprint spectrum, established fingerprint spectrum and application thereof | |
| CN106434641B (en) | And cabbage purple leaf ball geneBrPurLinked molecular markers | |
| CN108384879A (en) | A kind of SSR primers and method for watermelon hybrid object innovation | |
| CN104651497B (en) | Chain SSR molecular marker primer and application with Chinese cabbage yellow seed coat gene Brsc ye | |
| CN112725521B (en) | Dendrobium chrysotoxum SSR molecular marker primer composition and application thereof | |
| CN105219848B (en) | For differentiating primer and its application of tapiscia sinensis gender | |
| CN106048032A (en) | SCAR molecular marker for banana B genome identification and identification method thereof | |
| CN106244683B (en) | Primer for detecting " Qiong Li " small watermelon purity of hybrid combines and its methods and applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |