CN108660235A - A kind of molecular labeling SIsv0686 with millet leaf color gene close linkage - Google Patents
A kind of molecular labeling SIsv0686 with millet leaf color gene close linkage Download PDFInfo
- Publication number
- CN108660235A CN108660235A CN201711298892.8A CN201711298892A CN108660235A CN 108660235 A CN108660235 A CN 108660235A CN 201711298892 A CN201711298892 A CN 201711298892A CN 108660235 A CN108660235 A CN 108660235A
- Authority
- CN
- China
- Prior art keywords
- molecular labeling
- millet
- seq
- primer
- leaf color
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, specifically, being related to a kind of and millet leaf color gene close linkage molecular labeling, which contains sequence shown in Seq ID No.1.The invention further relates to expand the purposes and a kind of Millet Breeding method of primer, the molecular labeling and the primer of the molecular labeling in the assignment of genes gene mapping of millet leaf color or millet genetic breeding.The molecular labeling of the present invention gets up genomic dna sequence and millet leaf color genetic link, is conducive to the foundation of millet molecular mark system；The hereditary close linkage distance of the molecular labeling and millet leaf color gene is 1.6cM.The molecular labeling and molecular labeling amplimer of the present invention can be applied to Millet Breeding practice and resource and cultivar identification easy, quick, with high throughput.
Description
Technical field
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, more particularly to a kind of and millet blade face
Molecular labeling of the color base because of close linkage.The invention further relates to the primer, the molecular labeling and the primers that expand the molecular labeling to exist
Purposes in the assignment of genes gene mapping of millet leaf color or millet genetic breeding.
Background technology
China is the country of origin of millet (Setaria italica L.Beauv.), is the concentration plantation of millet in the world
State, millet occupy an important position in the national economy in China and social production, have important meaning to dry farming ecological agriculture construction
Justice.Therefore, accelerate the breeding process of millet particularly important.Since millet is region importance crop, current related paddy
The research means and method of son relatively fall behind, and it is a sternness that how the research means of the advanced science of application, which do Millet Breeding well,
The problem of.With the development of molecular biology, the appearance of molecular marking technique opens newly for the genetic research and breeding of millet
Thinking and means.It develops the molecular labeling of the important character gene with China's characteristic and carries out assisted selection research,
Facilitation will be played to improving China's Millet Breeding level.
Plant leaf color is the general performance of various pigments in chloroplaset, and normal blade Determination of Chlorophyll is dominant, is usually showed
For green.Leaf variegation is that the frequency of mutation is higher in higher plant and is easy to the mutant character of identification.So far, rice,
Wheat, barley, corn and soybean, cotton, tobacco, corn, sunflower, tomato, cucumber, potato, mulberry tree etc. are nearly all high
Leaf color mutant has been had been found that in plant.Its mutator directly or indirectly influences the synthesis of photosynthetic pigments, especially chlorophyll
And degradation, cause the content of various pigments and ratio to change, so as to cause plant leaf variegation.In recent years, leaf color mutant
Utility value increasingly attracts attention, and has become research photosynthesis of plant mechanism, chlcrophyll biosynthesis approach, chloroplaset
Development and hereditary control mechanism special material, while leaf color mutant is in the breeding of high photosynthetic efficiency and the utilization of mark property
With important application value.Some leaf variegations are produced as mark property for stock breeding and cenospecies.With quasi-
Southern mustard, rice isotype Plant Genome sequencing completion, researching value of the leaf color mutant in functional genomics by
More and more concerns, they have become research photosynthetical system structure, gene function and its regulatory mechanism ideal material.According to not
Statistics, the related gene for the rice Leaf color mutant reported at present already exceed 80 completely, these mutant are broadly divided into white
5 major class such as change type, yellow type, stripe, green changing type, zebra leaf.But for millet leaf color gene and therewith close linkage
The research of molecular labeling is substantially without document report.
Invention content
The object of the present invention is to provide a kind of and millet leaf color gene close linkage molecular labelings.
Can be used for point of the PCR amplification with millet leaf color gene close linkage it is a further object of the present invention to provide a kind of
The primer pair of son label, and the molecular labeling that is obtained by the primer pair amplifies.
Another object of the present invention is to provide above-mentioned molecular labeling in the assignment of genes gene mapping of millet leaf color, detection and millet
The detection method of purposes and above-mentioned molecular labeling in assistant breeding.
The purpose of the present invention also provide it is a kind of include using above-mentioned molecular labeling millet leaf color gene positioning side
Method, and the millet auxiliary breeding means using the molecular labeling.
To achieve the goals above, present invention employs following technical schemes：
The invention discloses a kind of and millet leaf color gene close linkage molecular labeling, the molecular labeling contains
Sequence shown in Seq ID No.1；The preferred molecular labeling has sequence shown in Seq ID No.1.Wherein underline portion
It is divided into design of primers section：
CTCTTCCAAGTCTGGTTTGCTTCTTCCGCCACTGACAGGTGGACCACGAGGATTCAATCAGCAGCAGGCTGTCCCAT
ATATGCTGCTGTGCGTGTGACGCCCACGGGCCACTTGTGTTCCCCCCACTACTCCAGAACTCCAGGTGCCACTGAAT
CGTTAACTTGTAGGCAGGCATGTCCTTTAACCTTTTTCCGTTTTCTCATACTCATACCAGCTGCAACTGCAAGGAGG
ATTCAGCCAAACTACCGTAATACTACAGCAAAATACAATACTAGGATCGATTGGCTTTCTCTCTTTGGTTCGTCTAA
TTAGGTGGCAGCACTATTCATCACAGGCAACACACTGCTAGTGTCTAGTGGATCACAAAAATACTTGCACACACGTC ACATGTGATGTCTGC(SEQ ID NO:1)
The invention also discloses a kind of primer pair of amplification and the molecular labeling of millet leaf color gene close linkage, institutes
The primer 1 of primer pair is stated containing sequence shown in Seq ID No.2, primer 2 contains sequence shown in Seq ID No.3；Preferred institute
Primer 1 is stated with sequence shown in Seq ID No.2, primer 2 has sequence shown in Seq ID No.3；
Seq ID No.2：5’-CTCTTCCAAGTCTGGTTTGC-3’；
Seq ID No.3：5’-GCAGACATCACATGTGACGT-3’.
The invention also discloses a kind of and millet leaf color gene close linkage molecular labeling, the molecular labeling is
It is obtained through PCR amplification as template using the millet genomic DNA of leaf green by above-mentioned primer pair.
In one embodiment of the invention, the molecular labeling (contains nucleotide sequence shown in Seq ID No.1
DNA fragmentation) for the DNA fragmentation of nucleotide sequence shown in Seq ID No.1 in millet genome, that is, the Seq ID for being included
5 ' the ends of No.1 and/or the nucleotide sequence other than 3 ' ends are also the sequence in millet genome, it is preferred that are millet genome
5 ' the ends of middle Seq ID No.1 and/or the upstream and downstream sequence at 3 ' ends.As long as it will be understood by those skilled in the art that amplification or
The molecular labeling in the millet genomic DNA of leaf green is detected, necessarily can detect or expand to obtain containing Seq ID
Sequence shown in No.1.The length of the 5 ' ends of Seq ID No.1 and/or the upstream and downstream sequence at 3 ' ends is suitable length, not special
It does not limit, for example, the length for meeting molecular labeling is less than 10,000bp, is less than 5,000bp, is less than 2,000bp, is less than 1,
500bp, it is less than 1,200bp, is less than 1,000bp or is less than 800bp.
The invention also discloses the preparation methods of the molecular labeling of the present invention, include the following steps：It is green using leaf color
The genomic DNA of the millet of color carries out PCR amplification as template, with above-mentioned primer pair, and obtained 400bp amplified productions contain
The molecular labeling；Preferably, further include the steps that purifying pcr amplification product.
To those skilled in the art, it will be understood that can also the chemically synthesized methods of DNA obtain the present invention molecule
Label.
The invention also discloses the detection methods of the molecular labeling, including step：
(1) the nucleotide sequence design primer of molecular labeling according to the present invention；
(2) it is expanded using the genomic DNA for being detected millet as template；
(3) judge to whether there is the molecular labeling in amplified production.
For example, can be using the genomic DNA of detected millet as template, with above-mentioned primer (Seq ID No.2 and Seq ID
No.3 PCR amplification) is carried out, amplified production is obtained.Obtained amplified production can be carried out to sequencing or gel electrophoresis.
The invention also discloses purposes of the molecular labeling in the assignment of genes gene mapping of millet leaf color or detection.
The invention also discloses a kind of methods of the millet leaf color assignment of genes gene mapping, and the method includes using the present invention's
The step of molecular labeling.
The invention also discloses purposes of the molecular labeling in millet assistant breeding.
The invention also discloses a kind of millet auxiliary breeding means, the method includes the molecular labeling of the detection present invention or
The step of molecular labeling primer pair.
The molecular labeling of the present invention can be used in molecular mark from now on, and those skilled in the art can manage
Solution, for example whether millet blade is screened containing control leaf color green by detecting whether the molecular labeling in the presence of the present invention
Millet.It detects that the millet blade of the molecular labeling with the present invention is green, does not have the millet blade of the molecular labeling
For yellow.The detection can be the method for PCR detections, specifically, can use drawing for the molecular labeling of the above-mentioned present invention
Object pair.The detection can also be carried out by sequencing approach.The millet auxiliary breeding means have easy, quick, high-throughput
Advantage.
In the present invention, specifically, the millet can be paddy No. 1, millet A2 sterile lines, confused flour beetle 3 or open miscellaneous
The F2 generations that No. 3 selfings of paddy generate.Wherein, the part F2 that No. 3 millet A2 sterile lines, confused flour beetle selfings generate is on behalf of blade yellow
Type；The part F2 of No. 3 selfing generations of confused flour beetle No. 1, confused flour beetle 3 or confused flour beetle are opened on behalf of blade edge colour pattern.More than use
Technical solution makes the advantageous effect that the present invention has be：
The present invention provides the molecular labeling with millet leaf color gene close linkage, the molecular labeling is by genome
DNA sequence dna gets up with millet leaf color genetic link, is conducive to the foundation of millet molecular mark system；Described point
Son label and the hereditary close linkage distance of millet leaf color gene are 1.6cM.The molecular labeling and molecular labeling of the present invention
Amplimer can be applied to Millet Breeding practice and resource and cultivar identification easy, quick, with high throughput.
Description of the drawings
Fig. 1：Molecular labeling primer (Seq ID No.2 and Seq ID No.3) ties the part of 480 single plant amplifications of F2 generations
Fruit.Wherein：
Swimming lane 3,4,5,7,8,9,10,12,13,14,15,16,17,19,20,21,22,23 represents 18 plants of blade edge colour patterns
Single plant pcr amplification product, swimming lane 1,2,6,18,24 represents the single plant pcr amplification product of 5 plants of blade yellow types.Swimming lane M is
Marker is 100bp DNA Ladder；Its molecular weight includes：、1500bp、1000bp、900bp、800bp、700bp、
600bp, 500bp, 400bp, 300bp, 200bp and 100bp.
Specific implementation mode
A kind of molecular labeling the invention discloses primer pair and with millet leaf color gene close linkage
SIsv0686.Using the primer pair of the present invention, PCR is carried out by template of millet genomic DNA, can be obtained and millet blade face
For color base because of the molecular labeling of close linkage, which is named as molecular labeling SIsv0686 in the present invention.It may be noted that
, it will be understood by those skilled in the art that obtained except through above-mentioned PCR amplification outside the molecular labeling of the present invention, it can be with
The molecular labeling of the present invention is obtained by chemical synthesis.
The primer pair sequence shown in the ID No.2 of Seq containing ordered list and Seq ID No.3 respectively of the present invention,
Seq ID No.2：5’-CTCTTCCAAGTCTGGTTTGC-3’；
Seq ID No.3：5’-GCAGACATCACATGTGACGT-3’.
Those skilled in the art are known, in the sequence shown in above-mentioned Seq ID No.2 and Seq ID No.3, can its 5 '
End or 3 ' ends increase separately 1~10 base, the increased base type of institute can according on millet genomic DNA with Seq ID
No.2 and Seq ID No.3 match region base type and determined according to basepairing rule, thus obtained primer
Essentially identical (the DNA sequence dna phase between upstream and downstream primer of amplified production pair with Seq ID No.2 and Seq ID No.3
Together).Therefore, above-mentioned to increase separately 1~10 base at the 5 ' ends of Seq ID No.2 and Seq ID No.3 or 3 ' ends and expand
Increasing obtains the primer pair of essentially identical DNA fragmentation, is included in the primer pair of the present invention.In specific embodiment of the present invention
In, primer pair of the invention is preferably sequence shown in Seq ID No.2 and Seq ID No.3.The present invention is by male parent leaf green
The homozygote hybridization of type and maternal blade yellow type obtains F1 generation (confused flour beetle 3), then is selfed with F1 generation and to generate F2 for group,
Totally 480 single plants.SV molecular markers development methods are preferably used, de novo sequencings (60X contig are carried out to male parent first
N50：22K, scaffold N50：320K；Total size：400Mb), female parent resurveys sequence (10X)；Then it is surveyed according to Parent
Ordinal number evidence, using the sequence difference between the SOAP comparison Parents of Hua Da independent development, respectively in male parent diversity sequence
5 ' ends and 3 ' end outside about 50bp positions, randomly select the primer of the Design of length diversity sequence amplification of 20bp or so, according to
Different diversity sequences devises 1105 pairs of primers.It is expanded as template using the DNA of Parent and F1, from 1105 pairs of primers
Filter out 616 pairs of primers with polymorphism and validity.Using the 616 pairs of primers developed, to 480 individuals of F2 groups
PCR detections are carried out, and carry out data statistic analysis, genetic map drafting is carried out with Map Maker3.0 softwares, obtains the present invention
The molecular labeling and its amplimer with leaf color gene close linkage.It is obtained using the primer pair amplifies filtered out
The male parent sequence arrived, i.e. molecular labeling SIsv0686 in the present invention.Character analysis is carried out to F2 individuals, and according to gene character
Data and phenotype trait data are by the millet leaf color assignment of genes gene mapping on genetic map.
Below by specific embodiment and in conjunction with attached drawing, invention is further described in detail.Following embodiment is only right
The present invention is further detailed, and should not be construed as limiting the invention.
Embodiment 1：Structures of the millet F2 for segregating population
Male parent is paddy No. 1：Blade edge colour pattern, high plant type, a kind of anti-Sethoxydin (herbicide), boot leaf is long and narrow, bristle
Red, glume is red, fertile.
Female parent is A2 sterile lines：Blade yellow type, short plant type, not anti-Sethoxydin, boot leaf short-wide, bristle green, glume
Green, partial sterility.
Male parent and hybridization of female parent obtain F1 (blade edge colour pattern), and 480 F2 are obtained for single plant in F1 selfings.To 480 F2
Single plant carries out leaf color character analysis, finds 453 plants of blade edge colour pattern, 27 plants of blade yellow type.
Embodiment 2：Parent and F1 generation, F2 for genes of individuals group DNA extraction
Extract the genomic DNA of Parent, F1 generation and 480 F2 in embodiment 1 for individual respectively with CTAB methods,
The specific method is as follows：
(1) the fresh blades of 1.0g are weighed, shreds and is put into mortar, with 1.5 × CTAB of 3mL are added after liquid nitrogen grinding, are ground into
Homogenate is transferred in the centrifuge tube of 15mL, and 1mL 1.5 × CTAB flushings are then added into mortar and are transferred in centrifuge tube again.After mixing
In 65 DEG C of water-bath 30min, during which slowly shake up frequently.
Wherein 1.5 × CTAB formulas are following (1L)：
Add deionized water to be settled to 1L, uses the preceding mercaptoethanol that final concentration of 0.2% (2ml) is added.
(2) it is cooled to room temperature, isometric chloroform/isoamyl alcohol (24 is added：1), gently mixing, until subnatant becomes dark green
Color.
(3) 4200rpm centrifuges 10min, and upper strata aqueous phase is moved on to new 15mL centrifuge tubes, adds 2 times of volumes to be pre-chilled anhydrous
Ethyl alcohol mixes static 5min.30min, which is placed, in -20 DEG C precipitates DNA.
(4) 4200rpm centrifuges 10min, discards supernatant, 75% ethyl alcohol of 1mL washing precipitation is added 1 time, and it is dry to be inverted centrifuge tube
200 μ L TE dissolving DNAs are added in dry DNA.
(5) genomic DNA is detected with 0.8% Ago-Gel.
(6) by the genomic DNA of obtained Parent and F1 generation, F2 generation individuals be stored in -20 DEG C it is spare.
Embodiment 3：The preparation of molecular labeling
Using the male parent, F1 generation or the genomic DNA in F2 generations extracted in embodiment 2 as template, with molecular labeling amplimer
PCR amplification is carried out to (Seq ID No.2 and Seq ID No.3).
PCR reaction systems are as follows：
PCR response procedures are as follows：
94 DEG C of pre-degenerations 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, run 35 cycles；
Last 72 DEG C extend 3 minutes.Pcr amplification product can be preserved at 4 DEG C.
Molecular labeling is obtained through above-mentioned amplification procedure, amplified production is subjected to purification process after preferably expanding.It purifies laggard
Row sequencing, as a result as shown in Seq ID No.1.
To those skilled in the art, it will be understood that the molecule mark can also be obtained by the chemically synthesized methods of DNA
Note.
Embodiment 4：SV molecular markers developments
Male parent：De novo sequencings, 60X contig N50：22K, scaffold N50：320K；Total size：
400Mb；It is maternal：Resurvey sequence 10X.
According to Parent sequencing data, SOAP softwares (such as the SOAP2.20, Ke Yicong of Hua Da independent development are utilized
http://soap.genomics.org.cn/ is downloaded, and can also use other sequence alignment programs) compare between Parent
Sequence difference, be then based on the sequence of difference, with primer premier Software for Design expand diversity sequence primer；It is based on
Different diversity sequences devises altogether 1105 pairs of primers.It is shown in following table 1 primer sequence (Seq in part therein
ID No.2-Seq ID No.41)
Part primer in 1 1105 pairs of random primers of table
Respectively using the Parent of extraction and the genomic DNA of F1 generation as template, PCR expansions are carried out with 1105 pairs of primers of design
Increase.
PCR reaction systems (25 μ L)：
PCR response procedures：94 DEG C of pre-degeneration 5min；It is recycled subsequently into 35：94 DEG C of denaturation 30s, 60 DEG C of annealing 30s,
72 DEG C of extension 40s；72 DEG C of extension 3min after circulation terminates；4 DEG C of preservations.
PCR product electrophoresis detection：1.2% Ago-Gel 120v electrophoresis 25min, EB dyeing 10min, according to glue and remembers
Record.
The validity and polymorphism of primer：Refer to whether having amplified production in this validity, polymorphism refers between Parent
The clip size of amplified production is variant.
The screening of primer is carried out according to following screening criteria：Parent and F1 have amplified production, and Parent expands
Increasing production object only has an apparent banding pattern and size variant, and F1 shows as the heterozygosis banding pattern of Parent banding pattern, that is, has father
Two bands of this and maternal banding pattern.
The selection result：According to above-mentioned screening criteria, 616 pairs of primers are filtered out from 1105 pairs of primers of design.
Embodiment 5：Genetic map construction and the assignment of genes gene mapping
(1) genetic map construction
With 616 couple of exploitation there is the molecular labeling of polymorphism to carry out PCR detections to 480 individuals of F2 groups, it is used
Template is 480 individual genomic DNAs of F2 groups obtained, the other ingredients and PCR programs of PCR system and above-mentioned phase
Together.
To PCR product into row agarose gel electrophoresis, wherein molecular labeling primer (SEQ ID NO:And (SEQ ID 2)
NO:3) as shown in Figure 1 to the partial results of 480 individual amplifications.
Whole electrophoresis results are subjected to data statistic analysis, the specific method is as follows：It is father by F2 groups single plant amplified band
This type is denoted as a, and amplified band is the b that is denoted as of maternal type, and amplified band is denoted as h, band containing male parent type and maternal type simultaneously
Pattern paste or missing be denoted as-, be equivalent to shortage of data, finally obtain the base of 480 individual 616 pair primer amplifications of F2 groups
Because of type data.For example, be a with 480 individual data that pair of primers obtains, b, h ,-, b ... ... totally 480 data are used
The data that second pair of primer obtains be b, a, h, a ,-... ... totally 480 data, totally 616 pairs of primers count respectively, gained is
The genotype data of the F2 groups.
With 3.0 softwares of MapMaker (Constructing genetic maps with MAPMAKER/EXP 3.0, S
Lincoln,M Daly,E Lander-Cambridge,MA:Whitehead Institute, 1992) carry out genetic linkage map
Spectrum is drawn, and genetic linkage map is obtained.Can determine on the genetic linkage map obtained from this 616 pairs of primers position and with millet blade
The genetic distance of color gene.
(2) assignment of genes gene mapping
It is similar with male parent type character to be denoted as a (blade edge colour pattern) according to 480 individual leaf color phenotypes, with mother
This type character is similar to be denoted as b (blade yellow type), and character occupy and is denoted as h between male parent and female parent.Obtain 480 it is individual
480 individual phenotypic datas are compared by phenotypic data with the 480 individual genotype datas obtained before, similar
Gao Ze represents the label and leaf color character close linkage, and by the leaf color assignment of genes gene mapping on genetic linkage maps.
Embodiment 6：With the verification of the molecular labeling of millet leaf color gene close linkage
1. made from embodiment 5 on the basis of genetic linkage maps, even according to the heredity with millet leaf color gene
Distance is locked, in the hereditary close linkage with millet leaf color gene apart from the location determination for being 1.6cM molecular labeling primer
(Seq ID No.2 and Seq ID No.3), and corresponding male parent sequence location is found, the sequence between upstream and downstream primer is
Molecular labeling, nucleotide sequence is as shown in Seq ID No.1.
Seq ID No.2：5’-CTCTTCCAAGTCTGGTTTGC-3’；
Seq ID No.3：5’-GCAGACATCACATGTGACGT-3’.
2. in addition, in the electrophoresis of 480 to F2 generations individual pcr amplification products in embodiment 5, for molecule mark
Remembering the amplification of primer (Seq ID No.2 and Seq ID No.3) is：The expansion of the plant of about 453 plants of leaf color green types
Volume increase object has the band of 400bp sizes, the pcr amplification product of the plant of about 27 plants of leaf color yellow types to have 680bp's
Band (part amplification is as shown in Figure 1).And the sequence and Seq ID No.1 phases of the segment of the 400bp are proved through sequencing
Together.
As it can be seen that the molecular labeling (Seq ID No.1) of the present invention is the molecule with millet leaf color gene close linkage
Label.
The above content is combining, specific embodiment is made for the present invention to be further described, and it cannot be said that this hair
Bright specific implementation is confined to these explanations.For those of ordinary skill in the art to which the present invention belongs, it is not taking off
Under the premise of from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to the protection of the present invention
Range.
Sequence table
<110>Shenzhen Hua Da millet industry limited liability company
<120>A kind of molecular labeling SIsv0686 with millet leaf color gene close linkage
<130> P2017-1-0174.CN
<160> 41
<170> SIPOSequenceListing 1.0
<210> 1
<211> 400
<212> DNA
<213>Millet (Setaria italica L. Beauv.)
<400> 1
ctcttccaag tctggtttgc ttcttccgcc actgacaggt ggaccacgag gattcaatca 60
gcagcaggct gtcccatata tgctgctgtg cgtgtgacgc ccacgggcca cttgtgttcc 120
ccccactact ccagaactcc aggtgccact gaatcgttaa cttgtaggca ggcatgtcct 180
ttaacctttt tccgttttct catactcata ccagctgcaa ctgcaaggag gattcagcca 240
aactaccgta atactacagc aaaatacaat actaggatcg attggctttc tctctttggt 300
tcgtctaatt aggtggcagc actattcatc acaggcaaca cactgctagt gtctagtgga 360
tcacaaaaat acttgcacac acgtcacatg tgatgtctgc 400
<210> 2
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 2
ctcttccaag tctggtttgc 20
<210> 3
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 3
gcagacatca catgtgacgt 20
<210> 4
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 4
gccatgccat ctgcgttctc 20
<210> 5
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 5
actctgatcg caacaaggac 20
<210> 6
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 6
cttcacactt cccacttcac 20
<210> 7
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 7
aagtttgcga gcaagcacaa 20
<210> 8
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 8
cctttgcagc atctgtacgt 20
<210> 9
<211> 19
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 9
ggtgtcacgc tcgatcgac 19
<210> 10
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 10
ctccattgtg gtttgtccac 20
<210> 11
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 11
ctcttgctat tgcgcatcct 20
<210> 12
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 12
agccagctgg agaagagaat 20
<210> 13
<211> 19
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 13
cccaagtcca actgaaggc 19
<210> 14
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 14
ctggaatagc cgtagctaat 20
<210> 15
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 15
ccaacttgca acacgcaaat 20
<210> 16
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 16
ggactgggtc atgaatactg 20
<210> 17
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 17
atggactatt ggactgtatg t 21
<210> 18
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 18
tcgtctccaa gccgtccagt 20
<210> 19
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 19
ccaatgtatt ggccctaagc 20
<210> 20
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 20
gctaaggttc cgatctgtct 20
<210> 21
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 21
cggatacgag tcgtgtttgt 20
<210> 22
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 22
ccttcaacct gactttgcac 20
<210> 23
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 23
catgacaagg atcgtcacag 20
<210> 24
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 24
ccaagtgtgt atgcgacaag 20
<210> 25
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 25
ccagcttgct taaggtatca 20
<210> 26
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 26
gcagtgtgtt tctttcatgg 20
<210> 27
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 27
gcaatggttg atagatacga t 21
<210> 28
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 28
ttcgttggct gtagcgttga 20
<210> 29
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 29
gaagaaatca ccaacataac c 21
<210> 30
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 30
caggacatcg ccatggtact 20
<210> 31
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 31
atgaagcgag caagtgaact 20
<210> 32
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 32
tggattatgt ggagccatgt 20
<210> 33
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 33
gcattggtct tcttccaagg 20
<210> 34
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 34
gtttctgcgc taatctgatc 20
<210> 35
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 35
ccgaaatggt ggcaattgct 20
<210> 36
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 36
gagtatgtcg accgtagtac t 21
<210> 37
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 37
gtgatggatt tgcttgtcac t 21
<210> 38
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 38
caggagcttt tgacagtgag 20
<210> 39
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 39
aggtacgctt cccttgtcat 20
<210> 40
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 40
cctacacacc gctataaacc 20
<210> 41
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 41
atcgtgtacc cagctccgtt 20
Claims (9)
1. a kind of and millet leaf color gene close linkage molecular labeling, it is characterised in that：The molecular labeling contains Seq
Sequence shown in ID No.1；Preferably, the molecular labeling is sequence shown in Seq ID No.1.
2. a kind of primer pair of amplification and the molecular labeling of millet leaf color gene close linkage, it is characterised in that：It is described to draw
The primer 1 of object pair contains sequence shown in Seq ID No.3 containing sequence shown in Seq ID No.2, primer 2；Preferably, primer 1
For sequence shown in Seq ID No.2, primer 2 is sequence shown in Seq ID No.3；
Seq ID No.2：5’-CTCTTCCAAGTCTGGTTTGC-3’；
Seq ID No.3：5’-GCAGACATCACATGTGACGT-3’.
3. a kind of and millet leaf color gene close linkage molecular labeling, it is characterised in that：The molecular labeling is by weighing
Profit requires the primer pair described in 2 to be obtained through PCR amplification as template using the millet genomic DNA of leaf green.
4. molecular labeling according to claim 3, it is characterised in that：The molecular labeling contains shown in Seq ID No.1
Sequence；Preferably, the molecular labeling is sequence shown in Seq ID No.1.
5. the detection method of molecular labeling described in claim 1, includes the following steps：
(1) the nucleotide sequence design primer of molecular labeling according to claim 1；
(2) it is expanded using the genomic DNA for being detected millet as template；
(3) judge to whether there is the molecular labeling in amplified production.
6. the molecular labeling primer of the molecular labeling or claim 2 described in claim 1,3, any one of 4 is to auxiliary in millet
Help the purposes in breeding or the assignment of genes gene mapping of millet leaf color or detection.
7. a kind of method of the millet leaf color assignment of genes gene mapping, it is characterised in that：The method includes using claim 1,3,4
Any one of described in molecular labeling or claim 2 molecular labeling primer pair step.
8. purposes of the molecular labeling described in claim 1 in millet marker assisted selection.
9. a kind of millet auxiliary breeding means, it is characterised in that：The method includes test rights to require 1,3, any one of 4 institutes
The molecular labeling stated or with the molecular labeling primer of claim 2 to being detected the step of.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711298892.8A CN108660235A (en) | 2017-12-08 | 2017-12-08 | A kind of molecular labeling SIsv0686 with millet leaf color gene close linkage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711298892.8A CN108660235A (en) | 2017-12-08 | 2017-12-08 | A kind of molecular labeling SIsv0686 with millet leaf color gene close linkage |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108660235A true CN108660235A (en) | 2018-10-16 |
Family
ID=63785006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711298892.8A Pending CN108660235A (en) | 2017-12-08 | 2017-12-08 | A kind of molecular labeling SIsv0686 with millet leaf color gene close linkage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660235A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154282A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet |
| CN102154285A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0737 closely linked with millet leaf color gene |
| CN102690811A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv1363 closely linked with Setaria italica L. Beauv. leaf color gene |
| CN102690810A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv0690 closely linked with Setaria italica L. Beauv. leaf color gene |
-
2017
- 2017-12-08 CN CN201711298892.8A patent/CN108660235A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154282A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet |
| CN102154285A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0737 closely linked with millet leaf color gene |
| CN102690811A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv1363 closely linked with Setaria italica L. Beauv. leaf color gene |
| CN102690810A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv0690 closely linked with Setaria italica L. Beauv. leaf color gene |
Non-Patent Citations (1)
| Title |
|---|
| GENGYUN ZHANG等: "Genome sequence of foxtail millet(Setaria italica) provides insights into grass evolation and biofuel potential", 《NATURE BIOTECHNOLOGY》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108715902B (en) | Plum blossom pendulous branch character SNP molecular marker and application thereof | |
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN106191240B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits epidermal hair character | |
| CN102154282B (en) | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet | |
| CN109385466A (en) | The KASP Functional marker of resistance gene of rice blast Pi2 a kind of and its application | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN108866233A (en) | For identifying marker site, primer pair, kit and application of the peach to disease-resistant/susceptible character of Meloidogyne incognita | |
| CN102690811B (en) | Molecular marker SIsv1363 closely linked with millet leaf color gene | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN102690814B (en) | Molecule marker SIsv0491 closely linked with millet bristle color gene | |
| CN102154285B (en) | Molecule marker SIsv0737 closely linked with millet leaf color gene | |
| CN108660234A (en) | With the molecular labeling SIsv0362 of millet leaf color gene close linkage | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN102690813B (en) | Molecule marker SIsv0701 closely linked with millet bristle color gene | |
| CN105671039B (en) | The molecular labeling indel15-1 of soybean early flowering season main effect QTL and its application | |
| CN108660235A (en) | A kind of molecular labeling SIsv0686 with millet leaf color gene close linkage | |
| CN108660236A (en) | A kind of molecular labeling SIsv0704 with millet leaf color gene close linkage | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN102154284B (en) | Molecular marker SIsv0408 capable of being closely linked to Setaria italica pollen color gene | |
| CN102690810B (en) | Molecular marker SIsv0690 closely linked with millet leaf color gene | |
| CN108660237A (en) | A kind of molecular labeling SIsv1099 and application with millet Plant height gene close linkage | |
| CN109652579A (en) | The codominant marker and its detection method of rice blast resistant gene Pi2 and application | |
| CN108660233A (en) | A kind of molecular labeling SIsv0456 with millet anti-imazethapyr herbicide resistance gene close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181016 |