CN108659146A - Heveatex preservative agent and preparation method thereof and its application - Google Patents
Heveatex preservative agent and preparation method thereof and its application Download PDFInfo
- Publication number
- CN108659146A CN108659146A CN201810533827.7A CN201810533827A CN108659146A CN 108659146 A CN108659146 A CN 108659146A CN 201810533827 A CN201810533827 A CN 201810533827A CN 108659146 A CN108659146 A CN 108659146A
- Authority
- CN
- China
- Prior art keywords
- perilla leaf
- heveatex
- preservative agent
- latex
- antibacterial peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08C—TREATMENT OR CHEMICAL MODIFICATION OF RUBBERS
- C08C1/00—Treatment of rubber latex
- C08C1/02—Chemical or physical treatment of rubber latex before or during concentration
- C08C1/06—Preservation of rubber latex
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K5/00—Use of organic ingredients
- C08K5/0008—Organic ingredients according to more than one of the "one dot" groups of C08K5/01 - C08K5/59
- C08K5/0058—Biocides
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K5/00—Use of organic ingredients
- C08K5/16—Nitrogen-containing compounds
- C08K5/17—Amines; Quaternary ammonium compounds
- C08K5/175—Amines; Quaternary ammonium compounds containing COOH-groups; Esters or salts thereof
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K5/00—Use of organic ingredients
- C08K5/36—Sulfur-, selenium-, or tellurium-containing compounds
- C08K5/41—Compounds containing sulfur bound to oxygen
- C08K5/42—Sulfonic acids; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
- C08L1/00—Compositions of cellulose, modified cellulose or cellulose derivatives
- C08L1/08—Cellulose derivatives
- C08L1/26—Cellulose ethers
- C08L1/28—Alkyl ethers
- C08L1/286—Alkyl ethers substituted with acid radicals, e.g. carboxymethyl cellulose [CMC]
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
- C08L7/00—Compositions of natural rubber
- C08L7/02—Latex
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Polymers & Plastics (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biodiversity & Conservation Biology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention relates to a kind of Heveatex preservative agent and preparation method thereof and its applications, including volume ratio is 1:1~1:3 fungicide and stabilizer；Fungicide is the mixture of antibacterial peptide and perilla leaf extract, and the volume ratio of antibacterial peptide and perilla leaf extract is 1:2~1:5.The fungicide such as antibacterial peptide, perilla leaf extract can kill the bacterium in latex, prevent carbohydrate and Rumen protein fermentation in latex from decomposing.Stabilizer can maintain electric equilibrium in latex, improve the stability of latex, effectively prevent latex coagulation rotten.In addition, the Heveatex preservative agent of the application is soluble easily in water, difficult volatilization, environmentally friendly, non-stimulated, stability is good, preferable to the preservation effect of natural emulsion and concentrated latex and free from environmental pollution.
Description
Technical field
The invention belongs to Heveatex preservative agent technical fields, and in particular to a kind of Heveatex preservative agent and its preparation side
Method and its application.
Background technology
Fresh Heveatex is a kind of milky white liquid flowed out after being tapped rubber by Brazilian para ruber.The master of Heveatex
It is the rubber hydrocarbon made of cis- Isosorbide-5-Nitrae-isoprene monomer biopolymerization to want ingredient, and chemical constitution is (C5H8)n.Natural rubber
With excellent performance, it is widely used in the necks such as industry, agricultural, transportation, daily necessities, health care, science and techniques of defence
Domain.China accounts for 22% or more of global aggregate demand to the demand of Heveatex at present, it has also become the maximum natural gum in the whole world
Newborn importer.
Concentrated latex is a kind of high concentration day by being obtained after antibacterial anti-oxidant treatment and centrifugally operated by Heveatex
T PNR particle solution reduces transportation cost and improves latex quality convenient for long-term storage and long-distance transport.Just from rubber tree
Fresh latex of outflow itself after the pollutions such as glue knife, secant, glue tongue, footed glass, can be brought into latex without germy
Various microorganisms.Wherein bacterium etc. can make full use of glue protein of milk, carbohydrate etc. to be bred, so that latex shape
It changes, reduces latex stability, speed latex natural coagulation speed.Under normal conditions, it is made as concentrating in Heveatex
Need addition to sterilize or antibacterial additive during latex, while improving the pH value of latex, avoid pH close to albumen etc.
It is electric, increase rubber particles electric double layer thickness, enhances latex stability.The content of volatile fatty acid is direct in latex system
Reflect the important indicator of latex degree of spoilage and latex stability, therefore latex preservative can be evaluated by measuring the index
Fresh-keeping effect.Ideal concentrated natural latex protective agent has following characteristic：(1) there is preferable sterilization and inhibitory enzyme activity
Ability improves solution ph, increases the stability of latex system, there is certain complexing power to metal；(2) toxicity is little, most
It is good not volatile；(3) facilitate preservation and use；(4) reasonable price；(5) there is no harmful effect to the technique of glue；(6) source
It is sufficient.Current the most widely used preservative agent is ammonium hydroxide and its derivative.Ammonium hydroxide has numerous as Heveatex preservative agent
Advantage：Source is sufficient, it is cheap, be easy to use, easily remove, can neutralize volatile fatty acid stabilized latex, bactericidal,
Neutralization reaction occurs for energy and phosphate anion, magnesium ion etc..Disadvantage is also evident from, to operating personnel's skin have corrosivity,
Volatile and corrosion production equipment uses acid amount when increasing glue.
In recent years, novel low ammonia and without ammonia protective agent become the field research hotspot.Whether contain according to preservative agent
Ammonia, can be divided into novel preservative agent has ammonia and without two kinds of compound preservative agents of ammonia：(1) there is the compound preservation system of ammonia：Ammonium hydroxide/alkalinity is protected
Agent is protected, such as penta sodium pentachlorophenate, sodium diethyldithiocarbamate (SDC), zinc diethyl dithiocarbamate (ZDC), 2,4,
6- tri- (dimethylamino methyl)-phenol (DMP30) etc.；Ammonium hydroxide/faintly acid protective agent such as formaldehyde, boric acid, TMTD/ZnO etc.；Ammonia
Water/both sexes protective agent：8-hydroxyquinoline and neutral sulphates azanol.(2) system is preserved without ammonia：Alkaline preservative agent such as sodium carbonate, urine
Element, ammonium hydrogen carbonate, ammonium carbonate, ethylenediamine, methylamine, sodium sulfite；Pure weak acid protective agent such as formaldehyde；Neutral protective agent such as shell is poly-
Sugar, hydrophobically modified carbohydrate and some natural surfactants, silver ion compound.Therefore, more efficient, environmentally friendly no ammonia is researched and developed
Preservation system becomes the inexorable trend of natural rubber industry development.
Invention content
The purpose of the present invention is Heveatex preservative agent, the Heveatex preservative agent is to natural emulsion and concentrated latex
Preservation effect is preferable and free from environmental pollution.
Second object of the present invention is to provide a kind of preparation method of Heveatex preservative agent.
Third object of the present invention is to provide application of the Heveatex preservative agent in latex preservation.
In order to achieve the goal above, the technical solution that the present invention takes is：Heveatex preservative agent, including volume ratio are 1:
1~1:3 fungicide and stabilizer；Fungicide is the mixture of antibacterial peptide and perilla leaf extract, and antibacterial peptide is soaked with perilla leaf
The volume ratio of extract is 1:2~1:5.
Further, the amino acid sequence of the antibacterial peptide such as SEQ ID NO:Shown in 1.
Further, the stabilizer is in sodium dodecyl benzene sulfonate aqueous solution or sodium carboxymethyl cellulose solution
It is one or two kinds of.
Further, the mass percent of neopelex is in the sodium dodecyl benzene sulfonate aqueous solution
0.1%, the mass percent of sodium carboxymethylcellulose is 0.07% in sodium carboxymethyl cellulose solution.
The preparation method of Heveatex preservative agent, includes the following steps：
1) antibacterial peptide and perilla leaf extract of formula ratio are taken, is uniformly mixed, is heated to 30~40 DEG C, obtains antibacterial peptide and purple
The mixture of perilla leaf extract；
2) stabilizer that formula ratio is added into the mixture of antibacterial peptide and perilla leaf extract, continues 1~2h of stirring, i.e.,
.
Further, the preparation method of the perilla leaf extract includes the following steps：
1) perilla leaf is taken, perilla leaf is dried to and is less than 5% containing water quality, later by the perilla leaf crushing after drying and mistake
100 mesh sieve, and obtain perilla leaf powder；
2) it takes the perilla leaf powder in step 1), add the water of 30~50 times of perilla leaf silty amounts and is heated to 30~50 DEG C,
It is perilla leaf extract to be filtered to remove the leaching liquor after impurity.
Further, the filtering is filtered using 200 mesh gauzes.
Application of the Heveatex preservative agent in latex preservation, the quality of the Heveatex preservative agent added in Heveatex
Percentage is 0.05~0.1%；The mass percent of the Heveatex preservative agent added in concentrated latex is 0.2~0.8%.
Beneficial effects of the present invention：
The Heveatex preservative agent of the present invention, the fungicide such as antibacterial peptide, perilla leaf extract can kill the bacterium in latex,
Prevent carbohydrate and Rumen protein fermentation in latex from decomposing.Stabilizer can maintain electric equilibrium in latex, improve the stability of latex, have
Effect prevents latex coagulation rotten.In addition, the Heveatex preservative agent of the application it is soluble easily in water, it is difficult volatilization, it is environmentally friendly, non-stimulated, steady
It is qualitative good, it is preferable to the preservation effect of natural emulsion and concentrated latex and free from environmental pollution.
The preparation method of the Heveatex preservative agent of the present invention, preparation method are simple to operation.
Specific implementation mode
It elaborates further below to the present invention.
Embodiment 1
The amino acid sequence of the antibacterial peptide of the present embodiment is：
Gly-Cys-Lys-Gly-Gly-Cys-Asn-Ile-Phe-Gly-Ile-Cys-Lys-Cys- Tyr (such as SEQ ID
NO:Shown in 1).Name antibacterial peptide is Bac.Cecropin B gene ac is the thermophilic Halomonas (Halomonas in deep-sea from India ocean bottom
Axialensis separation obtains in).The corresponding nucleotide series of antibacterial peptide are：
GGATGCAAAGGAGGATGCAACATCTTCGGAATTTGCAAGTGCTAT (such as SEQ ID NO:Shown in 2).
The preparation method of antibacterial peptide：
Two-way amplimer F1 and R1 is designed according to the corresponding nucleotide sequence of antibacterial peptide, is added respectively at primer both ends
I restriction enzyme site of Nde I and Xho.
Primer sequence is as follows：
F1：5 '-AGAAGGAGATATACATATGGATGCAAA-3 ' (such as SEQ ID NO:Shown in 3)；
R1：5 '-TGGTGGTGGTGGTGCTCGAGTAGCACTTGCAAA-3 ' (such as SEQ ID NO:Shown in 4).
Using I/Xho of Nde I digestion pET30a (+) plasmid, the product after digestion is subjected to agarose electrophoresis and cuts glue returning
It receives, it is pET30a-Vector to name the product.Using In-Fusion HD Cloning Kits (purchased from the limited public affairs of precious bioengineering
Department) composition sequence is attached with pET30a-Vector, and take the product thermal transition of 2.5 μ L to E.coli JM109Competent
In Cells, selects positive bacteria and fall behind extraction plasmid.The plasmid of extraction is converted to competent cell E.coli BL21 (DE) T1R
In, positive bacterium colony is selected as expression bacterial strain.37 DEG C of shaking table culture E.coli BL21 express bacterial strain, until light absorption value (OD600nm) be
100mM IPTG to final concentration of 1mM are added when 0.6, continue the 8h that ferments.It will be centrifuged through 10000r after zymotic fluid ultrasonication
20min abandons the final product that sediment takes supernatant as cecropin B gene ac.
Embodiment 2
The preparation method of the purple perilla extract of the present embodiment：
1) perilla leaf by fresh picking is dried, and it is 4.5% to be dried to containing water quality.Use vibration grinding device pair
Perilla leaf after drying is crushed and is sieved with 100 mesh sieve, and obtains perilla leaf powder.
2) the perilla leaf powder in step 1) is taken to be put into reaction kettle, and 50 times of perilla leaf silty amounts of addition into reaction kettle
Water.The mixture of perilla leaf powder and water is heated to 50 DEG C and is maintained in this temperature 8h, while to the mixing of perilla leaf powder and water
Object is stirred.After heating, the mixture of perilla leaf powder and water in reaction kettle is filtered using 200 mesh gauzes,
The leaching liquor removed after impurity is perilla leaf extract.
The Heveatex preservative agent of the present embodiment, including volume ratio are 1:1 fungicide and stabilizer.Fungicide is antibacterial
The mixture of peptide and perilla leaf extract.Antibacterial peptide uses method in embodiment 1 to prepare.Perilla leaf extract uses the present embodiment
It is prepared by middle perilla leaf extract preparation method.The volume ratio of antibacterial peptide and perilla leaf extract is 1:5.Stabilizer is dodecyl
Benzene sulfonate aqueous solution, the mass percent of neopelex is 0.1% in sodium dodecyl benzene sulfonate aqueous solution.
The preparation method of the Heveatex preservative agent of the present embodiment, includes the following steps：
1) antibacterial peptide and perilla leaf extract for taking formula ratio, are put into reaction kettle and are uniformly mixed, be heated to 35 DEG C,
Obtain the mixture of antibacterial peptide and perilla leaf extract.
2) sodium dodecyl benzene sulfonate aqueous solution of formula ratio is added into the mixture of antibacterial peptide and perilla leaf extract,
35 DEG C are maintained to continue to stir 1h to get Heveatex preservative agent.Heveatex preservative agent is stored in the clean plastics of PET materials
It in bucket, is protected from light, preserves in the cool, using finishing in 1 month.
Application of the Heveatex preservative agent of the present embodiment in latex preservation, the Heveatex added in Heveatex are protected
The mass percent for depositing agent is 0.01%.The mass percent of the Heveatex preservative agent added in concentrated latex is 0.1%.
Embodiment 3
The preparation method of the purple perilla extract of the present embodiment：
1) perilla leaf by fresh picking is dried, and it is 4% to be dried to containing water quality.Using vibration grinding device to drying
Perilla leaf after dry is crushed and is sieved with 100 mesh sieve, and obtains perilla leaf powder.
2) the perilla leaf powder in step 1) is taken to be put into reaction kettle, and 30 times of perilla leaf silty amounts of addition into reaction kettle
Water.The mixture of perilla leaf powder and water is heated to 40 DEG C and is maintained in this temperature 8h, while to the mixing of perilla leaf powder and water
Object is stirred.After heating, the mixture of perilla leaf powder and water in reaction kettle is centrifuged using tube centrifuge
Filtering, the leaching liquor removed after impurity is perilla leaf extract.
The Heveatex preservative agent of the present embodiment, including volume ratio are 1:1 fungicide and stabilizer.Fungicide is antibacterial
The mixture of peptide and perilla leaf extract.Antibacterial peptide uses method in embodiment 1 to prepare.Perilla leaf extract uses the present embodiment
It is prepared by middle perilla leaf extract preparation method.The volume ratio of antibacterial peptide and perilla leaf extract is 3:7.Stabilizer is that carboxymethyl is fine
The plain sodium water solution of dimension, the mass percent of sodium carboxymethylcellulose is 0.07% in sodium carboxymethyl cellulose solution.
The preparation method of the Heveatex preservative agent of the present embodiment, includes the following steps：
1) antibacterial peptide and perilla leaf extract for taking formula ratio, are put into reaction kettle and are uniformly mixed, be heated to 30 DEG C,
Obtain the mixture of antibacterial peptide and perilla leaf extract.
2) sodium carboxymethyl cellulose solution of formula ratio, dimension are added into the mixture of antibacterial peptide and perilla leaf extract
It holds 30 DEG C and continues to stir 2h to get Heveatex preservative agent.Heveatex preservative agent is stored in the clean plastic barrel of PET materials
In, it is protected from light, preserves in the cool, using finishing in 1 month.
Application of the Heveatex preservative agent of the present embodiment in latex preservation, the Heveatex added in Heveatex are protected
The mass percent for depositing agent is 0.05%.The mass percent of the Heveatex preservative agent added in concentrated latex is 0.2%.
Embodiment 4
The preparation method of the purple perilla extract of the present embodiment：
1) perilla leaf by fresh picking is dried, and it is 4% to be dried to containing water quality.Equipment is smashed using rotating blade
Perilla leaf after drying is crushed and sieved with 100 mesh sieve, perilla leaf powder is obtained.
2) the perilla leaf powder in step 1) is taken to be put into reaction kettle, and 40 times of perilla leaf silty amounts of addition into reaction kettle
Water.The mixture of perilla leaf powder and water is heated to 30 DEG C and is maintained in this temperature 8h, while to the mixing of perilla leaf powder and water
Object is stirred.After heating, the mixture of perilla leaf powder and water in reaction kettle is filtered using 200 mesh gauzes,
The leaching liquor removed after impurity is perilla leaf extract.
The Heveatex preservative agent of the present embodiment, including volume ratio are 1:3 fungicide and stabilizer.Fungicide is antibacterial
The mixture of peptide and perilla leaf extract.Antibacterial peptide uses method in embodiment 1 to prepare.Perilla leaf extract uses the present embodiment
It is prepared by middle perilla leaf extract preparation method.The volume ratio of antibacterial peptide and perilla leaf extract is 2:9.Stabilizer is that carboxymethyl is fine
The plain sodium water solution of dimension, the mass percent of sodium carboxymethylcellulose is 0.07% in sodium carboxymethyl cellulose solution.
The preparation method of the Heveatex preservative agent of the present embodiment, includes the following steps：
1) antibacterial peptide and perilla leaf extract for taking formula ratio, are put into reaction kettle and are uniformly mixed, be heated to 40 DEG C,
Obtain the mixture of antibacterial peptide and perilla leaf extract.
2) sodium carboxymethyl cellulose solution of formula ratio, dimension are added into the mixture of antibacterial peptide and perilla leaf extract
It holds 40 DEG C and continues to stir 2h to get Heveatex preservative agent.Heveatex preservative agent is stored in the clean plastic barrel of PET materials
In, it is protected from light, preserves in the cool, using finishing in 1 month.
Application of the Heveatex preservative agent of the present embodiment in latex preservation, the Heveatex added in Heveatex are protected
The mass percent for depositing agent is 0.1%.The mass percent of the Heveatex preservative agent added in concentrated latex is 0.5%.
Embodiment 5
The preparation method of the purple perilla extract of the present embodiment：
1) perilla leaf by fresh picking is dried, and it is 3.5% to be dried to containing water quality.Use vibration grinding device pair
Perilla leaf after drying is crushed and is sieved with 100 mesh sieve, and obtains perilla leaf powder.
2) the perilla leaf powder in step 1) is taken to be put into reaction kettle, and 40 times of perilla leaf silty amounts of addition into reaction kettle
Water.The mixture of perilla leaf powder and water is heated to 50 DEG C and is maintained in this temperature 8h, while to the mixing of perilla leaf powder and water
Object is stirred.After heating, the mixture of perilla leaf powder and water in reaction kettle is filtered using 200 mesh gauzes,
The leaching liquor removed after impurity is perilla leaf extract.
The Heveatex preservative agent of the present embodiment, including volume ratio are 1:2 fungicide and stabilizer.Fungicide is antibacterial
The mixture of peptide and perilla leaf extract.Antibacterial peptide uses method in embodiment 1 to prepare.Perilla leaf extract uses the present embodiment
It is prepared by middle perilla leaf extract preparation method.The volume ratio of antibacterial peptide and perilla leaf extract is 1:2.Stabilizer is dodecyl
Benzene sulfonate aqueous solution, the mass percent of neopelex is 0.1% in sodium dodecyl benzene sulfonate aqueous solution.
The preparation method of the Heveatex preservative agent of the present embodiment, includes the following steps：
1) antibacterial peptide and perilla leaf extract for taking formula ratio, are put into reaction kettle and are uniformly mixed, be heated to 40 DEG C,
Obtain the mixture of antibacterial peptide and perilla leaf extract.
2) sodium carboxymethyl cellulose solution of formula ratio, dimension are added into the mixture of antibacterial peptide and perilla leaf extract
It holds 40 DEG C and continues to stir 2h to get Heveatex preservative agent.Heveatex preservative agent is stored in the clean plastic barrel of PET materials
In, it is protected from light, preserves in the cool, using finishing in 1 month.
Application of the Heveatex preservative agent of the present embodiment in latex preservation, the Heveatex added in Heveatex are protected
The mass percent for depositing agent is 0.1%.The mass percent of the Heveatex preservative agent added in concentrated latex is 0.5%.
Embodiment 6
The preparation method of the purple perilla extract of the present embodiment：
1) perilla leaf by fresh picking is dried, and it is 3.5% to be dried to containing water quality.Use vibration grinding device pair
Perilla leaf after drying is crushed and is sieved with 100 mesh sieve, and obtains perilla leaf powder.
2) the perilla leaf powder in step 1) is taken to be put into reaction kettle, and 40 times of perilla leaf silty amounts of addition into reaction kettle
Water.The mixture of perilla leaf powder and water is heated to 50 DEG C and is maintained in this temperature 8h, while to the mixing of perilla leaf powder and water
Object is stirred.After heating, the mixture of perilla leaf powder and water in reaction kettle is filtered using 200 mesh gauzes,
The leaching liquor removed after impurity is perilla leaf extract.
The Heveatex preservative agent of the present embodiment, including volume ratio are 1:1 fungicide and stabilizer.Fungicide is antibacterial
The mixture of peptide and perilla leaf extract.Antibacterial peptide uses method in embodiment 1 to prepare.Perilla leaf extract uses the present embodiment
It is prepared by middle perilla leaf extract preparation method.The volume ratio of antibacterial peptide and perilla leaf extract is 1:4.Stabilizer is dodecyl
Benzene sulfonate aqueous solution, the mass percent of neopelex is 0.1% in sodium dodecyl benzene sulfonate aqueous solution.
The preparation method of the Heveatex preservative agent of the present embodiment, includes the following steps：
1) antibacterial peptide and perilla leaf extract for taking formula ratio, are put into reaction kettle and are uniformly mixed, be heated to 40 DEG C,
Obtain the mixture of antibacterial peptide and perilla leaf extract.
2) sodium carboxymethyl cellulose solution of formula ratio, dimension are added into the mixture of antibacterial peptide and perilla leaf extract
It holds 40 DEG C and continues to stir 2h to get Heveatex preservative agent.Heveatex preservative agent is stored in the clean plastic barrel of PET materials
In, it is protected from light, preserves in the cool, using finishing in 1 month.
Application of the Heveatex preservative agent of the present embodiment in latex preservation, the Heveatex added in Heveatex are protected
The mass percent for depositing agent is 0.2%.The mass percent of the Heveatex preservative agent added in concentrated latex is 1.0%.
Test example 1
The natural emulsion preservative agent prepared in embodiment 2 is accounted for into fresh latex mass percent according to natural emulsion preservative agent
It is added in the fresh latex of acquisition, is stirred well to uniformly mixed for 0.01~0.2% amount.It is measured in latex every 12h
The content of volatile fatty acid.It is lasting to detect to 72h.Volatile fatty acid test according to the method in GB/T8292-2008 into
Row test.Test result is as shown in table 1.
The volatile fatty acid number of 1 Heveatex of table
Under normal conditions, the content of volatile fatty acid is to evaluate the important finger of latex system degree of spoilage in fresh latex
Mark.As can be seen from Table 1, additive amount is the volatility of the fresh latex experimental group of 0.05% and 0.1% Heveatex preservative agent
Content of fatty acid is held essentially constant, and preservation effect is preferable.The experimental group volatile fatty acid number that additive amount is 0.01wt% is aobvious
It writes and is promoted.
Test example 2
The natural emulsion preservative agent prepared in embodiment 2 is accounted for into concentrated latex mass percent according to natural emulsion preservative agent
It is added in the fresh latex of acquisition, is stirred well to uniformly mixed for 0.1~1.0% amount.It measures in latex and waves every 12h
The content of hair property aliphatic acid.It is lasting to detect to 72h.Volatile fatty acid test is carried out according to the method in GB/T8292-2008
Test.Test result is as shown in table 2.
The volatile fatty acid number of 2 concentrated latex of table
As can be seen from Table 2, the concentrated latex of the preservative agent of the present invention of additive amount 0.2%, 0.5%, 0.8% and 1.0% is real
Group is tested, Volatile fatty acid contents are held essentially constant, and preservation effect is preferable.Additive amount is the experimental group volatility of 0.1wt%
Fatty acid value is obviously improved.
Sequence table
<110>Thailand's ten thousand bedding products of element（China）Co., Ltd
<120>Heveatex preservative agent and preparation method thereof and its application
<130> 2018
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 45
<212> PRT
<213> Halomonas axialensis
<400> 1
Gly Leu Tyr Cys Tyr Ser Leu Tyr Ser Gly Leu Tyr Gly Leu Tyr Cys
1 5 10 15
Tyr Ser Ala Ser Asn Ile Leu Glu Pro His Glu Gly Leu Tyr Ile Leu
20 25 30
Glu Cys Tyr Ser Leu Tyr Ser Cys Tyr Ser Thr Tyr Arg
35 40 45
<210> 2
<211> 45
<212> DNA
<213> Halomonas axialensis
<400> 2
ggatgcaaag gaggatgcaa catcttcgga atttgcaagt gctat 45
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 3
agaaggagat atacatatgg atgcaaa 27
<210> 4
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 4
tggtggtggt ggtgctcgag tagcacttgc aaa 33
Claims (8)
1. Heveatex preservative agent, which is characterized in that including volume ratio be 1:1~1:3 fungicide and stabilizer；Fungicide is
The volume ratio of the mixture of antibacterial peptide and perilla leaf extract, antibacterial peptide and perilla leaf extract is 1:2~1:5.
2. Heveatex preservative agent according to claim 1, which is characterized in that the amino acid sequence of the antibacterial peptide is such as
SEQ ID NO:Shown in 1.
3. Heveatex preservative agent according to claim 1, which is characterized in that the stabilizer is dodecyl benzene sulfonic acid
One or both of sodium water solution or sodium carboxymethyl cellulose solution.
4. Heveatex preservative agent according to claim 3, which is characterized in that the sodium dodecyl benzene sulfonate aqueous solution
The mass percent of middle neopelex is 0.1%, sodium carboxymethylcellulose in sodium carboxymethyl cellulose solution
Mass percent is 0.07%.
5. the preparation method of Heveatex preservative agent as described in claim 1, which is characterized in that the preparation method include with
Lower step：
1) antibacterial peptide and perilla leaf extract of formula ratio are taken, is uniformly mixed, is heated to 30~40 DEG C, obtains antibacterial peptide and perilla leaf
The mixture of extract；
2) into the mixture of antibacterial peptide and perilla leaf extract add formula ratio stabilizer, continue 1~2h of stirring to get.
6. the preparation method of Heveatex preservative agent according to claim 5, which is characterized in that the perilla leaf extract
Preparation method include the following steps：
1) perilla leaf is taken, perilla leaf is dried to and is less than 5% containing water quality, the perilla leaf after drying is crushed later and crosses 100
Mesh sieves, and obtains perilla leaf powder；
2) the perilla leaf powder in step 1) is taken, the water of 30~50 times of perilla leaf silty amounts is added and is heated to 30~50 DEG C, filtering
The leaching liquor removed after impurity is perilla leaf extract.
7. Heveatex preservative agent according to claim 6, which is characterized in that the filtering is carried out using 200 mesh gauzes
Filtering.
8. application of the Heveatex preservative agent as described in claim 1 in latex preservation, which is characterized in that in Heveatex
The mass percent of the Heveatex preservative agent of addition is 0.05~0.1%；The Heveatex preservative agent added in concentrated latex
Mass percent be 0.2~0.8%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810533827.7A CN108659146B (en) | 2018-05-29 | 2018-05-29 | Natural latex preservative and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810533827.7A CN108659146B (en) | 2018-05-29 | 2018-05-29 | Natural latex preservative and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108659146A true CN108659146A (en) | 2018-10-16 |
| CN108659146B CN108659146B (en) | 2020-07-14 |
Family
ID=63774137
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810533827.7A Active CN108659146B (en) | 2018-05-29 | 2018-05-29 | Natural latex preservative and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108659146B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115710322A (en) * | 2021-08-23 | 2023-02-24 | 中国热带农业科学院橡胶研究所 | Ammonia-free composite preservative for concentrated natural latex |
| WO2023144631A1 (en) * | 2022-01-26 | 2023-08-03 | Aflatex Technologies, Lda | Ammonia-free latex compositions |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105348413A (en) * | 2015-12-10 | 2016-02-24 | 中国热带农业科学院农产品加工研究所 | Method for controlling volatile fatty acid of natural latex |
| CN106046204A (en) * | 2016-06-06 | 2016-10-26 | 云南珩森生物科技有限公司 | Biological preservation technique for natural latex |
| CN106244565A (en) * | 2016-07-28 | 2016-12-21 | 黄润燕 | A kind of natural rubber fresh-keeping enzyme of breast and the method for concentrated natural latex rubber thereof |
| CN106565862A (en) * | 2015-10-12 | 2017-04-19 | 海南大学 | Natural latex ammonia-free preservative and preservation method thereof |
-
2018
- 2018-05-29 CN CN201810533827.7A patent/CN108659146B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106565862A (en) * | 2015-10-12 | 2017-04-19 | 海南大学 | Natural latex ammonia-free preservative and preservation method thereof |
| CN105348413A (en) * | 2015-12-10 | 2016-02-24 | 中国热带农业科学院农产品加工研究所 | Method for controlling volatile fatty acid of natural latex |
| CN106046204A (en) * | 2016-06-06 | 2016-10-26 | 云南珩森生物科技有限公司 | Biological preservation technique for natural latex |
| CN106244565A (en) * | 2016-07-28 | 2016-12-21 | 黄润燕 | A kind of natural rubber fresh-keeping enzyme of breast and the method for concentrated natural latex rubber thereof |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115710322A (en) * | 2021-08-23 | 2023-02-24 | 中国热带农业科学院橡胶研究所 | Ammonia-free composite preservative for concentrated natural latex |
| CN115710322B (en) * | 2021-08-23 | 2024-02-23 | 中国热带农业科学院橡胶研究所 | Concentrated natural latex ammonia-free composite preservative |
| WO2023144631A1 (en) * | 2022-01-26 | 2023-08-03 | Aflatex Technologies, Lda | Ammonia-free latex compositions |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108659146B (en) | 2020-07-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Milledge et al. | Ensilage and anaerobic digestion of Sargassum muticum | |
| Hessen | The relation between bacterial carbon and dissolved humic compounds in oligotrophic lakes | |
| Ogamba et al. | Water quality and proximate analysis of Eichhornia crassipes from River Nun, Amassoma Axis, Nigeria | |
| AU2013221643A1 (en) | Microalgae enriched with trace minerals | |
| CN108659146A (en) | Heveatex preservative agent and preparation method thereof and its application | |
| Negreanu-Pîrjol et al. | Physical-chemical characterization of some green and red macrophyte algae from the Romanian Black Sea littoral | |
| CN101139225A (en) | Method for preparing fertilizer by using water bloom blue algae as raw material | |
| Hulyal et al. | Water quality assessment of Almatti Reservoir of Bijapur (Karnataka State, India) with special reference to zooplankton | |
| WO2007003112A1 (en) | Fast thermal permeating contact herbicide without environment pollution | |
| Affan et al. | Variation of Spirulina maxima biomass production in different depths of urea-used culture medium | |
| CN108323531A (en) | A kind of function composition and its preparation method and application containing the antibacterial polypeptide of plant | |
| Anbarasu et al. | Physico-chemical parameter analysis of water in Musiri Taluk, Tamil Nadu, India | |
| Tai et al. | Future prospects of duck production in Asia | |
| Alber et al. | Incorporation of organic aggregates by marine mussels | |
| Ochigbo et al. | Comparison of two creaming methods for preparation of natural rubber latex concentrates from field latex | |
| Wondmagegne et al. | Seasonality in abundance, biomass and production of the phytoplankton of Welala and Shesher wetlands, Lake Tana sub-basin (Ethiopia) | |
| CN101205092A (en) | Ecological fibre flocculating water purification transparent deodorant | |
| Lysáková et al. | The epipelic algae at fishponds of Central and Northern Moravia (the Czech Republic) | |
| CN108975958A (en) | A kind of sterile processing systems of poultry manure and the method for preparing biological organic fertilizer | |
| Rakko et al. | Algal blooms in Estonian small lakes | |
| CN108605996B (en) | Cinnamomum camphora-based biological algicide and preparation method thereof | |
| Lima et al. | Studies on growth in the early adult of the freshwater mussel, Anodonta cygnea | |
| Olele | Nutrient composition of macrophytes harvested from in Onah lake | |
| Deka et al. | Utilization of lime sludge waste from paper mills for fish culture | |
| Hakiki et al. | Application of fungi Aspergillus sp. from leaf litter Rhizophora mucronata Lamk. to accelerate decomposition on various salinity levels in Belawan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |