CN108642178A - Detection method, kit and the application to methylate for colorectal cancer related gene - Google Patents
Detection method, kit and the application to methylate for colorectal cancer related gene Download PDFInfo
- Publication number
- CN108642178A CN108642178A CN201810379698.0A CN201810379698A CN108642178A CN 108642178 A CN108642178 A CN 108642178A CN 201810379698 A CN201810379698 A CN 201810379698A CN 108642178 A CN108642178 A CN 108642178A
- Authority
- CN
- China
- Prior art keywords
- lad1
- gene
- detection
- kit
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the detection method to methylate for colorectal cancer related gene, kit and applications.The present invention relates to the specific primers pair and probe for detecting LAD1 gene methylations, and nucleotide sequence is respectively as shown in NO.1~4 SEQ ID.The present invention also provides the application of the specific primer pair and/or probe, detection LAD1 gene methylations kit and LAD1 gene methylation detection methods.The detection method of the present invention has high pass flow characteristic and hypersensitivity, and without carrying out the operations such as electrophoresis and molecule hybridization after PCR, pollution and operating error in experimentation can be reduced, the time can also be saved and save reagent consumption, testing cost can not only be reduced, detection efficiency is improved, will be early diagnosed for colorectal cancer and noninvasive rapid screening provides effective means, and had a good application prospect.
Description
Technical field
The invention belongs to field of biological detection, more particularly to be used for colorectal cancer related gene methylate detection method,
Kit and application.
Background technology
Due to existing Screening Method for Colorectal Cancer, as colonoscopy, excrement sDNA are checked, S-CEA
(CEA) horizon check, that there are efficiency is low, accuracy is low or invasive feature, causes colorectal cancer patients that cannot obtain in time
Diagnosis, most colorectal cancer patients have been in later stage of development when being found, treatment and outcome are bad.Therefore, one is found
Kind of simple, safety, the methods for screening that specificity is high, sensitivity is high are the key that current colorectal cancer prevention and treatment.
As important one of epigenetic modification, it sends out DNA methylation (DNA methylation) with tumour
It opens up in close relations.The DNA methylation of narrow sense refers to be mediated by dnmt rna (DNA methyhransferase, DNMT), with
S-adenosylmethionine is methyl donor, and a methyl group is covalently bound to 5 carbon of cytimidine (Cytoine, Cyt) ring
On, become the chemical modification process of 5-methylcytosine (5-methylcytosine, 5-mC).DNA methylation typically occurs in
In CpG dinucleotides, play an important role to the expression and regulation and control of gene.Currently, DNA methylation has been applied to tumour mechanism and has examined
Control research.Mainly using tumor tissues in the DNA methylation research of colorectal cancer, but since acquisition difficulty is big, tumour
Tissue sample is not particularly suited for extensive screening and early diagnosis.Researchers attempt from Noninvasive biological sample (such as blood)
Find biomarker.Such sample has many advantages, such as that easy, DNA methylation is collected, operates and handled to suitable great amount of samples
It is expected to become non-invasive tumor marker source, preferably to apply to clinic.
Since some tumor suppressor gene abnormal methylations are often happened at the beginning of tumour formation, early detection can operate with.And
Confounding Factor may cause the false positive of detection, the problem of early detection most critical to be to discriminate between the phases such as non-tumour such as age, diet
What is closed methylates and methylates with tomour specific, and when design studies scheme is considered as various Confounding Factors or selects independent individual.To the greatest extent
Pipe has the early diagnosis that the DNA methylation assays such as some tumor suppressor genes such as SPG20, FBN1, VIM are used for colorectal cancer at present, but past
It is past to will appear specific or not strong sensitivity feature.
The method for being commonly used to be detected gene methylation at present has methylation status of PTEN promoter (MS-PCR), bisulfite
The methods of salt treatment and sequencing.MS-PCR methods are economical and practical, are not necessarily to specific apparatus, therefore be the side being most widely used at present
Method.After bisulf iotate-treated, you can carry out MS-PCR.In traditional MSP methods, two pairs of primers are commonly designed, it is a pair of
DNA profiling of the MSP primer amplifications after bisulf iotate-treated, and another pair expands non-methylation fragment.If pair of primers
Segment can be amplified, then illustrates that the detection site exists and methylates, if second pair of primer can amplify segment, illustrate the detection
There is no methylate in site.This method high sensitivity, can be used for paraffin embedding sample, and do not limited by restriction endonuclease.But
It also suffers from certain drawbacks, the primer for needing that the DNA sequence dna of segment to be measured is known in advance, and having designed, this is most important.Separately
Outside, if there are the incomplete situation of bisulf iotate-treated, that may lead to false positive.Bisulf iotate-treated and sequencing were once
It is considered as the goldstandard of DNA methylation analysis.Its process is as follows：After bisulf iotate-treated, with PCR amplification purpose
Segment, and PCR product is sequenced, sequence is compared with untreated sequence, judges whether the sites CpG occur first
Base.This method is reliable, and accuracy is high, the methylation state in each site CpG in the segment that can have a definite purpose, but needs
A large amount of cloning and sequencing, process are relatively complicated, expensive.
Therefore, the technical problems such as DNA methylation assay is specific or sensitivity is not strong are also to be solved.
Invention content
The first object of the present invention be the shortcomings that overcoming the prior art with it is insufficient, for improve DNA methylation assay specificity or
The problems such as sensitivity is not strong provides specific primer pair and probe for detecting LAD1 gene methylations.
The second object of the present invention is to provide the application of the specific primer pair and probe.
The third object of the present invention is to provide the kit for detecting LAD1 gene methylations.
The fourth object of the present invention is to provide the LAD1 gene methyl based on the specific primer pair and/or probe
Change detection method, is methylated and unmethylated DNA using the specific primer and/or probe of the present invention to distinguish.
The purpose of the invention is achieved by the following technical solution：
Specific primer pair for detecting LAD1 gene methylations：
LAD1-mF：GATTATCGGGTGTCGTAGTTC, (as shown in SEQ ID NO.1)
LAD1-mR：CCCTAACGCAACGTACGCG.(as shown in SEQ ID NO.2)
With the specific primer to the use of fluorescence probe, including following any sequence：
(1) TGAGTAGAATAAGGAGAGATTAT, (as shown in SEQ ID NO.3)
(2)ACAACTAACACTTAACATTATAAC.(as shown in SEQ ID NO.4)
The fluorescence probe holds mark fluorescent reporter group the 5 ' of the sequence, and at its 3 ' end, mark fluorescent is quenched
Group.
The specific primer pair and/or fluorescence probe answering in the kit for preparing detection LAD1 gene methylations
With.
A kind of biomarker for detecting LAD1 gene methylations, nucleotide sequence is as shown in SEQ ID NO.7.
A kind of kit of detection LAD1 gene methylations, including the specific primer pair.
The kit of the detection LAD1 gene methylations can also include following for further confirming that non-methylate
As a result primer pair：
LAD1-uF：AGATTATTGGGTGTTGTAGTTT, (as shown in SEQ ID NO.5)
LAD1-uR：AACCCTAACACAACATACACA.(as shown in SEQ ID NO.6)
The kit of the detection LAD1 gene methylations also includes the fluorescence probe or DNA fluorescent dyes.
The kit of the detection LAD1 gene methylations can also include positive criteria product, negative quality-control product, PCR
At least one of reaction solution, PCR enzymes.
The positive criteria product is to be inserted into the carrier of the biomarker for detecting LAD1 gene methylations
Plasmid.
A kind of LAD1 gene methylations detection method, using the specific primer as shown in NO.1~2 SEQ ID and such as
Fluorescence probe shown in NO.5~6 SEQ ID or fluorescent dye carry out real-time quantitative PCR, detect the LAD1 bases in sample to be tested
Because of the 26th and the 27th methylation (Fig. 1) of promoter region.
When carrying out real-time fluorescence PCR using fluorescent dye, optimum reaction condition is：95 DEG C of pre-degeneration, 10min；95 DEG C,
15s, 60 DEG C, 60s, 40 cycles；95 DEG C are warming up to from 75 DEG C with 1 DEG C of rate of every 20s heatings, obtains solubility curve.
When carrying out real-time fluorescence PCR using fluorescence probe, optimum reaction condition is：95 DEG C, 20min；50 PCR are followed
Ring is first warming up to 62 DEG C, 5s, then be cooled to 56 DEG C each in cycle, reacts 35s, is finally warming up to 94 DEG C, reacts 20s；50
It is cooled to 40 DEG C after a circular response, reacts 30s.
When the real-time quantitative PCR be sonde method when, with the specific primer to the use of fluorescence probe
Preferably as shown in NO.3~4 SEQ ID.
The LAD1 gene methylation detection methods can also further draw using as shown in NO.5~6 SEQ ID
Object is further confirmed that carrying out the real-time quantitative PCR result to methylate non-to LAD1 genes, to further increase result standard
True property.If only methylated primers expand, illustrate that the 26th and 27 is methylated；If the primer to methylate
It is all expanded with the non-primer to methylate, illustrates that there was only the 26th or 27 in the site is methylated；If only
Non- methylated primers expand, then illustrate that the two sites are completely non-methylate.
The sample to be tested is preferably blood sample.
The kit or described of the specific primer pair and/or probe, the detection LAD1 gene methylations
Application of the LAD1 gene methylations detection method in colorectal cancer detection.
The present invention is quasi- using detection of the fluorescence method to the middle LAD1 gene methylations of sample to be tested DNA that methylate.Using spy
The skill of handling needles and decoration method carry out real time PCR detections to specific methylation sites.The amount of signal strength and PCR product is at just
Than the methylation of sample can be calculated accordingly.
LAD1 is the newfound colorectal cancer tumor suppressor gene of applicant, and ImmunohistochemistryResults Results prompt it and colorectal cancer
TNM stage and lymphatic metastasis are negatively correlated, and theoretical research prompts the gene related with the anoikis of colorectal cancer cell.However
At present with regard to LAD1 individually and its combine other genes as the detection method that colorectal cancer early diagnose there is no study report.This hair
It is bright to utilize detection of the fluorescence method to the middle LAD1 gene methylations of sample to be tested DNA that methylate, it is examined as colorectal cancer early stage
Disconnected new supplementary means.Such method utilizesProbe or DNA fluorescent dyes and PCR primer methylate distinguishing and
Unmethylated DNA.First use bisulf iotate-treated DNA fragmentation, and design one can with the probe of site to be measured complementation, with
After carry out real-time quantitative PCR.
It has been found that the LAD1 of sample to be tested (such as blood sample) DNA of normal person is without methylating, and colorectal cancer
The LAD1 methylations of patient's sample to be tested (such as blood sample) dramatically increase.Therefore patient from now on is suggested to be measured to its
Sample (such as blood sample) DNA is first detected, if it find that LAD1 methylations dramatically increase, will be suggested in patient's progress
The conventional detections such as mirror are made a definite diagnosis in order to the state of an illness.
The present invention has the following advantages and effects with respect to the prior art：
1. detection method used in the present invention has high pass flow characteristic, one will be provided for the noninvasive rapid screening of colorectal cancer
Fixed reference.
2. the present invention can not only be reduced in experimentation and be polluted without carrying out the operations such as electrophoresis and molecule hybridization after PCR
And operating error, moreover it is possible to save the time and save reagent consumption, therefore the present invention can not only reduce testing cost, improve detection effect
Rate.
3. detection method used in the present invention has the characteristics that hypersensitivity, and the LAD1 to methylate is colon carcinogenesis
Early stage has just occurred, which provides reference for colorectal cancer early diagnosis.
4. the present invention is by methylating and the non-knot to methylate to the non-of LAD1 gene specific sites with real-time quantitative PCR
Fruit double check, to confirm that the reliability of this detection method and the accuracy of testing result provide foundation.
5. the present invention with two kinds of real time quantitative PCR methods by being studied, it was demonstrated that LAD1 gene specific site methyl
Changing detection has experimental feasibility, and provides important evidence for clinical application.
Description of the drawings
Fig. 1 is LAD1 gene promoter region sequence schematic diagrames.
Fig. 2 is fluorescent quantitative PCR curve graph (the colorectal cancer trouble of primer LAD1-mF, LAD1-mR in embodiment 1
Person).
Fig. 3 is fluorescent quantitative PCR solubility curve figure (the colorectal cancer trouble of primer LAD1-mF, LAD1-mR in embodiment 1
Person).
Fig. 4 is the fluorescent quantitative PCR curve graph of reference gene ATCB in embodiment 1.
Fig. 5 is the fluorescent quantitative PCR solubility curve figure of reference gene ATCB in embodiment 1.
Fig. 6 is the fluorescent quantitative PCR curve graph (normal person) of primer LAD1-uF, LAD1-uR in embodiment 1.
Fig. 7 is the fluorescent quantitative PCR solubility curve figure (normal person) of primer LAD1-uF, LAD1-uR in embodiment 1.
Fig. 8 is the specific curve graph of LAD1 in embodiment 3, wherein horizontal axis is 1- specificities, and the longitudinal axis is sensitivity.
Specific implementation mode
Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited
In this.
1 fluorescent dye determination of embodiment
1.DNA is extracted
The blood DNA of normal person and colorectal cancer patients are extracted using the blood extraction DNA kits of Qiagen 51183,
Concrete operation step is as follows：
(1) plus in 20 μ L Protease K to 1.5mL centrifuge tubes.
(2) add the sample liquid of 200 μ L (50~100 μ L anticoagulations supplement PBS to 220 μ L).
(3) add the Buffer AL, vortex 15s of 200 μ L.
(4) 56 DEG C of incubation 10min, until cracking completely.
(5) rapid centrifugation.
(6) add 200 μ L ethyl alcohol (100%), vortex 15s, rapid centrifugation.
(7) for transfer mixed liquor to Spin column (2mL collecting pipes), 6000g or 8000rpm renew pipe from 1min, abandon
Fall old collecting pipe.
(8) plus 500 μ L Buffer AW1, vortex 15s, 6000g or 8000rpm abandon old pipe and renew pipe from 1min.
(9) add 500 μ L Buffer AW2, vortex 15s, (20,000g or 14,000rpm) are from 1min at full speed.
(10) renew pipe, (20,000g or 14,000rpm) blank pipe centrifuges 3min at full speed.
(11) new centrifuge tube, 100 greenhouses μ L Buffer AE incubate 5min, 6000g or 8000rpm, and from 1min, repetition is washed
It is 3 times de-.
2. bisulfite handles DNA
Said gene group DNA carries out bisulfite processing with 59104 methylating reagent boxes of German Qiagen, and operation is pressed
Book carries out as directed.
Bisulfite mixture is dissolved with no RNA enzyme water, respective substance is added to the PCR of 200 μ L by following system
It manages (130 μ L systems)：
1 PCR reaction systems of table
It mixes well, is placed at room temperature for 15~25 minutes, following programs are then carried out in PCR instrument：95 DEG C 5 minutes, 60 DEG C
25 minutes, 95 DEG C 5 minutes, 60 DEG C 85 minutes, 95 DEG C 5 minutes, 60 DEG C 175 minutes, finally enter 20 DEG C of maintenances.
PCR pipe is taken out, after slightly centrifuging, content is gone into 1.5mL Eppendorf pipes, it is slow that the 560 fresh BL of μ L are added
Fliud flushing, BL are added vector rna by the concentration of 10 μ g/mL, mix well, and the above content is transferred to centrifugation column compartment after slightly centrifuging
Temperature was discarded the liquid under, centrifugal column is placed back in collecting pipe, washed with 500 μ L BW liquid with maximum velocity centrifugation 1 minute
Once, 500 μ L BD liquid are added, are placed at room temperature for 15 minutes, then room temperature, maximum velocity centrifugation 1 minute is washed twice with BW liquid
(500 μ L every time), then sky from 1 minute to remove residual liquid as possible, centrifugal column lid is opened, new 1.5mL is put into
Eppendorf is managed, and 56 DEG C are placed 5 minutes, are added dropwise 20 μ L EB liquid on the film of centrifugal column, and room temperature 15000g centrifuges 1 minute, i.e.,
Treated DNA to be measured.
3. real-time quantitative PCR
Using the DNA to be measured that step 2 obtains as template, quantitative PCR is carried out respectively with corresponding primer pair.
(1) 0.2mL PCR pipes are taken, reaction system as shown in Table 2 is prepared, each reverse transcription product prepares 3 pipes.
2 m-LAD1 primer PCR reaction systems of table
3 u-LAD1 primer PCR reaction systems of table
(2) 0.2mL PCR pipes are taken, reaction system as shown in table 4 is prepared, each reaction system prepares 3 pipes.
4 reference gene ATCB PCR reaction systems of table
Wherein, ACTB genes and probe primer are as follows：
ACTB-F GTGATGGAGGTTTAGTAAGTT
ACTB-R CCAATAAAACCTACTCCTCCCTTAA
Probe primer ACCACCACCCAACACACAATAACAAACACA
(3) PCR amplification
95 DEG C of pre-degeneration, 10min；
It recycles 95 DEG C of (40 times), 15s → 60 DEG C, 60s；
75 DEG C → 95 DEG C of solubility curve heats up 1 DEG C per 20s.
(4) melt curve analysis is analyzed
SDS softwares are run, and set melt curve analysis program：95℃15s；60℃15s；95℃15s.
4. interpretation of result
Real-time fluorescence quantitative PCR interpretation of result：After amplification, into interpretation of result interface, CT values, starting copies are seen
Number, standard deviation and solubility curve etc..Using ATCB as internal reference gene, compared with the control group, the phase of destination gene expression is obtained
To quantitative values (RQ values), RQ values are used for statistical analysis.If detection site methylates, Q-PCR will appear accordingly
Fluorescence intensity；Otherwise there is not fluorescence to occur in cycle at 40, then explanation changes site and do not methylate.Fig. 2 is from knot
The amplification curve of the DNA extracted in patients with bowel cancer blood sample；Solubility curve as shown in figure 3, solubility curve be simple spike, dissolving
Temperature is about 85.8 DEG C.Fig. 4, Fig. 5 are the amplification curve and solubility curve of reference gene ACTB.
In addition we reversely test the blood sample of normal person using the primer (LAD1-uF, LAD1-uR) of u-LAD1
Card illustrates that the site is non-methylation state if Q-PCR recycles the interior corresponding fluorescence intensity of appearance at 40；It is followed at 40
There is not fluorescence to occur in ring, then it is methylating state that explanation, which changes site,.As a result as shown in Figure 5 and Figure 6, illustrate the present invention
The LAD1 gene methylations detection method established is accurate, reliable.
2 sonde method of embodiment
1.DNA is extracted
Operation is the same as embodiment 1.
2. bisulfite handles DNA
Operation is the same as embodiment 1.
3. real-time quantitative PCR
Using the DNA to be measured that step 2 obtains as template, quantitative PCR is carried out respectively with corresponding primer pair and probe.
(1) sample to be tested PCR reaction systems
The total volume of PCR reaction systems is 30 μ L.
The program of PCR reactions is 95 DEG C, 20min；50 PCR cycles are first warming up to 62 DEG C, 5s, then drop each in cycle
Temperature reacts 35s to 56 DEG C, is finally warming up to 94 DEG C, reacts 20s；It is cooled to 40 DEG C after 50 circular responses, reacts 30s, PCR
Reaction terminates.
Each 30 μ L of PCR reaction systems, end reaction system concentration reach：Magnesium chloride (MgCl2) 2.5mM, dNTP
0.25mM, LAD1 primer (LAD1-mF, LAD1-mR) 350nM, blocking agent primer (as shown in SEQ ID NO.11) 100nM,
LAD1 probes 70nM (probe as shown in SEQ ID NO.3,5 ' end flag F AM of sequence, in its 3 ' end label TAMRA),
ACTB gene primers (upstream and downstream) 170nM, ACTB gene probe 70nM, archaeal dna polymerase 1.5U, DNA profiling 2~20ng/ μ L are mended
Fill 10 × PCR cachings liquid buffer to 30 μ L of total volume.
Wherein the upstream and downstream primer of ACTB genes, probe are the same as embodiment 1.
(2) interpretation of result
Real-time fluorescence quantitative PCR interpretation of result：After amplification, into interpretation of result interface, CT values, starting copies are seen
Number, standard deviation etc..Using ATCB as internal reference gene, compared with the control group, the relative quantification value (RQ of destination gene expression is obtained
Value), RQ values are used for statistical analysis.If detection site methylates, Q-PCR will appear corresponding fluorescence intensity；
Otherwise there is not fluorescence to occur in cycle at 40, then explanation changes site and do not methylate.
3 sonde method of embodiment
1.DNA is extracted
Operation is the same as embodiment 1.
2. bisulfite handles DNA
Operation is the same as embodiment 1.
3. real-time quantitative PCR
Using the DNA to be measured that step 2 obtains as template, quantitative PCR is carried out respectively with corresponding primer pair and probe.
(1) sample to be tested PCR reaction systems
The total volume of PCR reaction systems is 30 μ L.
The program of PCR reactions is 95 DEG C, 20min；50 PCR cycles are first warming up to 62 DEG C, 5s, then drop each in cycle
Temperature reacts 35s to 56 DEG C, is finally warming up to 94 DEG C, reacts 20s；It is cooled to 40 DEG C after 50 circular responses, reacts 30s, PCR
Reaction terminates.
Each 30 μ L of PCR reaction systems, end reaction system concentration reach：Magnesium chloride (MgCl2) 2.5mM, dNTP
0.25mM, LAD1 primer (LAD1-mF, LAD1-mR) 350nM, blocking agent primer (as shown in SEQ ID NO.11) 100nM,
LAD1 probes 70nM (probe as shown in SEQ ID NO.4,5 ' end flag F AM of sequence, in its 3 ' end label TAMRA),
ACTB gene primers (upstream and downstream) 170nM, ACTB gene probe 70nM, archaeal dna polymerase 1.5U, DNA profiling 2~20ng/ μ L are mended
Fill 10 × PCR cachings liquid buffer to 30 μ L of total volume.
Wherein the upstream and downstream primer of ACTB genes, probe are the same as embodiment 1.
(2) interpretation of result
Real-time fluorescence quantitative PCR interpretation of result：After amplification, into interpretation of result interface, CT values, starting copies are seen
Number, standard deviation etc..Using ATCB as internal reference gene, compared with the control group, the relative quantification value (RQ of destination gene expression is obtained
Value), RQ values are used for statistical analysis.If detection site methylates, Q-PCR will appear corresponding fluorescence intensity；
Otherwise there is not fluorescence to occur in cycle at 40, then explanation changes site and do not methylate.
Further the primer (LAD1-uF, LAD1-uR) of u-LAD1 is used reversely to test the blood sample of normal person
Card illustrates that the site is non-methylation state if Q-PCR recycles the interior corresponding fluorescence intensity of appearance at 40；It is followed at 40
There is not fluorescence to occur in ring, then it is methylating state that explanation, which changes site,.
4 clinical effectiveness embodiment of embodiment
Subjects are divided into 3 groups, i.e. colorectal cancer group 79, colorectal polypus group 73 and healthy control group 146.
After acquiring peripheral blood blood sample, mLAD1 in the PCR fluorescence probe methods detection periphery blood plasma of Application Example 1 analyzes the gene masculine
The relationship of rate and Colon and rectum clinical pathologic characteristic, and make comparisons with CEA and (or) CAl9-9 positive rates (CEA and CAl9-9 detections
Method is referring to effect and Mechanism Study [D] of the silaenafils in mouse colitis correlation canceration forever of document woods generation；South doctor
University of section, 2017.).Statistical analysis is using Chi-square Test or the Chi-square Test of correction for continuity.
Analysis result finds that colorectal cancer group blood plasma mLAD1 positive rates are 71.05% (54/76), and colorectal polypus group is
5.80% (4/69), healthy control group are 3.68% (5/136), and colorectal cancer group mLAD1 positive rates are apparently higher than other two groups
(P<0.01).Susceptibilitys of the blood plasma mLAD1 in colorectal cancer patients is 71.05%, specificity 82.5%.With serum other
Tumor markers are compared, colorectal cancer patients blood plasma mLAD1 positive rates be apparently higher than CEA, CA19-9 and joint-detection CEA,
The positive rate of CAl9-9, respectively 71.05% (54/76), 34.21% (26/76), 18.42% (14/76), 40.79% (31/
76), the statistically significant (χ of comparing difference two-by-two2=20.689,42.577,14.119, P it is equal<0.01).Conclusion Colon and rectum
Cancer patients serum's mLAD1 positive rates obviously increase, and detect the gene has important clinical meaning in the diagnosis of colorectal cancer.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, it is other it is any without departing from the spirit and principles of the present invention made by changes, modifications, substitutions, combinations, simplifications,
Equivalent substitute mode is should be, is included within the scope of the present invention.
Sequence table
<110>South China Science ＆ Engineering University
<120>Detection method, kit and the application to methylate for colorectal cancer related gene
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Specific primer LAD1-mF
<400> 1
gattatcggg tgtcgtagtt c 21
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Specific primer LAD1-mR
<400> 2
ccctaacgca acgtacgcg 19
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Probe 1
<400> 3
tgagtagaat aaggagagat tat 23
<210> 4
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Probe 2
<400> 4
acaactaaca cttaacatta taac 24
<210> 5
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Specific primer LAD1-uF
<400> 5
agattattgg gtgttgtagt tt 22
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Specific primer LAD1-uR
<400> 6
aaccctaaca caacatacac a 21
<210> 7
<211> 267
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Biomarker nucleotide sequence
<400> 7
ggttgggttt attttagtgt attggcgaat ggagtggggg cgcgcggggc tggcgcgagg 60
aaatggctgg gtttttattg gagattttat atttgcaggg tttgttttgg cgtaattaat 120
gttgggtttg gttgggctgg cgctttggcg tttgtgattt atttggcagc ttgcttagcg 180
ctttggcttg ctgcttgcgg gctttggctg tattttgatt agctgatggg ctttgctttt 240
gttttttgaa ggatgagttt tggttag 267
<210> 8
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Primer ACTB-F
<400> 8
gtgatggagg tttagtaagt t 21
<210> 9
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Primer ACTB-R
<400> 9
ccaataaaac ctactcctcc cttaa 25
<210> 10
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>ACTB probes
<400> 10
accaccaccc aacacacaat aacaaacaca 30
<210> 11
<211> 37
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Blocking agent primer
<400> 11
attagttatt atgttggatt ttgtggttaa tgtgtag 37
Claims (10)
1. the specific primer pair for detecting LAD1 gene methylations, it is characterised in that：
It is made of sense primer and downstream primer,
The sense primer is：GATTATCGGGTGTCGTAGTTC,
The downstream primer is：CCCTAACGCAACGTACGCG.
2. with specific primer described in claim 1 to the use of fluorescence probe, which is characterized in that including following arbitrary
Sequence：
(1) TGAGTAGAATAAGGAGAGATTAT,
(2)ACAACTAACACTTAACATTATAAC。
3. the fluorescence probe described in specific primer pair described in claim 1 and/or claim 2 is preparing detection LAD1 bases
Application in the kit that cause methylates.
4. a kind of biomarker for detecting LAD1 gene methylations, it is characterised in that：
Its nucleotide sequence is as shown in SEQ ID NO.7.
5. a kind of kit of detection LAD1 gene methylations, it is characterised in that：
Including specific primer pair described in claim 1.
6. the kit of detection LAD1 gene methylations according to claim 5, which is characterized in that can also include as follows
Primer pair for further confirming that the non-result that methylates：
LAD1-uF：AGATTATTGGGTGTTGTAGTTT,
LAD1-uR：AACCCTAACACAACATACACA.
7. the kit of detection LAD1 gene methylations according to claim 5 or 6, it is characterised in that：
Also include fluorescence probe as claimed in claim 2 or fluorescent dye.
8. a kind of LAD1 gene methylations detection method, it is characterised in that：
Using the specific primer pair as shown in NO.1~2 SEQ ID and the fluorescence probe as shown in NO.5~6 SEQ ID or
Fluorescent dye carries out real-time quantitative PCR, detects the LAD1 gene methylation degree in sample to be tested.
9. LAD1 gene methylations detection method according to claim 8, it is characterised in that：
Further include the steps that carrying out real-time quantitative PCR using the primer pair as shown in NO.3~4 SEQ ID.
10. the detection LAD1 described in specific primer pair and/or fluorescence probe, claim 5~7 described in claims 1 to 3
LAD1 gene methylations detection method described in the kit of gene methylation, claim 8 or 9 is in colorectal cancer detection
Using.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810379698.0A CN108642178A (en) | 2018-04-25 | 2018-04-25 | Detection method, kit and the application to methylate for colorectal cancer related gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810379698.0A CN108642178A (en) | 2018-04-25 | 2018-04-25 | Detection method, kit and the application to methylate for colorectal cancer related gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108642178A true CN108642178A (en) | 2018-10-12 |
Family
ID=63747742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810379698.0A Pending CN108642178A (en) | 2018-04-25 | 2018-04-25 | Detection method, kit and the application to methylate for colorectal cancer related gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108642178A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009122444A2 (en) * | 2008-03-31 | 2009-10-08 | Council Of Scientific & Industrial Research | Method for the diagnosis of higher- and lower-grade astrocytoma using biomarkers and diagnostic kit thereof |
| CN102628080A (en) * | 2012-03-31 | 2012-08-08 | 浙江大学医学院附属邵逸夫医院 | Application of protocadherin (PCDH) 17 genes |
-
2018
- 2018-04-25 CN CN201810379698.0A patent/CN108642178A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009122444A2 (en) * | 2008-03-31 | 2009-10-08 | Council Of Scientific & Industrial Research | Method for the diagnosis of higher- and lower-grade astrocytoma using biomarkers and diagnostic kit thereof |
| CN102628080A (en) * | 2012-03-31 | 2012-08-08 | 浙江大学医学院附属邵逸夫医院 | Application of protocadherin (PCDH) 17 genes |
Non-Patent Citations (2)
| Title |
|---|
| 张艳等: "DNA甲基化PCR引物的设计", 《第三军医大学学报》 * |
| 朱景德等: "《表观遗传学与精准医学》", 31 December 2017 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017124854A1 (en) | Primers, probe and kit for detecting ndrg4 gene methylation for early diagnosis of intestinal cancer | |
| CN112322736B (en) | Reagent combination for detecting liver cancer, kit and application thereof | |
| CN108977543A (en) | A kind of colorectal cancer early diagnosis reagent based on joint-detection SDC2 and SFRP2 gene methylation level | |
| CN104164516B (en) | A kind of primer based on the detection of Human colorectal carcinoma specific methylation and test kit | |
| CN112646888B (en) | Kit for detecting mammary tumor specific methylation | |
| CN107630093B (en) | Reagent, kit, detection method and application for diagnosing liver cancer | |
| CN112280865A (en) | Reagent combination for detecting liver cancer, kit and application thereof | |
| CN108624691A (en) | A kind of marker and its application for judging prostatic disorders | |
| CN106048021A (en) | Primer combination for detecting mutation of genes P53 in micro-tissues and application of primer combination | |
| CN107164519A (en) | A kind of primer and probe that ESR1 gene mutations are detected based on fluorescent PCR | |
| US11535897B2 (en) | Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer | |
| CN113862370B (en) | Primer, probe and kit for screening liver cancer and application of kit | |
| CN108642178A (en) | Detection method, kit and the application to methylate for colorectal cancer related gene | |
| CN108642177A (en) | A kind of method, kit and the application of detection excrement LAD1 gene methylations | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN107904310A (en) | Urine microRNA biomarkers, kit and its application for diagnosis of colorectal carcinoma | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN107326092A (en) | Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker | |
| CN106916893A (en) | A kind of gene methylation degree quantitative approach based on digital pcr chip | |
| CN105969874B (en) | Primer for detecting KRAS gene mutation in microcomponent combines and its application | |
| CN115948561B (en) | Reagent and detection kit for esophageal squamous carcinoma diagnosis or auxiliary diagnosis and application thereof | |
| CN114150065B (en) | Marker for colorectal cancer or precancerous lesion and application thereof | |
| CN116064792B (en) | Multi-gene DNA methylation joint detection kit for colorectal cancer diagnosis and application | |
| CN107746886A (en) | A kind of blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis and its application | |
| Lin-Lin et al. | Quantitative detection of gene methylated level of stool samples based on invader assay coupled with real-time polymerase chain reaction and its application in non-invasive screening of colorectal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181012 |