CN108642149A - A kind of quantitative detecting method of pig manure antibiotics resistance gene - Google Patents
A kind of quantitative detecting method of pig manure antibiotics resistance gene Download PDFInfo
- Publication number
- CN108642149A CN108642149A CN201810407462.3A CN201810407462A CN108642149A CN 108642149 A CN108642149 A CN 108642149A CN 201810407462 A CN201810407462 A CN 201810407462A CN 108642149 A CN108642149 A CN 108642149A
- Authority
- CN
- China
- Prior art keywords
- resistant gene
- genes
- pig manure
- gene
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of quantitative detecting method of antibiotics resistance gene in pig manure, step is：1) it is template to select and often take the pig manure DNA of antibiotic pig, using PCR amplification purpose resistance gene fragment；2) the purpose resistant gene after gel extraction purifying amplification, resistant gene is connected in carrier T, then transformed competence colibacillus Bacillus coli cells, positive clone molecule is selected after applying LB tablets；3) quality for expanding culture bacterium solution is detected with agarose gel electrophoresis, choosing clones successful bacterium solution and extracts plasmid, detects plasmid concentration, converses the copy number of resistant gene entrained by plasmid, and it is spare for dilution gradient dilution by 10 times, as resistant gene standard items；4) genomic DNA for extracting pig manure sample, quantitative pcr amplification is carried out at the same time by pig manure sample DNA and resistant gene standard items, to finally obtain the resistant gene copy number of pig manure sample.For the present invention independent of microculture, easy to operate, detection speed is high, high sensitivity, also more intuitive in quantity.
Description
Technical field
Patent of the present invention belongs to field of environment engineering technology, and in particular to antibiotics resistance gene quantifies in a kind of pig manure
Detection method.
Background technology
Tetracycline is a kind of common antibiotic, and livestock breeding industry is largely used to as veterinary drug and growth accelerator.Research card
Bright major part antibiotic is difficult to be absorbed and utilized by animal, about 25 ~ 75% antibiotic without metabolism and in the form of parent compound with
Fecaluria excretes.In the environment, the drug resistance of the microorganism in antibiotic meeting induced environment generates selection pressure, induction production
Raw tetracycline resistance gene（ARGs）.Resistant gene has stronger horizontal transfer ability, can be in soil, underground water and each
It migrates, convert in a surrounding medium, and be likely to be brought into food chain with r plasmid etc. and eventually enter into human body, increase human body
Once antibiotic resistance these resistant genes entered in pathogenic bacteria from environmental microorganism, human health will be constituted
Potential threat.Therefore, the fecaluria for remaining antibiotic is discharged into environment or uses the excrement for remaining antibiotic as organic
Fertilizer is administered in farmland, and long-term potential hazard is constituted to health and the entire ecosystem.
Antibiotics resistance gene is as a kind of novel environmental pollution, and type is various, enormous amount, such as so far,
It is more than 40 kinds that Tetracyclines resistant gene, which just has three categories, establishes the quantitative detecting method of resistant gene in pig manure, for into
One step systematically monitors in Pollution from livestock and poultry object antibiotics resistance gene and its to evaluate its ecological risk significant, simultaneously
It is also significant for the control in resistant gene Pollution from livestock and poultry source.Currently, in the extraction research of pig manure resistant gene, do not have
The pig manure resistant gene standard items of commercialization, and regular-PCR can only qualitatively detect the presence or absence of gene, and also sensitivity is not
It is high.
Invention content
In order to solve the above-mentioned technical problem, patent of the present invention provides a kind of quantitative detection of antibiotics resistance gene in pig manure
Method.It is as follows：
1) it should includes the antibiosis corresponding to purpose resistant gene to select the pig for often taking antibiotic, the Antibiotics taken
Element；The genomic DNA of pig manure is extracted with pig manure genome extracts kit (Fast DNA spin kit for manure),
And using pig manure DNA as template, using PCR amplification purpose resistance gene fragment, length should be in 168-171bp, purpose resistance
Gene groups mainly have Tetracyclines resistant gene tetM genes, tetO genes, tetW genes, tetT genes；
2）Using the target gene fragment after the purifying amplification of DNA gel purification kits, segment is connected to pGEM-T
On Easy carriers, then transformed competence colibacillus Bacillus coli cells, positive clone molecule is selected after applying tablet（White bacterial plaque）Again it connects
Enter in LB liquid medium and cultivate, then dip a small amount of template using culture solution is expanded with M13-RV47, if the positive, then
Expanded with LB culture solutions and cultivated, 1mL bacterium solution sequence verifications is then taken to be inserted into gene segment；
3）The successful bacterium solution of selected clone extracts plasmid, detects plasmid concentration, converses the copy of resistant gene entrained by plasmid
Number, and it is spare for dilution gradient dilution by 10 times, as resistant gene standard items；
4）Pig manure sample DNA and resistant gene standard items are carried out at the same time quantitative pcr amplification, according to copying for resistant gene standard items
Shellfish number and the CT values of its amplification generate standard curve, and then obtain the copy number of the resistant gene of pig manure sample.
In patent of the present invention, plasmid concentration is converted into the formula of the absolute template copy numbers entrained by every μ L plasmid solutions
For：Copies/ μ L=[x/ (a+b) × 660] × 10-9×6.02×1023, wherein x is plasmid concentration (ng/ μ L)；A is to carry
Body length (bp)；B is purpose resistant gene length (bp).
In patent of the present invention, the reaction system volume of PCR amplifications is 25 μ L：Including 0.125 μ L 5U μ L-1 Ex Taq
DNA polymerases, 2.5 μ L buffer solution 10 × Ex Taq buffer（Containing Mg2 +）, 2 a concentration of 2mmolL of μ L-1DNTPs,
A concentration of 20 μm of olL of 0.25 μ L-1Upstream and downstream primer, 0.5 μ L dilute 10 times of DNA samples, and surplus is secondary heavy steaming
Water；And reaction condition is：Pre-degeneration 4min at 94 DEG C, 94 DEG C of 45s, anneal 45s, 72 DEG C of 1min, 35 cycles, and last 72
Extend 6min at DEG C.
In patent of the present invention, purpose resistant gene is that the front and back primer sequence of Tetracyclines resistant gene tetM is respectively
ACAGAAAGCTTATTATATAAC, TGGCGTGTCTATGATGTTCAC；Annealing temperature is 45 DEG C；Resistant gene is Fourth Ring
The front and back primer sequence of plain class resistant gene tetO genes is respectively
ACGGARAGTTTATTGTATACC, TGGCGTATCTATAATGTTGAC；Annealing temperature is 45 DEG C；Resistant gene is Fourth Ring
The front and back primer sequence of plain class resistant gene tetT genes is respectively
AAGGTTTATTATATAAAAGTG, AGGTGTATCTATGATATTTAC；40 DEG C of annealing temperature；Resistant gene is tetracycline
The front and back primer sequence of class resistant gene tetW genes is respectively
GAGAGCCTGCTATATGCCAGC, GGGCGTATCCACAATGTTAAC；The reaction of 60 DEG C of of annealing temperature and quantitative PCR
System is 25 μ L, including 2 μ L（About 1.27 ng μ L-1）Template DNA, 12.5 μ L fluorescent dye SYBR Premix Ex Taq,
Front and back each 200 nmolL of primer-1。
And quantitative PCR response procedures：Purpose resistant gene is that the quantitative PCR of Tetracyclines resistant gene tetM genes reacts
After program is 95 DEG C of 1min, 40 cycles are 94 DEG C of 10s, 45 DEG C of 45s, 80 DEG C of 6s；Purpose resistant gene is tetracycline
After the quantitative PCR response procedures of class resistant gene tetO genes are 95 DEG C of 1min, 40 cycles are 94 DEG C of 10s, 45 DEG C of 45s,
81℃ 10s；Purpose resistant gene is that the quantitative PCR response procedures of Tetracyclines resistant gene tetT genes are 95 DEG C of 1min
Afterwards, 40 cycles are 94 DEG C of 10s, and the resistant gene of 40 DEG C of 45s, 79 DEG C of 6s mesh are Tetracyclines resistant gene tetW genes
Quantitative PCR response procedures be 95 DEG C of 1min after, 40 cycles are 94 DEG C of 10s, 60 DEG C of 45s, 83 DEG C of 10s.
The characteristics of patent of the present invention is that resistant gene standard items are quickly and accurately made using pig manure DNA sample, with pig manure
The extraction of sample resistant gene has preferable matching.Plasmid standard can preserve at -20 DEG C, and primary prepare can use 10-
20 times.The present invention is easy to operate, high to the detection speed of sample, the high sensitivity of testing result, also more intuitive in quantity；No
Dependent on microculture, the resistant gene entrained by uncultured microorganisms can be detected, make finally obtained quantized result
More fully with it is credible.
Patent of the present invention specifies Tetracyclines resistant gene tetM genes, tetO genes, tetW genes, tetT in pig manure
The quantitative detecting method of gene, while being alternatively other resistant genes and offer reference is quantitatively provided.
Specific implementation mode
It takes and takes excrement 0.25g caused by the pig of antibiotic for a long time, be used for plasmid extraction；Take the pig manure sample on certain pig farm
Three parts, every part of 0.25g；I.e. three parallel.Taken pig manure uses soil genome extracts kit (Fast DNA spin kit
For manure) it extracts and extracts DNA respectively, solvent is respectively 100 μ L；
Front and back primer is chosen respectively,
tetM：ACAGAAAGCTTATTATATAAC, TGGCGTGTCTATGATGTTCAC；Product length 171bp
tetO：ACGGARAGTTTATTGTATACC, TGGCGTATCTATAATGTTGAC；Product length 171bp
tetT：AAGGTTTATTATATAAAAGTG, AGGTGTATCTATGATATTTAC；Product length 169bp
tetW：GAGAGCCTGCTATATGCCAGC, GGGCGTATCCACAATGTTAAC；Product length 168bp
It is that template carries out PCR amplification with the pig manure sample DNA for the pig for taking antibiotic, regular-PCR reaction system is 25 μ L：Packet
Include 0.125 μ L 5U μ L-1Ex Taq DNA polymerases, 2.5 μ L buffer solution 10 × Ex Taq buffer（Containing Mg2 +）, 2 μ L
A concentration of 2mmolL-1DNTPs, a concentration of 20 μm of olL of 0.25 μ L-1Each primer, 0.5 μ L dilute 10 times of DNA
Sample, surplus are secondary redistilled water；And reaction condition is：Pre-degeneration 4min at 94 DEG C, 94 DEG C of 45s, anneal 45s, 72 DEG C
1min, 35 recycle, and extend 6min at last 72 DEG C.
Genetic fragment tetM after gel extraction purifying amplification（171 bp）、tetO（171 bp）、 tetT（169bp）With
tetW（168bp）.Segment is connected on pGEM-T Easy carriers, then transformed competence colibacillus Bacillus coli cells, is converted
Escherichia coli afterwards through cultivating 1h on 37 DEG C, 150pm shaking tables, be then uniformly applied to the benzyl of ammonia containing 100mg/L Penicillium,
On the LB culture medium flat plates of 0.5mMIPTG and 80mg/LX-Gal, 37 DEG C are incubated overnight.Then white bacterial plaque is selected to access again
Suspend culture in LB liquid medium（37℃、16h）, 1 μ L bacterium solutions is taken to carry out bacterium solution PCR verifying purpose genes.
Take positive bacterium solution 3mL extraction plasmid respectively, plasmid be sent to sequencing company sequencing, according to return come sequencing result exist
After comparison insertion gene segment is correct on the websites NCBI, plasmid concentration is detected with NanoDrop, according to reduction formula Copies/ μ
L=[x/ (a+b) × 660] × 10-9×6.02×1023, wherein x is plasmid concentration；A is pGEM-T Easy carriers
Length（3015bp）；B is purpose antibiotics resistance gene length.Then converse the copy of purpose resistant gene entrained by plasmid
Number, and become standard items by 10 times for dilution gradient dilution.
Pig manure sample DNA and standard items are carried out at the same time quantitative pcr amplification, specifically include 25 μ L, including 2 μ L（About 1.27
ng·μL-1）Template DNA, 12.5 μ L fluorescent dyes SYBR Premix Ex Taq, each 200 nmolL of upstream and downstream primer-1,
Surplus is secondary redistilled water.After the quantitative PCR response procedures of purpose resistant gene tetM genes are 95 DEG C of 1min, 40 cycles
For 94 DEG C of 10s, 45 DEG C of 45s, 80 DEG C of 6s；After the quantitative PCR response procedures of tetO genes are 95 DEG C of 1min, 40 cycles
For 94 DEG C of 10s, 45 DEG C of 45s, 81 DEG C of 10s；After the quantitative PCR response procedures of tetT genes are 95 DEG C of 1min, 40 cycles
For 94 DEG C of 10s, 40 DEG C of 45s, 79 DEG C of 6s；After the quantitative PCR response procedures of tetW genes are 95 DEG C of 1min, 40 cycles
For 94 DEG C of 10s, 60 DEG C of 45s, 83 DEG C of 10s.
The standard curve for then obtaining each purpose resistant gene is tetM y=- 3.2092x+43.076, R2=0.9917；
tetT：Y=- 2.92x+41.112, R2=0.9938；
tetO：Y=- 3.2968x+42.052, R2=0.9923；
tetW：Y=- 3.3259x+43.076, R2=0.9932。
The above x is log10 target gene copy numbers, and y is critical cycle number, i.e. the CT values reading of quantitative PCR instrument.By with
Upper curve can obtain, and the linear relationship of Ct values and target gene copy number is very strong（R2 Between 0.992 ~ 0.994）, amplification efficiency
E is 91.8% ~ 105.0%, and according to standard curve, calculating target gene copy number tetT is（4.45 ±0.25）×107
copies·g -1 （Dry sample）, tet M are（3.92 ±0.54）×107 copies·g -1（Dry sample）, tet O are（1.65
±0.07）×107 copies·g -1（Dry sample）, tetW is（2.16±0.20）×108 copies·g-1（Dry sample）.By pig
Four kinds of resistant genes are compared in excrement, it is found that genes of the tetW in pig manure is above other genes, more other genes, in pig
It is more universal in excrement.
Comparative example 1
The annealing temperature of tetM genes in embodiment, tetO genes, tetT genes, tetW genes is improved 5 DEG C, then
The R of standard curve corresponding to tetM genes2Value is 0.917, and amplification efficiency E is 76.5%；
The R of standard curve corresponding to tetO genes2Value is 0.923, and amplification efficiency E is 75.4%；
The R of standard curve corresponding to tetT genes2Value is 0.901, and amplification efficiency E is 73.2%；
The R of standard curve corresponding to tetW genes2Value is 0.912, and amplification efficiency E is 73.6%；
Generate the R of standard curve2Value should be greater than 0.98, and closer to 1, credible result degree is higher.The range of amplification efficiency E is answered
It is more ideal closer to 1 in 80%-120%.Therefore, the copy number of finally obtained every gram of argol purpose resistant gene can not
It leans on.
Comparative example 2
The annealing temperature of tetM genes in embodiment, tetO genes, tetT genes, tetW genes is reduced by 5 DEG C, then
The R of standard curve corresponding to tetM genes2Value is 0.923, and amplification efficiency E is 77.6%；
The R of standard curve corresponding to tetO genes2Value is 0.945, and amplification efficiency E is 76.4%；
The R of standard curve corresponding to tetT genes2Value is 0.911, and amplification efficiency E is 72.2%；
The R of standard curve corresponding to tetW genes2Value is 0.932, and amplification efficiency E is 71.6%；
Generate the R of standard curve2Value should be greater than 0.98, and closer to 1, credible result degree is higher.The range of amplification efficiency E is answered
It is more ideal closer to 1 in 80%-120%.Therefore, the copy number of finally obtained every gram of argol purpose resistant gene can not
It leans on.
Claims (6)
1. the quantitative detecting method of antibiotics resistance gene in pig manure, it is characterised in that include the following steps：
1）The DNA of the pig manure of antibiotic pig is often taken in extraction, using pig manure DNA as template, using PCR amplification purpose resistant gene
Segment；
2）Purpose resistance gene fragment after gel extraction purifying amplification, pGEM-T Easy carriers are connected to by resistant gene
On, it is then transferred to competent E.coli, Escherichia coli apply LB tablets, then select positive clone molecule after culture after conversion,
Expanded with LB culture solutions and is cultivated；
3）The quality for expanding culture bacterium solution is detected with agarose gel electrophoresis, the successful bacterium solution of selected clone extracts plasmid, detection
Plasmid concentration converses the copy number of resistant gene entrained by plasmid, and spare for dilution gradient dilution by 10 times, as anti-
Property gene standard items；
4）Pig manure sample DNA and resistant gene standard items are carried out at the same time quantitative PCR amplification, according to resistant gene standard items
Copy number and the CT values of its amplification generate standard curve, and then obtain the copy number of the resistant gene of pig manure sample.
2. according to the quantitative detecting method of antibiotics resistance gene in the soil described in claim 1, it is characterised in that：
The purpose resistant gene is：Tetracyclines resistant gene tetM genes, tetO genes, tetW genes, tetT genes
The purpose resistant gene, the length of 168-171bp.
3. the quantitative detecting method of antibiotics resistance gene, feature exist in pig manure according to claim 1
In：In the step 3), the formula that plasmid concentration is converted into the absolute template copy numbers entrained by every μ L plasmid solutions is：
Copies/ μ L=[x/ (a+b) × 660] × 10-9×6.02×1023, wherein x is plasmid concentration (ng/ μ L)；A is
Carrier lengths (bp)；B is purpose resistant gene length (bp).
4. the quantitative detecting method of antibiotics resistance gene in pig manure according to claim 1, it is characterised in that：
In the step 1), the reaction system volume of PCR amplifications is 25 μ L：Including
0.125 μ L of 5U μ L-1 Ex Taq DNA polymerases,
Buffer solution 10 × Ex Taq buffer（Containing Mg2 +）2.5 μ L,
The 2 μ L of dNTPs of a concentration of 2mmolL-1,
Each 0.25 μ L of primer of a concentration of 20 μm of olL-1,
The 0.5 μ L of DNA samples of 10 times of dilution
Surplus is secondary redistilled water；
Reaction condition is：
Pre-degeneration 4min at 94 DEG C, 94 DEG C of 45s, anneal 45s, 72 DEG C of 1min, 35 cycles, extends at last 72 DEG C
6min。
5. the quantitative detecting method of antibiotics resistance gene in pig manure according to claim 1, it is characterised in that：
When purpose resistant gene is Tetracyclines resistant gene tetM genes, front and back primer sequence is respectively
ACAGAAAGCTTATTATATAAC, TGGCGTGTCTATGATGTTCAC；Annealing temperature is 45 DEG C；
When purpose resistant gene is Tetracyclines resistant gene tetO genes, front and back primer sequence is respectively
ACGGARAGTTTATTGTATACC, TGGCGTATCTATAATGTTGAC；Annealing temperature is 45 DEG C；
When purpose resistant gene is Tetracyclines resistant gene tetT genes, front and back primer sequence is respectively
AAGGTTTATTATATAAAAGTG, AGGTGTATCTATGATATTTAC；40 DEG C of annealing temperature；
When purpose resistant gene is Tetracyclines resistant gene tetW genes, front and back primer sequence is respectively
GAGAGCCTGCTATATGCCAGC, GGGCGTATCCACAATGTTAAC；60 DEG C of annealing temperature.
6. the quantitative detecting method of antibiotics resistance gene in pig manure according to claim 1, it is characterised in that：It is quantitative
The reaction system of PCR is 25 μ L, including（About 1.27 ng μ L-1）Template DNA 2 μ L, fluorescent dye SYBR Premix Ex
Taq12.5 μ L, front and back each 200 nmolL of primer-1, quantitative PCR response procedures：
When purpose resistant gene is Tetracyclines resistant gene tetM genes, after quantitative PCR response procedures are 95 DEG C of 1min,
40 cycles are 94 DEG C of 10s, 45 DEG C of 45s, 80 DEG C of 6s；
When purpose resistant gene is Tetracyclines resistant gene tetO genes, after quantitative PCR response procedures are 95 DEG C of 1min,
40 cycles are 94 DEG C of 10s, 45 DEG C of 45s, 81 DEG C of 10s；
When purpose resistant gene is Tetracyclines resistant gene tetT genes, after quantitative PCR response procedures are 95 DEG C of 1min,
40 cycles are 94 DEG C of 10s, 40 DEG C of 45s, 79 DEG C of 6s；
When purpose resistant gene is Tetracyclines resistant gene tetW genes, after quantitative PCR response procedures are 95 DEG C of 1min,
40 cycles are 94 DEG C of 10s, 60 DEG C of 45s, 83 DEG C of 10s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810407462.3A CN108642149A (en) | 2018-05-02 | 2018-05-02 | A kind of quantitative detecting method of pig manure antibiotics resistance gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810407462.3A CN108642149A (en) | 2018-05-02 | 2018-05-02 | A kind of quantitative detecting method of pig manure antibiotics resistance gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108642149A true CN108642149A (en) | 2018-10-12 |
Family
ID=63748455
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810407462.3A Pending CN108642149A (en) | 2018-05-02 | 2018-05-02 | A kind of quantitative detecting method of pig manure antibiotics resistance gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108642149A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109652512A (en) * | 2019-01-28 | 2019-04-19 | 南京师范大学 | The quantitative detecting method of drug resistant gene in Taihu Lake water body and deposit |
-
2018
- 2018-05-02 CN CN201810407462.3A patent/CN108642149A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109652512A (en) * | 2019-01-28 | 2019-04-19 | 南京师范大学 | The quantitative detecting method of drug resistant gene in Taihu Lake water body and deposit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ruuskanen et al. | Fertilizing with animal manure disseminates antibiotic resistance genes to the farm environment | |
| McIlroy et al. | Identification of active denitrifiers in full‐scale nutrient removal wastewater treatment systems | |
| Wagner et al. | Removal of free extracellular DNA from environmental samples by ethidium monoazide and propidium monoazide | |
| Yamaguchi et al. | In situ DNA‐hybridization chain reaction (HCR): a facilitated in situ HCR system for the detection of environmental microorganisms | |
| Crossette et al. | Metagenomic quantification of genes with internal standards | |
| CN102127592B (en) | PCR (Polymerase Chain Reaction) method and kit for quickly detecting Enterobacter sakazakii in baby formula | |
| Hori et al. | Direct comparison of single-strand conformation polymorphism (SSCP) and denaturing gradient gel electrophoresis (DGGE) to characterize a microbial community on the basis of 16S rRNA gene fragments | |
| Van Holm et al. | A viability quantitative PCR dilemma: are longer amplicons better? | |
| CN103981263B (en) | The quantitative detecting method of antibiotics resistance gene in soil | |
| Annapurna et al. | Whole genome shotgun sequence of Bacillus paralicheniformis strain KMS 80, a rhizobacterial endophyte isolated from rice (Oryza sativa L.) | |
| Tian et al. | Selective detection of viable seed-borne Acidovorax citrulli by real-time PCR with propidium monoazide | |
| Sanz et al. | Antibiotic and antibiotic-resistant gene loads in swine slurries and their digestates: Implications for their use as fertilizers in agriculture | |
| Tolosi et al. | Rapid detection and quantification of plasmid‐mediated colistin resistance genes (mcr‐1 to mcr‐5) by real‐time PCR in bacterial and environmental samples | |
| Tatsadjieu et al. | Study of the microbial diversity of Oreochromis niloticus of three lakes of Cameroon by PCR-DGGE: Application to the determination of the geographical origin | |
| Rodrigues et al. | Selection of Escherichia coli heat shock promoters toward their application as stress probes | |
| Guron et al. | Manure-based amendments influence surface-associated bacteria and markers of antibiotic resistance on radishes grown in soils with different textures | |
| Wagner et al. | Survival of selected pathogens in diluted sludge of a thermophilic waste treatment plant and in NaCl-solution under aerobic and anaerobic conditions | |
| CN108642149A (en) | A kind of quantitative detecting method of pig manure antibiotics resistance gene | |
| Zhao et al. | Optimization of photosynthetic bacteria wastewater treatment and study of microbial species diversity | |
| Sunar et al. | Molecular techniques to characterize the invA genes of Salmonella spp. for pathogen inactivation study in composting | |
| Liu et al. | A Sensitive Nucleic Acid Detection Platform for Foodborne Pathogens Based on CRISPR-Cas13a System Combined with Polymerase Chain Reaction | |
| Beneduzi et al. | Genome sequence of the diazotrophic gram-positive rhizobacterium Paenibacillus riograndensis SBR5T | |
| CN105018637B (en) | Application and method of the tetA genes in detecting soil antibiotic resistance level of pollution | |
| Selim et al. | Development and assessment of a real-time PCR assay for rapid and sensitive detection of a novel thermotolerant bacterium, Lactobacillus thermotolerans, in chicken feces | |
| CN110157780A (en) | A kind of primer sets, kit and detection method for bacterial drug resistance detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181012 |