CN103981263B - The quantitative detecting method of antibiotics resistance gene in soil - Google Patents
The quantitative detecting method of antibiotics resistance gene in soil Download PDFInfo
- Publication number
- CN103981263B CN103981263B CN201410198989.1A CN201410198989A CN103981263B CN 103981263 B CN103981263 B CN 103981263B CN 201410198989 A CN201410198989 A CN 201410198989A CN 103981263 B CN103981263 B CN 103981263B
- Authority
- CN
- China
- Prior art keywords
- gene
- resistant gene
- soil
- plasmid
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the quantitative detecting method of antibiotics resistance gene in a kind of soil, comprise the following steps: 1), select often take antibiotic pig, with pig manure DNA for template, adopt pcr amplification purpose resistance gene fragment；2), cut the purpose resistant gene after glue reclaims purification amplification, resistant gene is connected in carrier T, then transformed competence colibacillus Bacillus coli cells, after being coated with LB flat board, selects positive colony；3) quality of amplification culture bacterium solution, is detected with agarose gel electrophoresis, choosing is cloned successful bacterium solution and is extracted plasmid, detects plasmid concentration, converses the copy number of resistant gene entrained by plasmid, and standby for dilution gradient dilution by 10 times, as resistant gene standard substance；4), extract soil genomic DNA, pedotheque DNA and resistant gene standard substance are carried out quantitative pcr amplification simultaneously, thus finally drawing the copy number of the resistant gene of pedotheque.
Description
Technical field
The invention belongs to the detection technique field of Soil Environmental Pollution thing, be specifically related in a kind of soil the quantitative detecting method of antibiotics resistance gene.
Background technology
Nineteen twenty-eight, AlexanderFleming was found that penicillin, and the penicillin large scale investment forties in 20th century produces, and is in succession found that again the antibiotic such as streptomycin, tetracycline, vancomycin, methicillin subsequently.China is antibiotic production and consumption big country, wherein within 2007, produces 210,000 tons of antibiotic, except outlet about 30,000 tons, uses 180,000 tons (wherein aquaculture accounts for 9.7 ten thousand tons) at home.Current antibiotic has been widely used in disease prevention and the treatment of human and animal, improves the growth rate of poultry used also as growth promoter simultaneously.In modern plant, a large amount of use antibiotic have become as a kind of custom, when using a kind of antibiotic to produce drug resistance, plant strengthens antibiotic usage dosage on the one hand, constantly looking for new antibiotic on the other hand, also can use compound antibiotic preparation simultaneously, agricultural soil is the ground, main home to return to of veterinary antibiotic, major part antibiotic excretes with fecaluria with parent compound form, the animal dung of more than 80% is without integrated treatment, just directly impose on farmland, cause antibiotics resistance gene in soil (ARGs) and the accumulation of tolerance bacterium.Microbe species in soil is various, enormous amount, highdensity microorganism more readily promotes the horizontal transfer of gene, ARGs can be incorporated on some removable Genetic elements, such as plasmid, transposon, integron etc., enter human body by approach such as directly or indirectly contacts (such as food chain), increase the drug resistance of human body, and then health and whole ecosystem are constituted long-term potential hazard.Antibiotherapy is the main or even sole therapy caught, and the increase of pathogenic bacterium drug resistance and diffusion have become as the huge problem that global disease treatment is encountered.
Pruden et al. just proposed as far back as 2006, using ARGs as a kind of novel environmental contaminants.Antibiotics resistance gene is of a great variety, enormous amount, such as coding Tetracyclines resistant gene just has three major types more than 40 kinds, set up the quantitative detecting method of ARGs in soil, for systematically antibiotics resistance gene and to evaluate its ecological risk be very necessary in monitoring soil environment further.Currently without commercial resistant gene standard substance, and regular-PCR can only detect the presence or absence of gene qualitatively, and sensitivity is not high.
Summary of the invention
The technical problem to be solved in the present invention is to provide in a kind of soil the quantitative detecting method of antibiotics resistance gene.
In order to solve above-mentioned technical problem, the present invention provides the quantitative detecting method of antibiotics resistance gene in a kind of soil, comprises the following steps:
1), selecting and often take antibiotic pig, the Antibiotics taken should include the antibiotic corresponding to purpose resistant gene；
Extract the genomic DNA of the pig manure of above-mentioned pig, and with pig manure DNA for template, adopt pcr amplification purpose resistance gene fragment；
Remarks illustrate: if purpose resistant gene cannot be obtained, then gravity treatment pig manure, repeat the above steps 1), till obtaining this purpose resistant gene；
2), cut the purpose resistant gene after glue reclaims purification amplification, resistant gene is connected in carrier T, then transformed competence colibacillus Bacillus coli cells, after being coated with LB flat board, selects positive colony, cultivate (amplification culture) with LB culture fluid；
3) quality of amplification culture bacterium solution, is detected with agarose gel electrophoresis, choosing is cloned successful bacterium solution and is extracted plasmid, detects plasmid concentration, converses the copy number of resistant gene entrained by plasmid, and standby for dilution gradient dilution by 10 times, as resistant gene standard substance；
4) genomic DNA of soil, is extracted, pedotheque DNA and resistant gene standard substance are carried out quantitative pcr amplification simultaneously, the CT value of the copy number according to resistant gene standard substance and its amplification generates standard curve, and then draws the copy number of the resistant gene of pedotheque.
As the improvement of the quantitative detecting method of antibiotics resistance gene in the soil of the present invention:
Described purpose resistant gene, its length is 100-350bp；
Described purpose resistant gene is: penicillins resistant gene blaTEM gene, Tetracyclines resistant gene tetC gene, Tetracyclines resistant gene tetM gene.
As the further improvement of the quantitative detecting method of antibiotics resistance gene in the soil of the present invention:
Described step 3) in, plasmid concentration is converted into the formula of the absolute template copy numbers entrained by every μ L plasmid solution and is: Copies/ μ L=[x/ (a+b) × 660] × 10-9×6.02×1023, wherein x is plasmid concentration (ng/ μ L)；A is carrier lengths (bp)；Resistant gene length (bp) for the purpose of b.
As the further improvement of the quantitative detecting method of antibiotics resistance gene in the soil of the present invention: described step 1) in,
The reaction system of pcr amplification is:
2 × EasyTaqPCRSuperMix10 μ L；
DNA profiling (concentration is 18～20ng/ μ L, for instance for 19.1ng/ μ L) 1 μ L；
The each 1 μ L of front and back primer (10 μMs) of purpose resistant gene；
Surplus is secondary redistilled water；
Reaction condition is:
94 DEG C of denaturation 4min,
72 DEG C extend 7min.
Remarks illustrate: different genes of interest fluctuates according to the Tm value of primer and arranges annealing gradient, is optimized to corresponding annealing temperature.
As the further improvement of the quantitative detecting method of antibiotics resistance gene in the soil of the present invention:
When purpose resistant gene is penicillins resistant gene blaTEM gene, front and back primer sequence respectively AAGCCATACCAAACGACGAG, CCGCCTCCATCCAGTCTAT；Annealing temperature is 66 DEG C；
When purpose resistant gene is Tetracyclines resistant gene tetC gene, front and back primer sequence respectively GCGGGATATCGTCCATTCCG, GCGTAGAGGATCCACAGGACG；Annealing temperature is 68 DEG C；
When purpose resistant gene is Tetracyclines resistant gene tetM gene, front and back primer sequence respectively ACAGAAAGCTTATTATATAAC, TGGCGTGTCTATGATGTTCAC；Annealing temperature is 46 DEG C.
Remarks illustrate: when purpose resistant gene is penicillins resistant gene blaTEM gene, before and after it primer sequence be the present invention institute spy create (that is, this primer sequence has no report)；The blaTEM genetic fragment reported at present is more than 350bp, length is not suitable for the amplification of quantitative PCR, we choose 30 known blaTEM gene orders (GenBank data base) and compare, find that blaTEM gene has good conservative, primer is redesigned according to conserved sequence, the purpose fragment generated is 129bp, and length is suitable for the amplification of quantitative PCR, and primer is considered the universal primer of detection blaTEM gene by this.
As the further improvement of the quantitative detecting method of antibiotics resistance gene in the soil of the present invention:
Described step 4) in, generate the R of standard curve2Value should be greater than 0.98, is closer to 1, and credible result degree is more high；The scope of amplification efficiency E at 0.8-1.2, should be closer to 1, more desirable.
In the present invention:
Step 1) for taking the pig manure of life-time service antibiotic plant for extracting standard substance DNA.Specific as follows: in the antibiotic plant of life-time service, to gather pig manure, extract test kit (FastDNAspinkitforsoil) with soil genome and extract the genomic DNA of pig manure；With pig manure DNA for template, expanding purpose resistant gene by regular-PCR program, its length should between 100-350bp.
Step 2) and step 3) in, carry out electrophoresis detection after pcr amplification, correct genes of interest fragment is carried out cuts glue and reclaims, and access in carrier T after purification amplification, then adopt commercial competence Bacillus coli cells to convert.Select positive colony (meet color and be white but not single bacterium colony of blueness, for positive colony) after being coated with LB flat board, cultivate in a small amount with LB culture fluid.Take 1 μ L bacterium solution and carry out bacterium solution PCR (primer is universal support primer M13,94 DEG C of denaturation 10min, annealing temperature 55 DEG C)；Checking genes of interest clone whether successful (bacterium solution PCR primer detects through agarose gel electrophoresis, when the length of resistant gene adds the length of carrier for the purpose of its length, then judges to clone successfully).
Take and clone successfully bacterium solution 2-4mL extraction plasmid, plasmid order-checking, comparison insert gene segment correct after, plasmid concentration is detected with NanoDrop, conversing the copy number of resistant gene entrained by plasmid, plasmid concentration is converted into the formula of the absolute template copy numbers entrained by every μ L plasmid solution and is: Copies/ μ L=[x/ (a+b) × 660] × 10-9×6.02×1023, wherein x is plasmid concentration (ng/ μ L)；A is carrier lengths (bp)；Resistant gene length (bp) for the purpose of b.And standby for dilution gradient dilution by 10 times, as the standard substance of resistant gene.
Step 4) in, extract test kit (FastDNAspinkitforsoil) with soil genome and extract the genomic DNA of soil sample to be measured, pedotheque DNA and standard substance are carried out quantitative pcr amplification simultaneously, quantitative PCR reaction system is the reaction system of 20 μ L, specifically include 10 μ L2 × SYBRqPCRSuperMix, each 0.4 μ L of front and back primer (10 μMs) of 1 μ L template (concentration dilution to 1-5ng/ μ L) and genes of interest；Surplus is secondary redistilled water.
Reaction condition is: 94 DEG C of denaturation 30s；94 DEG C of 5s, annealing 15s (annealing temperature of 3 different purpose resistant genes is with the annealing temperature after optimization set in step 1)), 72 DEG C of 10s, 40 circulations, last melting curve program is 95 DEG C of 5s, 60 DEG C of 1min, continuous detecting fluorescence signal while being warmed up to 95 DEG C.Generate the R of standard curve2Value should be greater than 0.98, is closer to 1, and credible result degree is more high.The scope of amplification efficiency E at 0.8-1.2, should be closer to 1, more desirable.Generated standard curve by the CT value of the copy number of known plasmid and its amplification, and then draw the copy number of the resistant gene of pedotheque.
It is characteristic of the invention that, pig manure DNA sample is adopted to prepare resistant gene standard substance quickly and accurately, compared with pig manure major part soil be not affected by antibiotic pollute or pollution level lighter, in soil, the copy number of resistant gene is less, it is difficult to expand out by purpose resistant gene by the qualitative PCR that sensitivity is relatively low, more cannot be carried out the preparation of standard substance.Extraction about the total gene of pig manure, the extracting method of our Experimental Comparison manual extraction and other test kits, discovery soil genome extracts test kit (FastDNAspinkitforsoil) and can be used to extract pig manure gene, and very convenient and accurate.Plasmid standard can preserve at-20 DEG C, once prepares available 10-20 time；Resistant gene standard substance and pedotheque DNA are carried out quantitative pcr amplification simultaneously.The present invention operates succinctly, and except the preparation of standard substance, pedotheque can obtain testing result in 3 hours；Testing result highly sensitive, quantitatively also more directly perceived；Do not rely on microorganism culturing, the resistant gene entrained by uncultured microorganisms (can not cultivate more than 99.9% microorganism) can be detected, make the quantized result finally given more fully with credible.
The present invention specify that the quantitative detecting method of penicillins resistant gene blaTEM gene, Tetracyclines resistant gene tetC gene, Tetracyclines resistant gene tetM gene, simultaneously can also as the reference of other resistant gene detection by quantitative.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is blaTEM gene quantification PCR standard curve；
Fig. 2 is tetC gene quantification PCR standard curve；
Fig. 3 is tetM gene quantification PCR standard curve；
Fig. 4 is the Quantitative Comparison of Tetracyclines resistant gene in different soils.
Detailed description of the invention
Examples below will be further illustrated feasibility and the application effect of the inventive method.
The detection by quantitative of ampicillin resistance gene blaTEM in embodiment 1, different soils
The beta-lactamase of blaTEM coding can make penicillin lose efficacy, take fresh sylvogenic soil, pasture soil, tea place soil measure soil moisture content, each soil sample and pig manure sample claim 0.25g to extract DNA, and volume is that [described pig manure is feces produced by the antibiotic pig of long-term taking to 100 μ L；The DNA of above-mentioned soil sample and pig manure sample all adopts soil genome to extract test kit (FastDNAspinkitforsoil) and extracts].
Choose 30 known blaTEM gene orders (GenBank data base) to compare, find that blaTEM gene has good conservative, primer is redesigned according to conserved sequence, the purpose fragment generated is 129bp, front and back primer sequence respectively AAGCCATACCAAACGACGAG, CCGCCTCCATCCAGTCTAT.Primer is considered the universal primer of detection blaTEM gene by this.
It is that template carries out PCR with pig manure sample DNA, common PCR reaction system, it it is the reaction system of 20 μ L, specifically include 10 μ L2 × EasyTaqPCRSuperMix, the each 1 μ L of front and back primer (10 μMs) of 1 μ L template (concentration is 19.1ng/ μ L) and blaTEM, surplus is secondary redistilled water.Reaction condition is: 94 DEG C of denaturation 4min；94 DEG C of 45s, anneal 66 DEG C of 45s, 72 DEG C of 1min, 35 circulations；7min is extended at last 72 DEG C.
2) the blaTEM genetic fragment (for 129bp) after glue reclaims purification amplification, is cut, segment is connected in carrier T, then transformed competence colibacillus Bacillus coli cells, select positive colony after being coated with LB flat board (to meet color and be white but not single bacterium colony of blueness, for positive colony), with LB culture fluid amplification culture (37 DEG C, 200 turns of overnight incubation).Take 1 μ L bacterium solution to carry out bacterium solution PCR and verify that genes of interest clone after successfully above-mentioned PCR checking system and is: the reaction system of 20 μ L, specifically include 10 μ L2 × EasyTaqPCRSuperMix, 1 μ L bacterium solution (concentration is 19.1ng/ μ L) is as each 1 μ L of primer before and after DNA profiling and universal support primer M13 (10 μMs), and surplus is secondary redistilled water；Reaction condition is: 94 DEG C of denaturation 10min, 94 DEG C of 45s, 55 DEG C of annealing 45s, 72 DEG C of 1min, and 35 circulations extend 7min at last 72 DEG C；When bacterium solution PCR primer through agarose gel electrophoresis detect, when for the purpose of its length, the length of resistant gene adds the length of carrier, then be judged to clone successfully expand bacterium solution)；
Take positive bacterium solution 3mL and extract plasmid, plasmid deliver to the order-checking of order-checking company, according to return the sequencing result come comparison on NCBI website insert gene segment correct after, detecting plasmid concentration with NanoDrop is 62.9ng/ μ L, according to reduction formula Copies/ μ L=[x/ (a+b) × 660] × 10-9×6.02×1023, wherein x is plasmid concentration 62.9ng/ μ L；A is carrier T length 3829bp；B is blaTEM mrna length 129bp.Conversing the copy number of blaTEM gene entrained by plasmid is 1.43 × 1010, and become copy number to be 1.43 × 10 by 10 times for dilution gradient dilution8～1.43 × 103As standard substance.
Pedotheque DNA and standard substance being carried out quantitative pcr amplification simultaneously, specifically includes 10 μ L2 × SYBRqPCRSuperMix, 1 μ L template is (with above-mentioned copy number for 1.43 × 108～1.43 × 103Standard substance and pedotheque DNA (concentration dilution to 1-5ng/ μ L) as template) and each 0.4 μ L of front and back primer (10 μMs) of blaTEM；Reaction condition is: 94 DEG C of denaturation 30s；94 DEG C of 5s, anneal 66 DEG C of 15s, 72 DEG C of 10s, 40 circulations, and last melting curve program is 95 DEG C of 5s, 60 DEG C of 1min, continuous detecting fluorescence signal while being warmed up to 95 DEG C.
Standard curve is y=-3.6666x+41.812 (Fig. 1), and wherein x is log10Gene blaTEM copy number, y is critical cycle number, i.e. the CT value reading of quantitative PCR apparatus.It is that 87.38% (formula is e=10 that K value according to standard curve calculates amplification efficiency e-1/k-1), R2=0.9937, draw the copy number of the blaTEM gene of pedotheque, the copy number of every gram of dry ground blaTEM gene=from blaTEM gene copy number × 100 μ L × template extension rate that graticule draws/[0.25 × (1-moisture content)], therefore, sylvogenic soil 1.58 × 106Copies/g, pasture soil 1.08 × 106Copies/g, tea place soil 1.57 × 106Copies/g.Illustrate three kinds of Different Soil all contain blaTEM gene, and quantitatively difference is little.
Verify test 1, the sylvogenic soil in embodiment 1, pasture soil, tea place soil are carried out detection by quantitative according to sonde method, front and back primer sequence is CACTATTCTCAGAATGACTTGGT, CATGACAGTAAGAGAATTATGCA probe is that CCAGTCACAGAAAAGCATCTTACGG acquired results is respectively as follows: sylvogenic soil 1.31 × 106Copies/g, pasture soil 0.98 × 106Copies/g, tea place soil 1.29 × 106copies/g。
Comparative example 1-1, the annealing temperature in embodiment 1 is risen to " 70 DEG C " by " 66 DEG C "；All the other are completely with embodiment 1；The standard curve of gained is meaningless, wherein R2Value is 0.815, and amplification efficiency E is the 22.6 (R of generation standard curve2Value should be greater than 0.98, is closer to 1, and credible result degree is more high.The scope of amplification efficiency E at 0.8-1.2, should be closer to 1, more desirable.) copy number of every gram of dry ground blaTEM gene that therefore finally gives is unreliable.
Comparative example 1-2, the annealing temperature in embodiment 1 quantitative PCR program is dropped to " 55 DEG C " by " 66 DEG C "；All the other are completely with embodiment 1；The standard curve of gained is meaningless, wherein R2Value is 0.994, and amplification efficiency E is the 2.10 (R of generation standard curve2Value should be greater than 0.98, is closer to 1, and credible result degree is more high.The scope of amplification efficiency E at 0.8-1.2, should be closer to 1, more desirable.) copy number of every gram of dry ground blaTEM gene that therefore finally gives is unreliable.
The Quantitative Comparison of tetracycline resistance gene tetC and tetM in embodiment 2, different soils
TetC encodes efflux transporters, tetracycline can be discharged extracellular, plays a protective role thus reducing drug concentration, tetM encoding ribosomal protected protein, causes ribosome configuration to change, and makes tetracycline can not be combined with ribosome and lose efficacy.
Take fresh sylvogenic soil, pasture soil, tea place soil measure soil moisture content, and each soil sample and pig manure sample claim 0.25g to extract DNA, and volume is that [described pig manure is the feces that the antibiotic pig of long-term taking is long-living to 100 μ L；The DNA of above-mentioned soil sample and pig manure sample all adopts soil genome to extract test kit (FastDNAspinkitforsoil) and extracts].
Primer sequence respectively GCGGGATATCGTCCATTCCG before and after tetC, GCGTAGAGGATCCACAGGACG, target fragment length is 207bp.
The front and back primer sequence of tetM is ACAGAAAGCTTATTATATAAC, TGGCGTGTCTATGATGTTCAC, and target fragment length is 171bp.
It is that template carries out PCR respectively with pig manure sample DNA, common PCR reaction system is the reaction system of 20 μ L, specifically include 10 μ L2 × EasyTaqPCRSuperMix, the each 1 μ L of front and back primer (10 μMs) of 1 μ L template (concentration is 19.1ng/ μ L) and a kind of purpose resistant gene, surplus is secondary redistilled water.Reaction condition is: 94 DEG C of denaturation 4min；94 DEG C of 45s, anneal 45s, 72 DEG C of 1min, 35 circulations；7min is extended at last 72 DEG C.TetC annealing temperature is 68 DEG C, and tetM annealing temperature is 46 DEG C.
(tetC is 207bp to cut the purpose resistance gene fragment after glue recovery purification amplification；TetM is 171bp), segment is connected in carrier T, then transformed competence colibacillus Bacillus coli cells, select positive colony after being coated with LB flat board (to meet color and be white but not single bacterium colony of blueness, for positive colony), with LB culture fluid amplification culture (37 DEG C, 200 turns of overnight incubation).Take 1 μ L bacterium solution to carry out bacterium solution PCR and verify that genes of interest clone after successfully that (above-mentioned PCR checking system is: the reaction system of 20 μ L, specifically include 10 μ L2 × EasyTaqPCRSuperMix, 1 μ L bacterium solution is as each 1 μ L of primer before and after DNA profiling and universal support primer M13 (10 μMs), and surplus is secondary redistilled water；Reaction condition is: 94 DEG C of denaturation 10min, 94 DEG C of 45s, 55 DEG C of annealing 45s, 72 DEG C of 1min, and 35 circulations extend 7min at last 72 DEG C；When bacterium solution PCR primer through agarose gel electrophoresis detect, when for the purpose of its length, the length of resistant gene adds the length of carrier, then be judged to clone successfully expand bacterium solution)；
Take positive bacterium solution 3mL and extract plasmid, plasmid deliver to the order-checking of order-checking company, according to return the sequencing result come comparison on GenBank data base insert gene segment correct after, plasmid concentration is detected, according to reduction formula Copies/ μ L=[x/ (a+b) × 660] × 10 with NanoDrop-9×6.02×1023, wherein x is plasmid concentration ng/ μ L；A is carrier T length bp；Resistant gene length bp for the purpose of b.Converse the copy number of purpose resistant gene entrained by plasmid, and by 10 times for diluting gradient dilution as standard substance.The copy number drawing tetC gene is 1.68 × 1010, and become copy number to be 1.68 × 10 by 10 times for dilution gradient dilution8～1.68 × 103As standard substance；The copy number of tetM gene is 7.66 × 109, and become copy number to be 7.66 × 10 by 10 times for dilution gradient dilution7～7.66 × 102As standard substance.
Pedotheque DNA and standard substance are carried out quantitative pcr amplification simultaneously, tetC gene need to separately expand because annealing temperature is different with tetM gene, specifically include 10 μ L2 × SYBRqPCRSuperMix, the each 0.4 μ L of front and back primer (10 μMs) of 1 μ L template (using the standard substance of above-mentioned tetC gene or tetM gene and pedotheque DNA as template, be diluted to 1-5ng/ μ L) and purpose resistant gene；Reaction condition is: 94 DEG C of denaturation 30s；94 DEG C of 5s, anneal 15s, 72 DEG C of 10s, and 40 circulations, tetC annealing temperature is 68 DEG C, and tetM annealing temperature is 46 DEG C.Last melting curve program is 95 DEG C of 5s, 60 DEG C of 1min, continuous detecting fluorescence signal while being warmed up to 95 DEG C.
The standard curve of tetC gene is y=-3.3972x+40.705 (Fig. 2), and wherein x is log10Gene tetC copy number, y is critical cycle number, i.e. the CT value reading of quantitative PCR apparatus.It is that 96.95% (formula is e=10 that K value according to standard curve calculates amplification efficiency e-1/k-1), R2=0.9954, draw the copy number of the tetC gene of pedotheque, the copy number of every gram of dry ground tetC gene=from tetC gene copy number × 100 μ L × template extension rate that graticule draws/[0.25 × (1-moisture content)], sylvogenic soil 7.49 × 103Copies/g, pasture soil 1.63 × 106Copies/g, tea place soil 2.93 × 103Copies/g.Illustrating all to contain in Different Soil tetC gene, but quantitatively difference is very big, pasture soil is big by resistant gene pollution level.
TetM gene standard curve is y=-3.3903x+42.193 (Fig. 3), and wherein x is log10Gene tetM copy number, y is critical cycle number, i.e. the CT value reading of quantitative PCR apparatus.It is that 97.22% (formula is e=10 that K value according to standard curve calculates amplification efficiency e-1/k-1), R2=0.9975, draw the copy number of the tetM gene of pedotheque, the copy number of every gram of dry ground tet, M gene=from tetM gene copy number × 100 μ L × template extension rate that graticule draws/[0.25 × (1-moisture content)], sylvogenic soil 4.64 × 104Copies/g, pasture soil 6.59 × 106Copies/g, tea place soil 3.85 × 104Copies/g.Illustrating all to contain in Different Soil tetM gene, but quantitatively difference is very big, pasture soil is big by resistant gene pollution level.
In soil two kinds of Tetracyclines resistant genes are compared (Fig. 4), it has been found that two kinds of resistant gene content are apparently higher than other two kinds of soil in the soil of pasture, illustrate that pasture soil is contaminated bigger.Meanwhile, tetM gene content in various soil is above tetC gene, and tetM gene is described, and relatively tetC gene is more general.
Comparative example 2-1,2 kinds of annealing temperatures in embodiment 2 quantitative PCR program are all risen 5 degree；All the other are completely with embodiment 2；
The R of the standard curve corresponding to tetracycline resistance gene tetC2Value is 0.907, and amplification efficiency E is 7.650；
The R of the standard curve corresponding to tetracycline resistance gene tetM2Value is 0.538, and amplification efficiency E is 180；
The standard curve of gained is meaningless (generates the R of standard curve2Value should be greater than 0.98, is closer to 1, and credible result degree is more high.The scope of amplification efficiency E at 0.8-1.2, should be closer to 1, more desirable.) copy number of every gram of dry ground purpose resistant gene that therefore finally gives is unreliable.
Comparative example 2-2,2 kinds of annealing temperatures in embodiment 2 are all declined 5 DEG C；All the other are completely with embodiment 2；
The R of the standard curve corresponding to tetracycline resistance gene tetC2Value is 0.445, and amplification efficiency E is 463；
The R of the standard curve corresponding to tetracycline resistance gene tetM2Value is 0.525, and amplification efficiency E is 269；
The standard curve of gained is meaningless (generates the R of standard curve2Value should be greater than 0.98, is closer to 1, and credible result degree is more high.The scope of amplification efficiency E at 0.8-1.2, should be closer to 1, more desirable.) copy number of every gram of dry ground purpose resistant gene that therefore finally gives is unreliable.
<110>Zhejiang University
<120>quantitative detecting method of antibiotics resistance gene in soil
<160>6
<210>1
<211>20
<212>DNA
<213>artificial sequence
<220>
<223>the front primer of corresponding penicillins resistant gene blaTEM gene
<400>1
aagccataccaaacgacgag20
<210>2
<211>19
<212>DNA
<213>artificial sequence
<220>
<223>the rear primer of corresponding penicillins resistant gene blaTEM gene
<400>2
ccgcctccatccagtctat19
<210>3
<211>20
<212>DNA
<213>artificial sequence
<220>
<223>the front primer of corresponding Tetracyclines resistant gene tetC gene
<400>3
gcgggatatcgtccattccg20
<210>4
<211>21
<212>DNA
<213>artificial sequence
<220>
<223>the rear primer of corresponding Tetracyclines resistant gene tetC gene
<400>4
gcgtagaggatccacaggacg21
<210>5
<211>21
<212>DNA
<213>artificial sequence
<220>
<223>the front primer of corresponding Tetracyclines resistant gene tetM gene
<400>5
acagaaagcttattatataac21
<210>6
<211>21
<212>DNA
<213>artificial sequence
<220>
<223>the rear primer of corresponding Tetracyclines resistant gene tetM gene
<400>6
tggcgtgtctatgatgttcac21
Claims (3)
1. the quantitative detecting method of antibiotics resistance gene in soil, it is characterised in that comprise the following steps:
1), antibiotic pig is often taken in selection；
Extract the genomic DNA of the pig manure of above-mentioned pig, and with pig manure DNA for template, adopt pcr amplification purpose resistance gene fragment；
Described purpose resistant gene, its length is 100-350bp；
Described purpose resistant gene is: penicillins resistant gene blaTEM gene, Tetracyclines resistant gene tetC gene, Tetracyclines resistant gene tetM gene；
The reaction system of pcr amplification is:
2 × EasyTaqPCRSuperMix10 μ L；
DNA profiling, concentration is 18～20ng/ μ L1 μ L；
The front and back primer of purpose resistant gene, 10 μMs of each 1 μ L；
Surplus is secondary redistilled water；
Reaction condition is:
94 DEG C of denaturation 4min,
72 DEG C extend 7min；
When purpose resistant gene is penicillins resistant gene blaTEM gene, front and back primer sequence respectively AAGCCATACCAAACGACGAG, CCGCCTCCATCCAGTCTAT；Annealing temperature is 66 DEG C；
When purpose resistant gene is Tetracyclines resistant gene tetC gene, front and back primer sequence respectively GCGGGATATCGTCCATTCCG, GCGTAGAGGATCCACAGGACG；Annealing temperature is 68 DEG C；
When purpose resistant gene is Tetracyclines resistant gene tetM gene, front and back primer sequence respectively ACAGAAAGCTTATTATATAAC, TGGCGTGTCTATGATGTTCAC；Annealing temperature is 46 DEG C；
2), cut the purpose resistant gene after glue reclaims purification amplification, resistant gene is connected in carrier T, then transformed competence colibacillus Bacillus coli cells, after being coated with LB flat board, selects positive colony, cultivate with LB culture fluid；
3) quality of amplification culture bacterium solution, is detected with agarose gel electrophoresis, choosing is cloned successful bacterium solution and is extracted plasmid, detects plasmid concentration, converses the copy number of resistant gene entrained by plasmid, and standby for dilution gradient dilution by 10 times, as resistant gene standard substance；
4) genomic DNA of soil, is extracted, pedotheque DNA and resistant gene standard substance are carried out quantitative pcr amplification simultaneously, the CT value of the copy number according to resistant gene standard substance and its amplification generates standard curve, and then draws the copy number of the resistant gene of pedotheque.
2. the quantitative detecting method of antibiotics resistance gene in soil according to claim 1, it is characterised in that:
Described step 3) in, plasmid concentration is converted into the formula of the absolute template copy numbers entrained by every μ L plasmid solution and is: Copies/ μ L=[x/ (a+b) × 660] × 10-9×6.02×1023, wherein x is plasmid concentration, and unit is ng/ μ L；A is carrier lengths, and unit is bp；Resistant gene length for the purpose of b, unit is bp.
3. the quantitative detecting method of antibiotics resistance gene in the soil stated according to claim 2, it is characterised in that: described step 4) in, generate the R of standard curve2Value should be greater than 0.98, is closer to 1, and credible result degree is more high；The scope of amplification efficiency E at 0.8-1.2, should be closer to 1, more desirable.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410198989.1A CN103981263B (en) | 2014-05-12 | 2014-05-12 | The quantitative detecting method of antibiotics resistance gene in soil |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410198989.1A CN103981263B (en) | 2014-05-12 | 2014-05-12 | The quantitative detecting method of antibiotics resistance gene in soil |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103981263A CN103981263A (en) | 2014-08-13 |
| CN103981263B true CN103981263B (en) | 2016-06-29 |
Family
ID=51273434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410198989.1A Active CN103981263B (en) | 2014-05-12 | 2014-05-12 | The quantitative detecting method of antibiotics resistance gene in soil |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103981263B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018636B (en) * | 2015-08-24 | 2018-05-22 | 济南大学 | Application and method of the ermC genes in soil antibiotic resistance level of pollution is detected |
| CN105936931A (en) * | 2016-04-15 | 2016-09-14 | 山东畜牧兽医职业学院 | Kit for fluorescence quantitative PCR detection of poultry-farm enterobacteriaceae drug-resistant gene and detection method thereof |
| CN107254518A (en) * | 2017-05-24 | 2017-10-17 | 中山大学 | The quantitative detecting method of enteric bacteria antibiotics resistance gene |
| WO2019005763A1 (en) * | 2017-06-26 | 2019-01-03 | Phase Genomics Inc. | A method for the clustering of dna sequences |
| CN109825557A (en) * | 2019-04-11 | 2019-05-31 | 河北工程大学 | A kind of method of Sulfonamides-resistant genes sulI in detection atmospheric environment |
| CN110554109A (en) * | 2019-08-29 | 2019-12-10 | 同济大学 | Safety evaluation method for antibiotic fungi residues |
| CN110747260A (en) * | 2019-09-24 | 2020-02-04 | 天津科技大学 | Specific primer, detection method and application of β -lactam antibiotic resistance gene blaTEM |
| CN111549158A (en) * | 2020-06-08 | 2020-08-18 | 河北工程大学 | Method for detecting one-class integron gene intI1 in atmospheric environment |
| CN113388688A (en) * | 2021-06-16 | 2021-09-14 | 济南大学 | Method and system for detecting spread of manure source drug-resistant bacteria in soil |
-
2014
- 2014-05-12 CN CN201410198989.1A patent/CN103981263B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Diverse and abundant antibiotic resistance genes in Chinese swine farms;Yong-Guan Zhu et al;《PNAS》;20130226;第110卷(第9期);摘要部分以及第3437、3439页 * |
| Monitoring and source Tracking of Tetracycline Resistance Genes in Lagoons and Groundwater Adjacent to Swine Production Facilities over a 3-year Period;S.Koike et al;《Applied AND Environmental Microbiology》;20070830;第73卷(第15期);参见Table.1部分 * |
| Nosocomial Transmission of CTX-M-15 and OXA-30 β-Lactamase-Producing E.coli in a Neurosurgical Intensive Care Unit;Yang-Ree Kim et al;《Annals of Clinical of Laboratory Science》;20051231;第35卷(第3期);参见Table1部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103981263A (en) | 2014-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103981263B (en) | The quantitative detecting method of antibiotics resistance gene in soil | |
| Luby et al. | Molecular methods for assessment of antibiotic resistance in agricultural ecosystems: prospects and challenges | |
| Shinkai et al. | Localization of ruminal cellulolytic bacteria on plant fibrous materials as determined by fluorescence in situ hybridization and real-time PCR | |
| Zhou et al. | Intermediate grazing intensities by sheep increase soil bacterial diversities in an Inner Mongolian steppe | |
| Hobbs et al. | Small RNAs and small proteins involved in resistance to cell envelope stress and acid shock in Escherichia coli: analysis of a bar-coded mutant collection | |
| Nehmé et al. | Culture-independent characterization of archaeal biodiversity in swine confinement building bioaerosols | |
| Su et al. | Conservation and divergence of DNA methylation in eukaryotes: new insights from single base-resolution DNA methylomes | |
| Popova et al. | Methanogens and methanogenesis in the rumens and ceca of lambs fed two different high-grain-content diets | |
| CN103710455B (en) | A kind of method obtaining oligonucleotide probe | |
| CN106119283A (en) | A kind of method that the CRISPR of utilization Cas9 targeting knocks out MSTN gene | |
| CN102337340A (en) | Method for quickly detecting gene copy number in genome | |
| Tang et al. | Wide but variable distribution of a hypervirulent Campylobacter jejuni clone in beef and dairy cattle in the United States | |
| AU2017388535A1 (en) | Methods, apparatuses, and systems for microorganism strain analysis of complex heterogeneous communities with tracer analytics, determination of functional relationships and interactions thereof, and synthesis of microbial ensembles including dosed microbial ensembles and inoculative microbial ensembles | |
| Tolosi et al. | Rapid detection and quantification of plasmid‐mediated colistin resistance genes (mcr‐1 to mcr‐5) by real‐time PCR in bacterial and environmental samples | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| Hamann et al. | Syntrophic linkage between predatory Carpediemonas and specific prokaryotic populations | |
| Mou et al. | Genome-Wide Association study reveals growth-related markers and candidate genes for selection in Chinese longsnout catfish (Leiocassis longirostris) | |
| CN103266120A (en) | Dual fluorescent reporter gene vector for identifying miRNA targets, preparation method and application thereof | |
| Tang et al. | Complete genome sequence of Erysipelothrix rhusiopathiae strain GXBY-1 isolated from acute swine erysipelas outbreaks in south China | |
| Oliveira et al. | Occurrence of the colistin resistance mcr‐1 gene in soils from intensive vegetable production and native vegetation | |
| CN102796693A (en) | Microbial cell sensor for detecting arsenic bioavailability degree | |
| Smalla | Culture‐independent microbiology | |
| CN105018637B (en) | Application and method of the tetA genes in detecting soil antibiotic resistance level of pollution | |
| Kamke et al. | Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep | |
| CN101348822B (en) | Reporter plasmid for biological detection of radioactive ray dose and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |