CN108611440A - A kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus - Google Patents
A kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus Download PDFInfo
- Publication number
- CN108611440A CN108611440A CN201810373215.6A CN201810373215A CN108611440A CN 108611440 A CN108611440 A CN 108611440A CN 201810373215 A CN201810373215 A CN 201810373215A CN 108611440 A CN108611440 A CN 108611440A
- Authority
- CN
- China
- Prior art keywords
- sample
- mouth disease
- seq
- disease virus
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a kind of Taqman real-time fluorescent PCR reagent cases and its detection method for detecting foot and mouth disease virus, including PCR reaction buffer A, FMDV primed probes mixed liquid B, enzyme system C, negative control and positive control, detection method to be：Sample collection and processing；The extraction of sample rna；Sample rna is extracted；The preparation of PCR reaction systems；Sample-adding；Amplification；As a result interpretation.The present invention has many advantages, such as high sensitivity, efficient.
Description
Technical field
The present invention relates to molecular diagnostic techniques fields, and specifically a kind of Taqman of detection foot and mouth disease virus is glimmering in real time
Light PCR kit and its detection method.
Background technology
Aftosa (Foot and mouth disease, FMD) is by foot and mouth disease virus (Foot and mouth
Disease virus, FMDV) caused by a kind of animal infectious epidemic disease, mainly infect artiodactyls, it is easy with pig, ox and sheep
Sense, accidental people and other animals.The hairless multiple water in place such as the nipple of the positions such as mouth, nose, the hoof of infected animal and jenny
Blister.In addition easily there are the symptoms such as mental depression, limping, salivation in infection animal.The adult death rate is relatively low, and juvenile
The death rate is then up to 100%.FMD is a kind of zoonosis, can cause serious threat to aquaculture and human health, be
One of great animal epidemic of national requirements compulsory immunization.Currently, FMD constitutes huge prestige to livestock breeding industry and human health
The side of body is that the animal of World Organization for Animal Health (Office International desepizooties, OIE) statutory report passes
One of catch an illness.
FMDV variations are rapid, the phenomenon that multiple serotypes are often presented and deposit.Distribution status according to FMD in the whole world, mostly
Number country Major Epidemic is O-shaped, and then based on O-shaped, A types and Asia I type (I types of Asia) distribute, O-shaped with SEA types (Southeast Asia in China
Type is commonly called as 98 pedigree of Burma) based on, while there is new strain variation, each serum includes different topological types, and vaccine strain includes
Mya98/by/2011,O/×J/10-11.Other two kinds of O-shaped FMD of China's prevalence include CATHAY types (sinotype) and ME-SA
Type (the middle southeast-hypotype).
The propagation of FMDV has rapid onset, infects the features such as wide, incidence is high.Most important direct contagion source is sick pig and band
Malicious pig, sick pig early stage infectiousness highest, and the several weeks or even several months of 50% or so infected animal after recovering can still be taken
Band virus.Blister skin, blister liquid, meat, hair, internal organ, blood, tear and other excretas of sick pig may also become the infection sources.
In addition, there is also propagate risk for contaminated pig house, feed, water, raising apparatus.FMDV mainly passes through air or contact transmission.
Airborne approach is that the FMDV of infection animal exhalation forms particulate in air, and susceptible animal sucking is contaminated
Air, you can draw viral infection；Contact transmission mainly by the direct contact infection of affected animal and susceptible animal, is such as enclosed
Animal in house, animal farm, country fair and haulage vehicle is in direct contact；Mediate contact mainly passes through medium mechanicalness band poison
And it propagates.The vitality of FMDV is indomitable, can depend on aerial tiny dust, move with the wind, or even occurs crossing over number 10km
It propagates.
FMDV belongs to Picornaviridae, is single-stranded positive virus, genome is by about 8450 base compositions, serotype
It is complicated and changeable, it has been found that 7 serotypes, i.e. A types, O-shaped, c-type, South Africa (SAT) I types, South Africa II types, South Africa type III and Asia I
Type, again there are many hypotype, each serotype acts on each type without Cross immunogenicity.FMDV infectiousness is extremely strong, to ill domestic animal and doubtful
Infection animal must be slaughtered promptly, need that block is isolated to the wide geographic area around epidemic disease, forbid on animal transhipment and livestock products
City, foreign trade will also stop, indirect economic loss bigger, become " the political economy disease " for influencing the national economic development.Cause
Fast and accurately the Methods of Detection of Pathogens is particularly significant to the prevention and control and purification of FMD for this.
Currently, FMDV detection methods include mainly virus purification, the experiment of indirect sandwich enzyme-linlced immunosorbent, reversed indirect blood
Solidifying experiment, inverse PCR and multiplex reverse transcription-PCR etc..Traditional animal inoculation pvaccination and serology
Although experiment has the shortcomings of time-consuming, cumbersome and sensitivity is not high when detecting FMDV, indirect ELISA experiment is easy to operate, fast
Speed, but need a large amount of standard antigen.Although the conventional RT-PCR detection method that is widely used at present is simple, easily and fast and
Susceptibility is higher, singly still has the drawbacks such as false positive and PCR pollutions.TaqMan real-time fluorescent PCR technologies its high specificities, spirit
The advantages that sensitivity is high, speed is fast and anti-pollution obtains wide in gene expression dose analysis, Pathogen test and quantitative detection etc.
General application, and have become the main method that current viral nucleic acid quickly detects.
Invention content
The technical problem to be solved by the present invention is in order to overcome inefficiency in the prior art, sensitivity be not high to lack
It falls into, and a kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus is provided.
The present invention solves above-mentioned technology technical problem, and the invention discloses a kind of Taqman for detecting foot and mouth disease virus
Real-time fluorescent PCR reagent case, including PCR reaction buffer A, FMDV primed probes mixed liquid B, enzyme system C, negative control and the positive
Control.
Preferably, each component content is as follows：PCR reaction buffers A is that 384 μ l, FMDV primed probe mixed liquid Bs are 48
96 μ l of μ l, enzyme system C, 400 μ l of negative control, 400 μ l of positive control.
Preferably, the group of the PCR reaction buffers A is divided into 5 × PCR buffer (Mg2+Plus) and dNTPs groups
At the group of the enzyme system C is divided into the mixture of thermal starting archaeal dna polymerase, Super M-MLV, RRI, the negative control
Using DEPC-H2O, the positive control uses the plasmid bacterial of aftosa target gene fragment.
Preferably, the FMDV primed probe mixed liquid Bs are by pair of primers and a specificity fluorescent probe groups
At the primer sequence such as SEQ ID NO:1 and SEQ ID NO:Shown in 2, the sequence such as SEQ ID of the fluorescence probe
NO:Shown in 3, the primer sequence SEQ ID NO:1 and SEQ ID NO:2 are：
SEQ ID NO:1：Sense primer ACAAACCTGTGATGGCYT
SEQ ID NO:2：Downstream primer GGAGATCAACTTCTCCTGTA
The probe sequence is：
SEQ ID NO:3：CTCTCCTTTGCACGCCGTG.
Preferably, the primer sequence SEQ ID NO:1 and SEQ ID NO:2 extension increasing sequence and sequence SEQ ID
NO:3 probe primer concentration is 10uM/ul, and amplimer is 2 with probe primer proportioning:2:1.
Preferably, another mesh of the present invention, which is to additionally provide, utilizes the above-mentioned Taqman for detecting foot and mouth disease virus
Real-time fluorescent PCR reagent case detects the Fluorescence PCR system of aftosa：
Amplification system：
The present invention also provides using the above-mentioned Taqman real-time fluorescent PCR reagent cases detection for detecting foot and mouth disease virus
The detection method of aftosa, is as follows：
(1), sample collection and processing
Biopsy sample：Tonsillotome sample is taken with sampling gun, is chosen to 1.5ml centrifuge tubes and is marked with sterilizing toothpick, pressed
1:DEPC water are added in 5 times of volumes, are fully ground in grinding in alms bowl or tissue homogenizer, and 3000g centrifuges 15min, take supernatant be transferred to from
It is spare in heart pipe；
Internal organ sample：Take 50~100mg samples to be tested by 1:DEPC water is added in 5 times of volumes, in stone roller alms bowl or tissue homogenizer
In be fully ground, 3000g centrifuge 15min, take supernatant to be transferred to spare in centrifuge tube；
Nose swab：It with sterilized cotton swab, stretches into hog snout chamber, takes snotter, as nose swab, sent under refrigerated condition
Test in laboratory；
Blood sample：Blood is acquired with asepsis injector, injection contains in the sterile chamber of 1/10 4%EDTA solution, fully
Mixing, number are spare；
Saving specimen and transport：Sample can be immediately available for detecting；If do not detected immediately, sample is preserved at 4 DEG C is no more than 24
Hour, -20 DEG C preservation the no more than 3 moons, -70 DEG C can long-term preservation, multigelation be no more than 5 times；
Sample should be transported by professional special messenger；Short distance transports bag cold insulation on the rocks；Long-distance transport need to add dry ice cold insulation；
(2), the extraction of sample rna
Sample rna is extracted；
(3), the preparation of PCR reaction systems
PCR reaction systems are prepared in preparation of reagents room, wherein 16 μ l of PCR reaction buffers A, 2 μ l of enzyme system B,
2 μ l of primed probe mixed liquor C are dispensed PCR reaction buffers A into PCR reaction tubes by 20 μ l/ pipes, and PCR will be housed and reacted
The reaction tube of liquid moves to sample process area；
(4), it is loaded
Each 5 μ l of processed sample, negative control, positive control supernatant are taken to be added separately to respectively with the suction nozzle with filter core
In PCR reaction tubes equipped with reaction system, lid upper tube cap moves to augmentation detection area after centrifuging the several seconds；
(5), it expands
PCR reaction tubes are put into fluorescent PCR amplification instrument and carry out augmentation detection；
Loop parameter is set：(AB：ABI 7500FAST, Anlong：Pro Eco48, SLAN-96)：
(6) result interpretation
6.1 negative findings judge：In the channels FAM, amplification curve is UNDET not at S types and Ct values；
6.2 positive findings judge：Sample is S-type in the channels FAM amplification curve and value≤36 Ct, then result is the positive；
6.3 experiment gray areas：If sample is S-type in the channels FAM amplification curve and 36 ＜ Ct ＜ 38, result are located at real
Gray area is tested, sample should be rechecked；If it is S-type to recheck result amplification curve, result is judged for the positive, if amplification curve
It is not S-type, then judge result for feminine gender.
Preferably, in the step (2), the QIAampMinElute Virus Spin of QIAGEN companies are used
Kit (article No.s：57704), Tiangeng biochemical technology Co., Ltd virus genom DNA/RNA extracts kit (article No.s：DP315) right
Excreta and blood sample extract, using the AllPrep DNA/RNA Mini Kit (article No.s of QIAGEN companies：80204)
Tissue samples are extracted.
The invention has the advantages that：
(1) high sensitivity：Virus of the detectable template concentrations down to 100PFU/ml；
(2) high specificity：With kit of the present invention to blue ear classics strain, pig parvoviral, porcine rotavirus, pig transmissible
8 kinds of viruses such as marcy agent, pig circular ring virus, swine fever virus, encephalitis B and pig epidemic diarrhea, testing result show to try
The amplification foot and mouth disease virus of agent box energy specificity ensures the reliability of testing result without cross reaction occurs with other nucleic acid；
(3) precision is high, and kit repeats detection 8 times, intermediate value cv to intermediate value and low value precision standard items<1%, low value
cv<1.5%；
(4) foot and mouth disease virus detection kit of the invention has high specificity, high sensitivity, favorable repeatability etc. excellent
Point.Need instrument is relatively easy can be general on alternating temperature qPCR in this method detection process, detection time is short, is as a result easy to sentence
, do not avoid 2 times pollution, it is easy to operate, can in base's large-scale popularization, can relatively easy Quality Control, be easy to standardize.It is more smart
Standard carry out Disease Warning Mechanism, have it is easy to operate, stress not, intuitive, quick and high accurately effect.
Description of the drawings
Fig. 1 is with 6 pig blood hoof-and-mouth diseases of Taqman real-time fluorescent PCR reagent cases pair for detecting foot and mouth disease virus
Malicious testing result figure；
Fig. 2 is the sensitivity technique result figure of the Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus；
Fig. 3 is the specific detection result figure of the Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus；
Fig. 4 is the precision result figure of the Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus.
Specific implementation mode
It is further illustrated below in conjunction with specific embodiment, but the present invention is not limited in these embodiments.
Embodiment 1
The present invention detects pig blood foot and mouth disease virus.
Specifically include following steps：(1) sample collection；(2) extraction of RNA；(3) preparation of PCR reaction systems；(4) add
Sample；(5) it expands；(6) judge result.
(1) sample collection and processing
Biopsy sample：The tonsillotome sample of 7 pigs, number is taken to be with sampling gun：No. 001, No. 002, No. 003,004
Number, No. 005 and No. 006, with asepsis injector acquire blood, injection containing 1/10 4%EDTA solution sterile chamber in, fully
Mixing, number are spare；
(2) extraction (Specimen Treatment Chamber) of sample rna
Use the QIAampMinElute Virus Spin Kit (article No.s of QIAGEN companies：57704), specific extraction step
Suddenly corresponding extracts kit specification is please referred to.
Sample extraction Quality Control result such as Fig. 1
| Number | 001 | 002 | 003 | 004 | 005 | 006 |
| Volume | 50ul | 50ul | 50ul | 50ul | 50ul | 50ul |
| 260/280 | 1.76 | 1.82 | 1.95 | 1.76 | 1.92 | 2.12 |
| Concentration | 59ng/ul | 45ng/ul | 52ng/ul | 65ng/ul | 64ng/ul | 64ng/ul |
(3) preparation (reagent disposed chamber) of PCR reaction systems
It requires to be prepared according to kit specification in preparation of reagents room, PCR reaction buffers 1:16 μ l, enzyme system 3:2μ
L, primed probe mixed liquor 2:2μl.PCR reaction solution is dispensed by 20 μ l/ pipes into PCR reaction tubes, it will be equipped with PCR reaction solution
Reaction tube moves to sample process area.
(4) it is loaded (sample application zone)
Each 5 μ l of processed sample, negative control, positive control supernatant are taken to be added separately to respectively with the suction nozzle with filter core
In PCR reaction tubes equipped with reaction system.Lid upper tube cap moves to augmentation detection area after centrifuging the several seconds.
(5) amplification (amplification room)
PCR reaction tubes are put into fluorescent PCR amplification instrument and carry out augmentation detection.
Loop parameter setting such as table 2：(AB：ABI 7500FAST, Anlong：Pro Eco48, SLAN-96)：
(6) result interpretation
6.1 negative findings judge：In the channels FAM, amplification curve is UNDET not at S types and Ct values；
6.2 positive findings judge：Sample is S-type in the channels FAM amplification curve and value≤36 Ct, then result is the positive；
6.3 experiment gray areas：If sample is S-type in the channels FAM amplification curve and 36 ＜ Ct ＜ 38, result are located at real
Gray area is tested, sample should be rechecked；If it is S-type to recheck result amplification curve, result is judged for the positive, if amplification curve
It is not S-type, then judge result for feminine gender.
Experimental result such as table 3 and Fig. 1.
The foot and mouth disease virus 6 pattern detection results of kit of table 3
Embodiment 2
Sensitivity technique
With the kit sensitivity of the positive control cloned plasmids evaluation present invention, by 10 times of gradients of positive control cloned plasmids
Dilution, detection range 106-100copiea/ul.The result shows that 106-100copiea/ul can be detected, in this range
Interior foot and mouth disease virus can detect, i.e., kit of the present invention can detect the sample of the Pseudorabies virus content of 1 copy.Detection
As a result see Fig. 2.
3 specific detection of embodiment
Blue ear classics strain, pig parvoviral, porcine rotavirus, transmissible gastroenteritis of swine are detected using the kit of the present invention
8 kinds of viruses such as virus, pig circular ring virus, swine fever virus, porcine pseudorabies virus and pig epidemic diarrhea.
Testing result shows the amplification foot and mouth disease virus that kit can be specific, anti-without intersecting with the generation of other nucleic acid
It answers.Testing result is shown in Fig. 3.
Embodiment 4
Precision detects
Foot and mouth disease virus RNA detection kits are to positive control cloned plasmids (1 × 106PFU/ml, 1 × 103PFU/ml)
Foot and mouth disease virus as sample to be checked, be detected with the foot and mouth disease virus RNA detection kits of quality inspection qualification, each is 8 times
It repeats to detect.It is detected in ABI7500 instruments.As a result the detection Ct value coefficient of variation of different nucleic acid concentrations is equal<1%, have
Preferable precision.Testing result is shown in Table 4 and Fig. 4
4 Pseudorabies virus real-time fluorescence PCR detection precision of table detects
The above-described embodiments merely illustrate the principles and effects of the present invention, and is not intended to limit the present invention.It is any ripe
The personage for knowing this technology can all carry out modifications and changes to above-described embodiment without violating the spirit and scope of the present invention.Cause
This, institute is complete without departing from the spirit and technical ideas disclosed in the present invention by those of ordinary skill in the art such as
At all equivalent modifications or change, should by the present invention claim be covered.
Sequence table
<120>A kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus
<141> 2018-04-24
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
aman 4
Claims (8)
1. a kind of Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus, it is characterised in that：It is reacted including PCR
Buffer solution A, FMDV primed probes mixed liquid B, enzyme system C, negative control and positive control.
2. a kind of Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus according to claim 1, special
Sign is：Each component content is as follows：PCR reaction buffers A is that 384 μ l, FMDV primed probe mixed liquid Bs are 48 μ l, enzyme system C
96 μ l, 400 μ l of negative control, 400 μ l of positive control.
3. a kind of Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus according to claim 1 or 2,
It is characterized in that：The group of the PCR reaction buffers A is divided into 5 × PCR buffer (Mg2+Plus) and dNTPs compositions, institute
The group of the enzyme system C stated is divided into the mixture of thermal starting archaeal dna polymerase, Super M-MLV, RRI, and the negative control uses
DEPC-H2O, the positive control use the plasmid bacterial of aftosa target gene fragment.
4. a kind of Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus according to claim 1 or 2,
It is characterized in that：The FMDV primed probes mixed liquid B is made of pair of primers and a specificity fluorescent probe, described
Primer sequence such as SEQ ID NO:1 and SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of the fluorescence probe:3 institutes
Show, the primer sequence SEQ ID NO:1 and SEQ ID NO:2 are：
SEQ ID NO:1：Sense primer ACAAACCTGTGATGGCYT
SEQ ID NO:2：Downstream primer GGAGATCAACTTCTCCTGTA
The probe sequence is：
SEQ ID NO:3：CTCTCCTTTGCACGCCGTG.
5. a kind of Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus according to claim 1 or 2,
It is characterized in that：The primer sequence SEQ ID NO:1 and SEQ ID NO:2 extension increasing sequence and sequence SEQ ID NO:3
Probe primer concentration be 10uM/ul, amplimer is 2 with probe primer proportioning:2:1.
6. a kind of Taqman real-time fluorescent PCR reagent cases for detecting foot and mouth disease virus using described in claims 1 or 22 are examined
Survey the Fluorescence PCR system of aftosa, it is characterised in that amplification system is as follows：
Amplification system：
7. a kind of Taqman real-time fluorescent PCR reagent cases using as claimed in claim 1 or 2 for detecting foot and mouth disease virus are examined
The detection method for surveying aftosa, is as follows：
(1), sample collection and processing
Biopsy sample：Tonsillotome sample is taken with sampling gun, is chosen to 1.5ml centrifuge tubes and is marked with sterilizing toothpick, by 1:5 times
DEPC water is added in volume, is fully ground in grinding in alms bowl or tissue homogenizer, 3000g centrifuges 15min, and supernatant is taken to be transferred in centrifuge tube
It is spare；
Internal organ sample：Take 50~100mg samples to be tested by 1:DEPC water is added in 5 times of volumes, is filled in grinding in alms bowl or tissue homogenizer
Grinding, 3000g is divided to centrifuge 15min, take supernatant to be transferred to spare in centrifuge tube；
Nose swab：It with sterilized cotton swab, stretches into hog snout chamber, takes snotter, as nose swab, experiment is sent under refrigerated condition
It detects room；
Blood sample：Blood is acquired with asepsis injector, injection contains in the sterile chamber of 1/10 4%EDTA solution, fully mixed
Even, number is spare；
Saving specimen and transport：Sample can be immediately available for detecting；If do not detected immediately, sample preserves small no more than 24 at 4 DEG C
When, -20 DEG C preservation the no more than 3 moons, -70 DEG C can long-term preservation, multigelation be no more than 5 times；
Sample should be transported by professional special messenger；Short distance transports bag cold insulation on the rocks；Long-distance transport need to add dry ice cold insulation；
(2), the extraction of sample rna
Sample rna is extracted；
(3), the preparation of PCR reaction systems
PCR reaction systems are prepared in preparation of reagents room, wherein 16 μ l of PCR reaction buffers A, 2 μ l of enzyme system B, primer
2 μ l of probe mixed liquor C are dispensed PCR reaction buffers A into PCR reaction tubes by 20 μ l/ pipes, will be equipped with PCR reaction solution
Reaction tube moves to sample process area；
(4), it is loaded
Each 5 μ l of processed sample, negative control, positive control supernatant are taken to be added separately to be equipped with respectively with the suction nozzle with filter core
In the PCR reaction tubes of reaction system, lid upper tube cap moves to augmentation detection area after centrifuging the several seconds；
(5), it expands
PCR reaction tubes are put into fluorescent PCR amplification instrument and carry out augmentation detection；
Loop parameter is set：(AB：ABI 7500FAST, Anlong：Pro Eco48, SLAN-96)：
(6) result interpretation
6.1 negative findings judge：In the channels FAM, amplification curve is UNDET not at S types and Ct values；
6.2 positive findings judge：Sample is S-type in the channels FAM amplification curve and value≤36 Ct, then result is the positive；
6.3 experiment gray areas：If sample is S-type in the channels FAM amplification curve and 36 ＜ Ct ＜ 38, result are located at experiment ash
Area is spent, sample should be rechecked；If it is S-type to recheck result amplification curve, result is judged for the positive, if amplification curve is not in
S types then judge result for feminine gender.
8. detection method according to claim 7, it is characterised in that：In the step (2), QIAGEN companies are used
QIAampMinElute Virus Spin Kit (article No.s：57704), Tiangeng biochemical technology Co., Ltd virus genom DNA/
RNA extracts kit (article No.s：DP315) excreta and blood sample are extracted, using the AllPrep of QIAGEN companies
DNA/RNA Mini Kit (article No.s：80204) tissue samples are extracted.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810373215.6A CN108611440A (en) | 2018-04-24 | 2018-04-24 | A kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810373215.6A CN108611440A (en) | 2018-04-24 | 2018-04-24 | A kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108611440A true CN108611440A (en) | 2018-10-02 |
Family
ID=63660775
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810373215.6A Pending CN108611440A (en) | 2018-04-24 | 2018-04-24 | A kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108611440A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1560279A (en) * | 2004-03-10 | 2005-01-05 | 云南出入境检验检疫局检验检疫技术中 | Reagent for testing foot and mouth disese virus by fluorescent quantity RI-PCR and its preparation process |
| CN1661088A (en) * | 2004-12-24 | 2005-08-31 | 武汉大学 | Fluorescence quantitative PCR kit for detecting virus of aftosa and application |
| CN102220436A (en) * | 2011-04-06 | 2011-10-19 | 珠海出入境检验检疫局检验检疫技术中心 | Method for detecting FMDV (Foot and Mouth Disease Virus) through real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) |
| CN102260750A (en) * | 2011-07-20 | 2011-11-30 | 东莞出入境检验检疫局检验检疫综合技术中心 | Primers and method for real-time fluorescent reverse transcription-polymerase chain reaction (RT-PCR) detection of foot and mouth disease virus |
| CN103382510A (en) * | 2013-07-22 | 2013-11-06 | 广西壮族自治区动物疫病预防控制中心 | Fluorescent reverse transcription-polymerase chain reaction (RT-PCR) primer and probe for detecting A-type foot and mouth disease virus and kit of primer and probe |
-
2018
- 2018-04-24 CN CN201810373215.6A patent/CN108611440A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1560279A (en) * | 2004-03-10 | 2005-01-05 | 云南出入境检验检疫局检验检疫技术中 | Reagent for testing foot and mouth disese virus by fluorescent quantity RI-PCR and its preparation process |
| CN1661088A (en) * | 2004-12-24 | 2005-08-31 | 武汉大学 | Fluorescence quantitative PCR kit for detecting virus of aftosa and application |
| CN102220436A (en) * | 2011-04-06 | 2011-10-19 | 珠海出入境检验检疫局检验检疫技术中心 | Method for detecting FMDV (Foot and Mouth Disease Virus) through real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) |
| CN102260750A (en) * | 2011-07-20 | 2011-11-30 | 东莞出入境检验检疫局检验检疫综合技术中心 | Primers and method for real-time fluorescent reverse transcription-polymerase chain reaction (RT-PCR) detection of foot and mouth disease virus |
| CN103382510A (en) * | 2013-07-22 | 2013-11-06 | 广西壮族自治区动物疫病预防控制中心 | Fluorescent reverse transcription-polymerase chain reaction (RT-PCR) primer and probe for detecting A-type foot and mouth disease virus and kit of primer and probe |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104328218B (en) | Synchronize nucleic acid and the detection method thereof of the liquid phase genetic chip of detection five boar virus | |
| CN101886138A (en) | Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof | |
| CN103614494B (en) | Two-color fluorogenic quantitative PCR (Polymerase Chain Reaction) detection kit for CDV (canine distemper viruses) and CPV (canine parvo viruses) | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN109517927A (en) | A kind of A type, influenza B virus rapid typing detection reagent box and its application | |
| CN102212623B (en) | Two-color fluorescence quantitative polymerase chain reaction (PCR) combined detection method of swine fever virus and blue ear disease virus and kit thereof | |
| CN104789697A (en) | Four-colored fluorescent quantitative PCR method capable of simultaneously detecting CSFV, PRRSV, PRV and PCV2 and reagent kit thereof | |
| CN108504782A (en) | Primer combination for 4 boar infectious disease viruses of synchronous detection and detection kit | |
| CN104774953B (en) | Fluorescence PCR detection reagent of African swine fever virus CP530R genes and preparation method thereof and purposes | |
| CN106167837A (en) | The real-time fluorescence quantitative PCR detection kit of bovine viral diarrhoea bovine diarrhoea virus and primer special thereof and probe | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN101570798B (en) | Detection kit and detection method for 3 species of food-borne viruses in marine products | |
| CN101392299B (en) | Equine influenza detection kit and detection method | |
| CN108504774A (en) | A method of detection rhinovirus parting and enterovirus | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN103757137B (en) | Common primer nucleic acid amplification method for detecting three pig viruses synchronously and kit | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN109321683A (en) | A kind of A type Sai Nika viral diagnosis primer, kit, method for detecting virus and application | |
| CN108411042A (en) | A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus | |
| CN108611440A (en) | A kind of the Taqman real-time fluorescent PCR reagent cases and its detection method of detection foot and mouth disease virus | |
| CN103205510A (en) | Reverse transcription-polymerase chain reaction (RT-PCR) detection kit for identifying hog cholera virus virulent strain and vaccine attenuated strain | |
| CN107574263A (en) | A kind of kit and method for the type of PCR quick detections pig circular ring virus 3 | |
| CN103114154A (en) | Rhinovirus real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) detection kit and application thereof | |
| CN104611461A (en) | Penaeus vannamei baculovirus detection kit and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181002 |
|
| RJ01 | Rejection of invention patent application after publication |