CN108610398A - One section of functional sequence and the application in secretory protein expression - Google Patents

Abstract

Application the invention discloses one section of functional sequence and in secretory protein expression.The amino acid of the functional sequence is formed by connecting by the secretory protein leader peptide sequences (Pro_mdf) of nerve growth factor signal peptide (NGFSP), GNT, Linker and transformation successively from N-terminal to C-terminal；Tag and Linker can also be inserted between Linker and Pro_mdf to improve purifying process yield.The present invention utilizes the combination of nerve growth factor signal peptide and GNT sequences, secretory protein can be guided to secrete extracellularly potently, improve secretory protein expression quantity.Pro_mdf eliminates PC cleavage sites, has got around the expression product inhomogenous problem caused by leader peptide excision efficiency is low when secretory protein is expressed in vitro, gained expression product is uniform, and expression quantity is high.Gained original albumen can get the destination protein of high yield and high yield pulp1 after site-specific protease digestion.

Description

One section of functional sequence and the application in secretory protein expression

Technical field

The invention belongs to biomedicine technical field, the expression in particular to one section of functional sequence, the sequence carries Body, the mammalian cell containing the sequence.

Background technology

Many albumen of living nature are synthesized into inactive amyloid protein precursor molecule first in the cell, by signal peptide (pre Area), leader peptide (areas pro) and mature peptide (being maturation protein) three parts composition (preproprotein), or only by signal Peptide (areas pre) and mature peptide (being maturation protein) two parts composition (preprotein).Guiding of the amyloid protein precursor in signal peptide Under, it is transported in endoplasmic reticulum, is further processed, is modified, and in the work of signal peptidase (signalpeptidase, SPase) With lower excision signal peptide sequence；Then it is transported to golgiosome, then is further processed, and in a kind of precursor protein invertase Under the action of (proprotein convertase, PC), leader peptide sequences are cut off, active maturation protein is converted into；Finally Biological function is played outside secretion to cytoplasma membrane.It deserves to be called after stating synthesis in the cell, by point of endoplasmic reticulum and golgiosome Choosing, processing, modification, and it is secreted into the protein that biological action is played outside cytoplasma membrane, it is secretory protein.

There are two types of the secretory proteins of type：One kind is to pass through adjustment type secretory pathway (regulated secretory Pathway) albumen secreted, mainly endocrine and neuroendocrine peptide hormone and neuropeptide, such as insulin, cytokinesin (lipotropin, LPH), endorphin (endorphin) etc.；Another kind is to pass through composing type secretory pathway (constitutive Secretorypathway) the albumen secreted, including growth factor, receptor, adhesion molecule, plasma protein (containing coagulation factor and Complement system protein), matrix metalloproteinase, outer virionic membrane glycoprotein and bacterial exotoxin etc., such as：Nerve growth factor (β-NGF), transforming growth factor (TGF-β 1), insulin receptor, albumin, Ⅸ factor of blood coagulation, von Willebrand factor (vonWillebrand factor, vWF), Complement C_3, inhibition of HIV outer membrane protein gp160, A type avian flu virus hemagglutinin, charcoal Deep carbuncle element protective antigens, diphtheria toxin, etc..

These secretory proteins are to have a specific precursor in its leader peptide carboxyl terminal (C-terminal) there are one common feature The cutting sequence of convertase, and the cutting sequence has common conserved motifs：(K/R)-(X)n-(K/R)↓. (Shiryaev SA, et al. (2013) PLoS ONE 8 (1):E54290.) wherein K and R is amino acid one-letter abbreviations generation Code, respectively lysine and arginine；X represents arbitrary amino acid, and n indicates the quantity of arbitrary amino acid, is equal to 0,1,2,4 or 6, When n is more than 1, X can be the same or different；↓ precursor protein invertase cleavage site is represented, it is downstream mature peptide, under First amino acid of trip is denoted as the positions P1 ', and second amino acid in downstream is the positions P2 ', and so on；The amino acid of the positions P1 ' is For first amino acid of mature peptide aminoterminal (N-terminal)；Similarly, using the cleavage site as starting point, toward the first of upstream-number A amino acid is denoted as P1, and second amino acid is denoted as P2, and so on；P1 amino acid is leader peptide C-terminal The last one amino acid.

Have now been found that precursor protein conversion enzyme family shares 9 members, respectively PC1/3, PC2, furin (not woods albumen Enzyme), PC4, PC5/6, PACE4 (pairs of basic amino acid nickase 4), PC7, SKI-1/S1p (subtilopeptidase A or Kexin enzyme isoenzymes 1), PCSK9 (9 type of proprotein convertase subtilisin or kexin enzymes).(Shiryaev SA, et al.(2013)PLoS ONE 8(1):e54290.)

With the development of technique for gene engineering, a large amount of secretory proteins obtain expression system by extracorporeal recombinant DNA expression technology It is standby.Extracorporeal recombinant DNA expression technology is by the precursor molecule (preproprotein of the maturation protein (destination protein) of quasi- acquisition Or preprotein) gene (DNA sequences encoding) imports carry out table in suitable host cell by suitable expression vector It reaching, while realizing secretory protein post translational processing in the cell, modification, final secretion is extracted for people and is prepared to extracellular, Obtain required maturation protein (destination protein).Used expression system has prokaryotic expression system, yeast expression system, insect Baculovirus expression system and mammalian cell expression system, etc..Wherein since mammalian cell expression system has： It is modified after capable of realizing correct effective protein translation, albumen is enable correctly to be folded into the structure closest to natural molecule；Can have Secretory protein is imitated to extracellular；The expression of host cell background is relatively low, the features such as being conducive to isolate and purify, and generally by people institute With (CN 106478801A).

Secretory protein is prepared for effective, great expression, for industries such as medicine, food, herdings, people are around raising albumen Secernment efficiency improves protein expression yield expansion a lot of research work.To improve protein secretion expression efficiency, people attempt to letter Number peptide sequence is optimized, is screened, and is desirably to obtain one strong secretion signal peptide sequence, so that destination protein secernment efficiency is improved, is reached To the purpose for improving expression yield.(WO 2008/148519A2) Zhang et al. change proleulzin (IL-2) signal peptide n- The alkalinity and hydrophobicity in area and the areas h- make destination protein (P-ALP or Endostatin) in breast cancer cell (MDA- MB-435 cells) in secretory volume improve to 2.5~3.5 times.(Zhang L,Leng Q,MixsonAJ.(2005)J Gene Med 7(3):354-365.) it is glimmering to compared Gaussiaprinceps (a kind of Marine copepod animal) by Knappskog et al. Light element enzyme signal peptide, human IL-2's signal peptide and human albumin signal peptide are thin in CHO to the Fluorescent element enzyme or human endostatin The influence of secretory volume in born of the same parents finds that the guiding secretion of the Fluorescent element enzyme signal peptide is better than human albumin signal peptide (Knappskog et al.(2007)J Biotechnol 128(4):705-715.)；However Lars et al. pass through screening Totally 16 kinds of signal peptides of the different generas such as mammal, fish, scorpion, snail, fungi, plant, virus and bacterium to antibody or melt The guiding secretion of hop protein, finder's human serum albumin signal peptide and man day blueness kill the anti-of plain (azurocidin) signal peptide guidance The secreting, expressing amount of body or fusion protein is higher, other signal peptides cannot improve secreting, expressing amount.(Lars K,Christoph Z,Juergen B.(2013)Biotechnol.Bioeng.110:1164-1173.) both seem contradictory result prompt not Only signal peptide sequence itself, the protein sequence in signal peptide downstream can also influence the secreting, expressing efficiency of destination protein.(Khar HC,Shoba R.(2008)BMC Bioinformatics.9(Suppl 12):S15) thus, to screen, optimization is potent, energy The signal peptide sequence for improving secretory protein expression quantity also needs system, arduous research work.

In addition, a problem being also commonly present when using mammalian cell vivoexpression secretory protein is precursor protein Leader peptide fails effectively to cut off in host cell, is just secreted into extracellularly, leads to the presence of former albumen in cell culture (proprotein, the destination protein containing the areas pro) and two kinds of compositions of maturation protein (destination protein) (Wise R.J., et al. (1990)Biochemistry.87:9378-9382.Oda,K.et al.(1989) Biochem.Biophys.Res.Commun.163:194-200.Gentry,L.E.,et al.(1987) Mol.Cell.Biol.7:3418-3427.).Due to easily forming heterodimer or heterologous poly between former albumen and maturation protein Body undoubtedly brings difficulty to isolating and purifying for destination protein, while also undoubtedly reducing the expression quantity of destination protein and final Yield and yield.One common practice is, while the precursor molecule gene of secretory protein is transferred to host cell or it Afterwards, then it is transferred to a kind of precursor protein invertase (PC) gene, secretory protein and PC is made to co-express, the excision to improve leader peptide is imitated Rate obtains high expression and high yield (Wise R.J., et al. (1990) Biochemistry.87 of destination protein:9378- 9382.PatriciaA.,et al.(1990)J Cell Biol.111(6Pt 2):2851-2859.Liu JM,et al. (2014)Protein J.33:174-183.).But this way can undoubtedly increase the difficulty and complexity of molecules upstream structure, The risk of instability for also bringing along host cell simultaneously, increases the screening difficulty and workload of stable transfected cells strain.

Thus, it still needs to establish a kind of secretory protein expression of effective, high expression yield.

Invention content

In order to solve the problems, such as manually to prepare the above-mentioned multiple technologies of secretory protein, the present invention has carried out numerous studies analysis, And it obtains to draw a conclusion：

It improves signal peptide guiding secretory protein precursor and enters classical secretory pathway (adjustment type secretory pathway and composing type secretion Approach) efficiency, be to improve secretory protein to secrete cell efficiency, and then improve the key link of expression yield.The height of signal peptide Effect guiding depends not only on signal peptide sequence itself, while also depending on the protein sequence composition in signal peptide downstream, passes through research It was found that the tandem compound of nerve growth factor signal peptide and 6~12 amino acid sequences before GLP-1 analog N-terminals, it can be efficient Guiding secretory protein secretes cell.

In a first aspect, the present invention provides one section of functional sequence, amino acid sequence from N-terminal to C-terminal successively by：NGF SP, GNT, Linker and Pro_mdf are formed by connecting；

The amino acid sequence of the NGF SP is：MSMLFYTLIT (A/V) (F/L) LIG (I/V) QA, wherein the 11st ammonia Base acid is alanine (A) or valine (V), and the 12nd amino acids are phenylalanine (F) or leucine (L), the 16th amino acids For isoleucine (I) or valine (V)；

The amino acid sequence of the GNT is：Preceding 6~12 amino acid sequences of H (G/A) EGTFTSD (V/L) S (S/K), Wherein, the 2nd amino acids are glycine (G) or alanine (A), and the 10th amino acids are valine (V) or leucine (L), the 12 are serine (S) or lysine (K)；

The amino acid sequence of the Linker is：Contain glycine (G), serine (S), alanine (A) and threonine (T) Middle at least one amino acid, sequence length are not more than 20 amino acid；

The amino acid sequence of the Pro_mdf contains site-specific protease cutting sequence, is converted without precursor protein Enzyme sequence.

In above-mentioned technical proposal, NGF SP are nerve growth factor signal peptide sequences.Nerve growth factor signal peptide is by 18 A amino acid composition, highly conserved in mammals, concensus sequence is MSMLFYTLIT (A/V) (F/L) LIG (I/V) QA, Only the 11st is alanine (A) or valine (V), and the 12nd is phenylalanine (F) or leucine (L), and the 16th is different bright ammonia Sour (I) or valine (V).It will be understood to those of skill in the art that the amino acid substitution between A and V, F and L, I and V, is same Justice mutation, does not influence the allomeric function of more peptide or proteins.Thus, it will be understood to those of skill in the art that heretofore described The optional employment of nerve growth factor signal peptide, rat, mouse, cavy, ox, orangutan and Squirrel monkey nerve growth factor signal peptide Sequence, or using the mutant sequence after single or multiple amino acid same sense mutations.

GNT is 6~12 amino acid sequences before glucagon-like-peptide-1 (GLP-1) analog N-terminal.Glucagon Sample peptide -1 (GLP-1) analog is a kind of molecule that can be used for treating diabetes B, belongs to GLP-1 receptor stimulating agents, including Chinese mugwort Fill in that peptide (Exenatide), Liraglutide (Liraglutide), Du Lalu peptides (Dulaglutide), Ai Bilu peptides (Albiglutide), Li Xina peptides (Lixisenatide), etc., 12 amino acid sequences are highly conserved before N-terminal, and one Cause sequence is H (G/A) EGTFTSD (V/L) S (S/K), and only the 2nd is glycine (G) or alanine (A), and the 10th is valine (V) or leucine (L), the 12nd is serine (S) or lysine (K).It will be understood to those of skill in the art that G and A, V and L, Amino acid substitution between S and K is same sense mutation, does not influence the whole biological function of more peptide or proteins.

It is convenient for statement, by 6~12 amino acid sequences before GLP-1 analog N-terminals, sequences of referred to as GNT6~12 successively Row.For example, 6 amino acid sequences are H (G/A) EGTF before heretofore described GLP-1 analogs N-terminal, it is denoted as GNT6, preceding 7 A amino acid sequence is H (G/A) EGTFT, is denoted as GNT7, and so on, preceding 12 amino acid sequences are H (G/A) EGTFTSD (V/L) S (S/K), is denoted as GNT12.

Linker is polypeptide linker sequence.It is connected with polypeptide linker sequence (Linker) between GNT sequences and Pro_mdf, To avoid the influence of GNT sequence pair secretory protein structure or functions.It will be understood to those of skill in the art that peptide linker is here The effect of introns (spacer) is served as, should have certain flexibility.Peptide linker contains glycine (G), serine (S), the third ammonia At least one amino acid in sour (A) and threonine (T), sequence length are not more than 20 amino acid.In some preferred embodiments In, peptide linker is selected from and is made of SGGGGG, SSGGGG, GGGGG, GGGGS, GGGGGS, GGGGSS, GSGSGS, GGGSSS Any sequence in group.

Pro_mdf is then the secretory protein leader peptide sequences of transformation, it should be pointed out that, which is and needs to secrete The albumen of expression, the i.e. corresponding leader peptide sequences of ripe peptide sequence of secretory protein.

The secretory protein leader peptide sequences of the transformation can be completed to be transformed by following two modes：

(a) it transform natural leader peptide C-terminal PC (precursor protein invertase) cutting sequence of secretory protein as site spy Foreign preteins cleavage sequences are eliminated PC cleavage sites including by the way of mutation；Or

(b) the secretory protein leader peptide sequences of the transformation are only site-specific protease cutting sequence.

The secretory protein leader peptide sequences of above-mentioned transformation, C-terminal PC cutting sequences abide by conserved motifs：(K/R)-(X)n- (K/R) ↓, X represents arbitrary amino acid, and n indicates the quantity of arbitrary amino acid, is equal to 0,1,2,4 or 6, and when n is more than 1, X can be with It is identical to can also be different.Such as：Albumin leader peptide PC cutting sequences be RGVFRR ↓, Ⅸ leader peptide PC cutting sequences of Factor For RPKR ↓, 1 leader peptide PC cutting sequences of TGF-β be RHRR ↓, the leader peptide PC cutting sequences of β-NGF and vWF be RSKR ↓. In the present invention, the secretory protein leader peptide C-terminal PC cutting sequences are passed through into amino acid mutation, displacement, insertion or deletion etc. Mode transform site-specific protease (Site specific protease) cutting sequence as, before eliminating secretory protein The PC cleavage sites for leading peptide make host cell be only capable of secreting the former protein molecular of secretory protein, solve because leader peptide is cut off Expression product caused by inefficient is inhomogenous, and (there are the condensate of former albumen, maturation protein, former albumen and maturation protein etc. is more Kind ingredient) the technical issues of.It will be understood to those of skill in the art that the secretory protein leader peptide sequences of the transformation further include leading to Cross the mode of amino acid mutation, in mutant leader peptides in addition to C-terminal PC cutting sequences existing for other regions, thoroughly to eliminate PC Cleavage site.

In certain embodiments of the present invention, it when secretory protein is expressed in recombinant mammalian cells in vitro, is not required to The help of leader peptide is wanted to process, fold, it is only necessary to which signal peptide achieves that vitro recombination cell is expressed, and produces maturation protein, example Such as human endostatin (Endostatin), leptin (Leptin), insulin-like growth factor-i (IGF-1), fibroblast life The long factor 21 (FGF21), monoclonal antibody, monoclonal antibody fragment, etc. in these embodiments, Pro_mdf sequences can be only For site-specific protease cutting sequence.

Second aspect, another section of functional sequence provided by the invention, based on above-mentioned functional sequence, in the Linker and Between Pro_mdf, it is also associated with Tag and Linker.

The present invention is to ensure that GNT sequences, Tag sequences and Pro_mdf's (the secretory protein leader peptide sequences of transformation) is mutual Independent, integrality, structure and function are unlikely to interfere with each other, and are used respectively between GNT sequences, Tag sequences and Pro_mdf more Peptide linker sequence (Linker) connects, and the polypeptide linker sequence is characterized above.Same domain technical staff will be understood that, Polypeptide linker sequence between polypeptide linker sequence between GNT sequences and Tag sequences and Tag sequences and Pro_mdf can phase It is same or different.

Tag, that is, protein tag sequence is inserted into the behaviour such as purifying, detection and the tracer that protein tag sequence is more advantageous in production Make.

The protein tag be selected from but not limited to by：Histidine tag (His6), Flag labels, HA labels, c-Myc labels Any label in the group formed with green fluorescent protein (GFP).The protein tag is that those skilled in the art institute is ripe Know, and be used widely in basic research and commercially produced product production, for conducive to mesh such as purifying, detection and tracers , such as：Histidine tag (His6) is made of 6 histidines, amino acid sequence HHHHHH, histidine residues side chain and nickel Ion has strong attraction, thus available immobilization metal chelate chromatography (IMAC) isolates and purifies secretory protein； Flag sequence labels are DYKDDDDK, and detection, the identification of secretory protein can be carried out by anti-Flag antibody, can also be by anti- Flag affinity chromatographys (using Anti-Flag affinity gels filler) carry out isolating and purifying for albumen；HA sequence labels are YPYDVPDYA, c-Myc sequence label are EQKLISEEDL, and available corresponding antibodies are detected, to understand secretory protein in place Expression in chief cell；GFP protein tags can be used for understanding positioning, migration and variation etc. of the secretory protein in host cell Situation.

Optional or preferred, the Tag is histidine tag, Flag labels, HA labels, c-Myc labels or green Fluorescin (GFP).

Optional or preferred, in the functional sequence of any description above, the site-specific protease is blood coagulation Enzyme (Thrombin), Ⅹ factor of blood coagulation (Factor Xa), marmor erodens (TEV) protease, HRV HRV 3CPs or intestines swash Enzyme (Enterokinase).Preferably, the site-specific protease is fibrin ferment, Ⅹ factor of blood coagulation or TEV protease；More For preferably, the site-specific protease is fibrin ferment.

Such as：Blood coagulation cleavage sequences are LVPR ↓ GS or GR ↓ G, and Factor Xa cutting sequences are I (E/D) GR ↓ (wherein Second amino acids are glutamic acid (E) or L-aminobutanedioic acid (D)), TEV protease cutting sequence is ENLYFQ ↓ (G/S) (wherein the Seven amino acids are glycine (G) or serine (S)), HRV HRV 3CP cutting sequences are LEVLFQ ↓ GP, enterokinase cutting Sequence is D (D/E) (D/E) (D/E) K ↓ (second and third, four amino acids be L-aminobutanedioic acid (D) or glutamic acid (E)), can be by right The protease answered is in single-minded site (↓ site represented is disconnected in closely ↓ preceding amino acid c-terminus) cutting, excision secretion Proteins leader peptide and its upstream sequence, obtain destination protein.

In a preferred embodiment of the invention, the site-specific protease cutting sequence is blood coagulation cleavage sequences GR ↓ G, Factor Xa cutting sequences I (E/D) GR ↓ (wherein the second amino acids be glutamic acid (E) or L-aminobutanedioic acid (D)) or TEV protease cutting sequence ENLYFQ ↓ S.In being more highly preferred in embodiment for the present invention, the site-specific protease is cut It is blood coagulation cleavage sequences GR ↓ G to cut sequence.

The third aspect, the present invention provides the encoding genes of the functional sequence of any description above.

Fourth aspect, the present invention provides a kind of secretory protein precursor molecules, by the functional sequence C of any description above End connection secretory protein maturation peptide sequence composition.

I.e. its amino acid sequence from N-terminal to C-terminal successively by：NGF SP, GNT, Linker, Pro_mdf and mature peptide (are Maturation protein) be formed by connecting or its amino acid sequence from N-terminal to C-terminal successively by：NGF SP、GNT、Linker、Tag、 Linker, Pro_mdf and mature peptide (being maturation protein) are formed by connecting.

The secretory protein precursor molecule is inactive, needs sorting, processing, modification using endoplasmic reticulum and golgiosome, Biological action is played as being secreted into after maturation protein outside cytoplasma membrane.

Optional or preferred, the secretory protein is nerve growth factor (β-NGF), transforming growth factor (TGF-β 1), albumin, Ⅸ factor of blood coagulation (Factor Ⅸ), von Willebrand factor (von Willebrand factor, vWF), Human endostatin (Endostatin), leptin (Leptin), insulin-like growth factor-i (IGF-1), fibroblastic growth The factor 21 (FGF21), monoclonal antibody or monoclonal antibody fragment or their functional variant thereof.

The functional variant thereof refers to that the stability of destination protein (maturation protein), bioactivity, receptor is affine to improve Power reduces immunogenicity, or extends the improvement in functionality such as Half-life in vivo, passes through amino acid mutation, displacement, insertion or deletion etc. The mutant that mode is transformed to the single or multiple amino acid of maturation protein, and obtains.

In a preferred embodiment of the invention, the secretory protein precursor molecule includes successively from N-terminal to C-terminal：Nerve Growth factor signal peptide sequence；GNT sequences；Polypeptide linker sequence (Linker), selected from by SGGGGG, SSGGGG, GGGGG, Any sequence in the group of GGGGS, GGGGGS, GGGGSS, GSGSGS, GGGSSS composition；Protein tag sequence (Tag), is selected from Any sequence in the group that histidine tag (His6), Flag labels, HA labels and c-Myc labels are formed；Peptide linker sequence It arranges (Linker), selected from what is be made of SGGGGG, SSGGGG, GGGGG, GGGGS, GGGGGS, GGGGSS, GSGSGS, GGGSSS Any sequence in group；C-terminal Furin cleavage sequences transform the NGF leader peptides of blood coagulation cleavage sequences as；β-NGF, are selected from Any sequence in the group be made of NGF (120), NGF (118) and NGF (117).

The nerve growth factor (β-NGF) be Rita Levi-Montalcini in nineteen fifty-three out of mice sarcoma cell It was found that first neurotrophic factor, β-NGF are able to maintain that and promote sympathetic nerve and sensory nerve from neural crest thin Survival, differentiation and the maturation and execution function of born of the same parents is an important factor for participating in injured nerve regeneration and function reparation.β-NGF Be synthesized into first in the cell 241 amino acid composition precursor molecule (preproNGF), preproNGF people, rat, Amino acid sequence homology is up to 78% in mouse, cavy, orangutan and Squirrel monkey, and last three amino acid sequences of C-terminal are RRA/G；PreproNGF, by signal peptidase excision signal peptide (areas pre), forms proNGF (223 amino acid groups in endoplasmic reticulum At), then be transported in golgiosome, through Furin enzyme digestions, leader peptide is removed, generates ripe NGF albumen (120 amino acid Composition), it is denoted as NGF (120)；When using mammalian cell vivoexpression β-NGF, it is frequently present of C-terminal and lacks 2 amino Sour (RA/G) or 3 amino acid (RRA/G), are denoted as NGF (118), the latter is denoted as NGF (117) by the former.NGF(120)、NGF (118) and NGF (117) can be considered the functional variant thereof of a type of β-NGF, and stability and in-vitro recombination expression efficiency are equal There is some difference (referring to patent announcement CN102898514B).

In the present invention more preferably embodiment, the secretory protein precursor molecule includes successively from N-terminal to C-terminal： Nerve growth factor signal peptide sequence；GNT10；SGGGGG；HHHHHH；GGGGG；C-terminal Furin cleavage sequences transform as solidifying The NGF leader peptides of hemase cutting sequence；NGF(117).

5th aspect, the present invention provides the encoding genes of the secretory protein precursor molecule of any description above.

It is counter to be translated into DNA sequence dna by the secretory protein precursor molecule amino acid sequence of above-mentioned structure, referring concurrently to host cell Preference codon table, and the factors such as the sub- degeneracy of combining cipher, G/C content, the mRNA structures of transcription and its stability are to the DNA Sequence optimizes.It can refer to document (Cai HY, et al. (2013) Chin J Biotech.29 (9):1201-1213.) or Using OptimumGene^TMSoftware carries out DNA sequence dna optimization, finally obtains the DNA sequences for encoding above-mentioned secretory protein precursor molecule Row.

6th aspect, the present invention provides a kind of expression vector, the coding base containing above-mentioned secretory protein precursor molecule Cause and expression control element.

The expression control element is the control sequence effectively to replicate, expressing needed for the DNA sequence dna, is such as replicated Point, promoter, enhancer；Required machining information site, such as ribosome bind site, KOZAK sequences, RNA splice sites, interior Containing subsequence, site of polyadenylation and transcription terminator sequences；And riddled basins, such as dihyrofolate reductase (DHFR) gene, glutamine synthelase (GS) gene, neomycin resistance gene, puromycin resistance gene, bleomycin are anti- Property gene, hygromycin gene, pluramycin resistant gene etc..

7th aspect, the present invention provides a kind of mammalian cells, contain above-mentioned expression vector.The present invention, which expresses, to be carried The host cell of body is mammalian cell.

It is optional or preferred, above-mentioned mammalian cell, initial cell be Chinese hamster ovary cell (CHO), Human embryonic kidney 293 cell, COS cells, Hela cells or mdck cell.Initial cell refer to do not carry out expression vector be transferred to it is thin Born of the same parents.

Eighth aspect, the present invention provides a kind of preparation methods of secretory protein, which is characterized in that includes the following steps：

(1) by above-mentioned expression vector transfection mammalian cell；

(2) cell of the screening containing above-mentioned expression vector or the encoding gene for being integrated with above-mentioned secretory protein precursor molecule Strain；

(3) culture gained cell strain collects the former albumen (proprotein) that culture solution and purifying cells secret out of；

(4) site-specific protease digestion original albumen is used, and isolates and purifies to obtain destination protein.

The mammalian cell be preferably Chinese hamster ovary cell (CHO), human embryonic kidney 293 cell, COS cells, Hela cells or mdck cell.

The transfection is expression vector to be introduced host cell, for example the process of mammalian cell, transfection method include Calcium phosphate precipitation, electroporation, liposome method and polymer (such as PEI) method.Whether it is integrated in host based on target gene Cellular genome, transfection can be divided into stable transfection and transiently transfect two ways.Any mode is specifically taken to depend on experiment Purpose and economic and technical factor, as stable transfection is clinical thin with stabilization, the high efficient expression of business application commonly used in exploitation Born of the same parents' strain, to express, prepare the albumen needed for the industries such as medicine, food, herding；And it transiently transfects and is effectively applied to high throughput The screening of drug and the product analysis of early stage and evaluation.

Usually using the riddled basins on expression vector, come screen stablized, the cell strain of high efficient expression.Screening Marker gene can express generation drug resistance, the drug such as neomycin (G418), puromycin, bleomycin, hygromycin, Pluramycin etc..By drug screening identification, (for example, being integrated with the cell of riddled basins can survive, and other are not integrated Have the cell of riddled basins can be dead), can get expression vector or genome conformity described in stable transfection has described in coding The cell strain of the DNA sequence dna of secretory protein precursor molecule；In addition, riddled basins, which are not only expressed, generates drug resistance, may be used also The copy number for increasing itself and neighbouring target gene with the raising of drug concentration (being screening pressure), to improve target The expression quantity of albumen, such riddled basins such as dihyrofolate reductase (DHFR) gene and glutamine synthelase (GS) base Cause, corresponding screening drug are methotrexate (MTX) (MTX) and methionine imino group for sulfone (MSX).Thus, those skilled in the art It will be understood that being screened by above-mentioned antibiotic medicine, in conjunction with DHFR-MTX screening systems or GS-MSX screening systems, can get The cell strain of stability and high efficiency expression.

The purifying of former albumen and destination protein is known in the art, and can be used including ammonium sulfate precipitation, ultrafiltration, affine layer The general purification technique such as analysis, ion-exchange chromatography, hydrophobic chromatography, gel permeation chromatography.Due to containing Tag sequences in former albumen, Affinity chromatography, such as nickel ion metal chelate chromatography, Anti-Flag affinity chromatography technologies can be easily utilized to be purified.

Compared with prior art, the invention has the advantages that：

The present invention utilizes the group of nerve growth factor signal peptide and 6~12 amino acid sequences before GLP-1 analog N-terminals It closes, guiding secretory protein that can be potent is secreted extracellularly, improves secretory protein expression quantity.Meanwhile it by mutation, eliminating point The PC cleavage sites for secreting proteins leader peptide, got around secretory protein in vitro mammalian cell expression when, because leader peptide is cut Except the low caused expression product of efficiency is inhomogenous, (there are the condensate of former albumen, maturation protein, former albumen and maturation protein etc. is more Kind ingredient) the technical issues of；Gained expression product is uniform (a kind of only ingredient of former albumen), and expression quantity is high.The present invention is also in original Protein N terminal upstream is provided with protein tag sequence, is conducive to isolating and purifying for former albumen, improves purifying process yield；Institute Former albumen is obtained after site-specific protease digestion, can get the destination protein of high yield and high yield pulp1.

Description of the drawings

Fig. 1：The tactic pattern figure of secretory protein precursor molecule of the present invention.Secretory protein precursor molecule is in the cell by signal Peptase (SPase) digestion removes signal peptide；Through site-specific protease (Site specific after isolating and purifying Protease) digestion removes leader peptide and its upstream sequence, generates maturation protein (Mature)；SPase and Site The cleavage site of specific protease is shown with lightning sample arrow.

Fig. 2：The transient expression amount column of NGF (118) recombinant expression carriers and native-NGF (118) recombinant expression carrier Figure.It compared the expression effect that linear plasmid transiently transfects and super spirial plasmid transiently transfects respectively, Dark grey column is pCHO- SU1-NGF (118) carrier, light grey column are pCHO-SU1-native-NGF (118) carrier.

Fig. 3：NGF (118) recombinant expression carriers and native-NGF (118) recombinant expression carrier super spirial plasmid instantaneously turn Contaminate culture supernatant Western Blot detection figures.1 is turns culture supernatant in pCHO-SU1-NGF (118) super spirial plasmid wink, and 2 are PCHO-SU1-native-NGF (118) super spirial plasmid wink turns culture supernatant.

Fig. 4：The stable transfection expression quantity column of pCHO-SU1-Gis-NGF (118) and pCHO-SU1-native-NGF (118) Shape figure.Dark grey column is pCHO-SU1-Gis-NGF (118) carrier, and light grey column carries for pCHO-SU1-native-NGF (118) Body.

Fig. 5：Mass spectrography detects G-NGF (117) molecular weight results.

Specific implementation mode

The present invention is further explained in the light of specific embodiments, so that those skilled in the art can be better Understand the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.

In the present specification, unless specifically stated otherwise, otherwise technical term used is that those skilled in the art are normal Use term；Test method without specific conditions is routinely experimental method in this specification；It is tried used in this specification It tests material to be commercially available products unless otherwise instructed, the ingredient and preparation method of various reagents and culture medium can be found in routine Operation in laboratory manual.

Embodiment 1：The expression and preparation of NGF (118)

(1) acquisition of NGF (118) precursor molecule coding DNA

In the present embodiment, involved NGF (118) precursor molecule has NGF SP-GNT10-SGGGGG-HHHHHH- GGGGG-NGF Pro_mdf-NGF (118) structure, structure meet ideograph as shown in Figure 1.Wherein Tag sequences are group ammonia Acidity scale label (HHHHHH) are Linker sequences, respectively SGGGGG and GGGGG before and after the label.

In the present embodiment, after involved NGF (118) precursor molecule synthesizes in the cell, in NGF SP sequences and Under the guiding of GNT10 combined sequences, signal peptide NGF SP sequences are cut off by signal peptidase (SPase) digestion in endoplasmic reticulum, and With former protein form efficiently secrete it is extracellular；In the present embodiment, NGF (118) original albumen has GNT10-SGGGGG-HHHHHH- GGGGG-NGF Pro_mdf-NGF (118) structure, then remove leader peptide and its upstream sequence through site-specific protease digestion Row generate NGF (118) mature peptide.

NGF SP are NGF signal peptide sequences, select in the present embodiment the people's NGF signal peptides, sequence to be MSMLFYTLITAFLIGIQA；GNT10 is 10 amino acid sequences before GLP-1 analog N-terminals, and sequence is selected in the present embodiment For HGEGTFTSDV；In the present embodiment, NGF Pro_mdf are by the Furin cleavage sequences of NGF leader peptide sequences C-terminals RSKR/H ↓ (the 118th to 121 amino acids of preproNGF molecules) transform blood coagulation cleavage sequences XYGR ↓ G as；It is wherein described X, Y is arbitrary non-alkaline amino acid (i.e. non-R, K or H), and it is non-that preferably side-chain radical steric hindrance is small and/or side-chain radical is hydrophilic Basic amino acid, such as G, L, S, T；It will be understood to those of skill in the art that X, Y can be identical or different, it is preferable that X, Y are respectively G and S；Thoroughly to eliminate Furin cleavage sites, in the present embodiment, also by potential Furin digestions in NGF leader peptide sequences Sequence (the 49th to 52 of preproNGF molecules, RRAR/H and the 80th to 83, RRLR/H) is cut to give by way of mutation To eliminate, the amino acid (R/H) of the 52nd of preproNGF molecules and 83 are such as sported into alanine (A) respectively, sequence is prominent It is respectively RRAA and RRLA after change, it cannot be by Furin cleavages；The NGF (118) is natural NGF mature peptides (120 amino Acid composition) C-terminal lack 2 amino acid (RA/G) mutant.

In the present embodiment, it is XYGR ↓ G that site-specific protease, which selects fibrin ferment, cutting sequence, and sequence signature is Hereinbefore characterize.It will be understood to those of skill in the art that since fibrin ferment is in the 4th amino acids (smart ammonia of the cutting sequence Acid, R) c-terminus cut, cause NGF (118) the mature peptide N-terminal generated to be added there are one glycine (G).NGF N-terminals Add a G, do not influence its biological activity, and can bring and increase protein stability, convenient for technique effects such as amalgamation and expressions (CN106749605A), it is denoted as G-NGF (118).

In the present embodiment, the specific amino acid sequence of NGF (118) precursor molecule is as shown in SEQ ID NO.1, GNT10 and prominent Sequence after change lines out below, and NGF Pro_mdf sequences are shown with italic overstriking.

SEQ ID NO.1：

It is counter to be translated into DNA sequence dna by above-mentioned NGF (118) precursor molecule amino acid sequence, have a preference for referring concurrently to Chinese hamster ovary celI close Numeral table (Wang Zhiyun, etc..China's experiment and clinical virology magazine.2006；20(3):266-269), and combining cipher is simple And the factors such as property, G/C content, the mRNA structures of transcription and its stability, using OptimumGene^TMIt is excellent that software carries out DNA sequence dna Change, design obtains the DNA sequence dna for being suitable for encoding NGF (118) precursor molecule.Specifically as shown in SEQ ID NO.2, wherein 5 ' ends Containing AvrII restriction enzyme sites (CCTAGG) and KOZAK sequences (GCCACC), Bstz17I restriction enzyme sites (GTATAC) are contained at 3 ' ends With terminator codon (TGA), shown with underscore.

SEQ ID NO.2：

CCTAGGGCCACCATGAGCATGCTGTTCTACACACTGATCACCGCTTTTCTGATCGGCATCCAGGCCCATGGCGAGGG CACATTCACCAGCGACGTGTCTGGAGGAGGAGGAGGACACCATCACCATCACCATGGCGGAGGAGGAGGAGAGCCTC ACTCCGAGAGCAACGTGCCTGCTGGCCACACAATCCCACAGGCCCATTGGACCAAGCTGCAGCACAGCCTGGATACA GCTCTGAGGAGGGCTGCTTCTGCCCCAGCTGCTGCTATCGCTGCTAGGGTGGCTGGCCAGACACGGAATATCACCGT GGACCCCAGGCTGTTCAAGAAGAGACGCCTGGCCTCTCCCAGGGTGCTGTTCTCCACACAGCCACCTCGGGAGGCTG CTGATACCCAGGACCTGGATTTCGAAGTGGGAGGAGCTGCTCCCTTCAACAGAACCCATGGATCCGGAAGGGGATCC AGCTCTCACCCAATCTTCCATAGAGGCGAGTTTAGCGTGTGCGACTCCGTGTCCGTGTGGGTGGGCGACAAGACCAC AGCTACAGATATCAAGGGCAAGGAAGTGATGGTGCTGGGCGAAGTGAATATCAACAATTCCGTGTTCAAGCAGTACT TCTTTGAGACCAAGTGCAGAGACCCAAACCCCGTGGATTCCGGCTGTCGCGGCATCGATTCCAAGCATTGGAATAGC TATTGTACCACAACCCACACATTCGTGAAGGCTCTGACCATGGACGGCAAGCAGGCTGCCTGGAGGTTCATCCGCAT CGATACCGCCTGCGTGTGCGTGCTGTCTAGGAAGGCTGTGAGGTGAGTATAC。

The sequence has been synthesized by chemically synthesized mode, that is, has obtained NGF (118) precursor molecule coding DNA.

(2) acquisition of the structure and engineering cell strain of NGF (118) recombinant expression carrier

The expression vector of the present embodiment is with Life Technologies companies1.0 carriers of pCHO are Beginning carrier construction.

Since the carrier contains 2 exogenous gene expression units (SU1 and SU2), disappeared first with restriction enzyme Sfi I ChangePCHO 1.0 is simultaneously reconnected to remove expression unit SU2, is obtained the carrier containing only expression unit SU1, is remembered For pCHO-SU1.External source gene promoter is the heterozygous sequence derived from EF1 and CMV promoter in pCHO-SU1 carriers, than common CMV promoter transcriptional activity is higher by 5~10 times；In addition, also containing two screening marks of puromycin resistance gene and DHFR genes Note, corresponding screening drug is respectively puromycin (Puromycin) and methotrexate (MTX), thus can be resisted by puromycin Property drug screening, in conjunction with DHFR-MTX screening systems obtain stability and high efficiency expression cell strain.

It is bis- with Avr II and Bstz17I by artificial synthesized NGF (118) precursor molecule coding DNA (SEQ ID NO.2) It is connected on the equally pCHO-SU1 expression vectors through double digestion through T4DNA ligases after digestion, structure NGF (118) recombinates table Up to carrier, escherichia coli cloning bacterial strain TOP10 is converted, 37 DEG C of culture sieves on the LB culture mediums containing 50 μ g/ml kanamycins Recon is selected, after digestion identification is correct, it is consistent that further sequencing is compared with implementation sequence, it was demonstrated that NGF (118) is recombinantly expressed Vector construction success, is denoted as pCHO-SU1-NGF (118).

The host cell of the present embodiment selects Life Technologies companiesCell, This is cell-derived from CHO-K1 cells, grows and passage carries out in serum free medium.

With Nru I digestion pCHO-SU1-NGF (118) vector plasmid, after being linearized, with reference to Freestyle^TMMAX is tried Agent box specification, using liposome (Freestyle^TMMAX) method transfectsCell；With reference toKit operation manual (is write a Chinese character in simplified form by 10 μ g/ml puromycins of the first round and 100nM MTX For 10P/100M) pressurization screening, the second 50 μ g/ml puromycins of wheel and 1000nM MTX (being abbreviated as 50P/1000M) pressurization sieves Choosing altogether after two-wheeled drug pressurization screening, obtains mixing clone group；It is finally screened to obtain stability and high efficiency expression with limiting dilution assay again The monoclonal cell strain of NGF (118), as NGF (118) engineering cell strain.

(3) culture of NGF (118) engineering cell strain and the purifying of NGF (118)

By the NGF frozen (118) engineering cell strain recover cultivate, and expand culture to 600~800ml, be seeded to containing About 2L basal mediums (glutamine containing 8mM and 1:The CD FortiCHO of 100 diluted Anti-ClumpingAgent^TMCulture Base) 5L double-sided arm shaking flasks, in 37 DEG C, 8%CO₂, cultivate in 106rpm condition carbon dioxide shaking tables；It was pressed respectively at the 4th day The concentration of 4g/L adds glucose, adds glucose by the concentration of 6g/L within the 6th day, and continuous culture terminated culture to the 9th day.

NGF (118) engineering cell strain culture supernatant is collected by centrifugation, it is rich using Ni-Sepharose Fast Flow chromatographic columns Collect proNGF, then through EMD SO₃ ^-(M) cation exchange chromatography obtains proNGF sterling solution；By proNGF sterling solution pair 4 DEG C of dialysed overnights of 0.15M NaCl-20mM Tris buffer solutions (pH7.8), change liquid 1~2 time halfway；ProNGF after dialysis 13.5% glycerine -0.15M NaCl-20mM Tris buffer solutions (pH7.8) of 1/9 volume are added in sterling solution, and are added solidifying Hemase, in 25~37 DEG C of digestions 18~24 hours；Again through EMD SO₃ ^-(M) ion-exchange chromatography isolates and purifies to obtain G-NGF (118)。

(4) G-NGF (118) preparation process evaluation and its Quality Identification

By above-mentioned (3) item NGF (118) cultures and its purification process, repeats three batches of cultures and purification experiment, will receive The proNGF sterlings and G-NGF (118) obtained presses Lowry methods and detects albumen concentration respectively, calculates process recovery ratio；And reverse phase is used respectively High performance liquid chromatography (RP-HPLC, chromatographic column：ZORBAX 300SB-C8, grain size 5um, 4.6 × 250mm, Agilent company Product, article No.：880995-906) and anion-exchange (IEX-HPLC, chromatographic column：TSKgel SP-5PW, Grain size 10um, aperture 100nm, 7.5 × 750mm, TOSOH Products, article No.：0007161) G-NGF (118) purity is detected； Using the mouse nerve growth factor Bioassay reference of Chinese pharmaceutical biological product calibrating research institute distribution as reference, use《Middle traditional Chinese medicines Allusion quotation》Three general rules 3530 of version in 2015 " TF-1 cells/MTS colorimetric methods " detect G-NGF (118) specific activity.

The results are shown in table below for three batches of batch experiments and purification experiment, shows by the method for the invention, and NGF (118) is realized Efficient secretory expression, every liter of culture solution can express Primary product (proNGF) 100mg or more, can prepare G-NGF (118) 30mg (average value)；G-NGF (118) average recovery rates are up to 51%；G-NGF (118) specific activity is not less than 850,000 U/mg.

Comparative example 1：The structure of native-NGF (118) recombinant expression carrier

In this comparative example, using prior art expression of NGF (118), it is denoted by native-NGF (118).Involved Precursor molecule is preproNGF, the structure with NGF SP-NGF Pro-NGF (118).Wherein NGF Pro are natural NGF Leader peptide sequences will wherein potential Furin cleavage sequences (preproNGF in order to which the comparison with embodiment 1 is more rigorous The 49th to 52 of molecule, RRAR/H and the 80th to 83, RRLR/H) RRAA and RRLA are sported respectively.

In this comparative example, the specific amino acid sequence of native-NGF (118) precursor molecule is dashed forward as shown in SEQ ID NO.3 Sequence and Furin cleavage sequences after change line out below, and NGF Pro sequences are shown with italic overstriking.

SEQ ID NO.3：

It is counter to be translated into DNA sequence dna by above-mentioned native-NGF (118) precursor molecule amino acid sequence, with 1 method of embodiment into Row DNA sequence dna optimizes, and design obtains the DNA sequence dna for being suitable for encoding native-NGF (118) precursor molecule.Specific such as SEQ ID Shown in NO.4, wherein Avr II restriction enzyme sites (CCTAGG) and KOZAK sequences (GCCACC) are contained in 5 ' ends, 3 ' ends are contained Bstz17I restriction enzyme sites (GTATAC) and terminator codon (TGA), are shown with underscore.

SEQ ID NO.4：

CCTAGGGCCACCATGTCTATGCTGTTCTACACACTGATCACCGCTTTTCTGATCGGCATCCAGGCCGAG CCTCATTCCGAGAGCAACGTGCCTGCTGGCCACACAATCCCACAGGCCCATTGGACCAAGCTGCAGCACTCTCTGGA CACAGCTCTGAGGAGGGCTGCTTCCGCCCCAGCTGCTGCCATCGCTGCCCGCGTGGCTGGCCAGACAAGGAATATCA CCGTGGACCCCAGACTGTTCAAGAAGAGACGCCTGGCCTCCCCTCGGGTGCTGTTTAGCACACAGCCCCCTAGAGAG GCTGCCGATACCCAGGACCTGGATTTCGAAGTGGGAGGAGCTGCTCCCTTCAACAGGACCCACCGGAGCAAGAGATC CAGCTCTCACCCCATCTTCCATAGGGGCGAGTTCTCCGTGTGCGACTCCGTGTCCGTGTGGGTGGGCGACAAGACCA CAGCTACAGATATCAAGGGCAAGGAAGTGATGGTGCTGGGCGAAGTGAATATCAACAATTCCGTGTTCAAGCAGTAC TTCTTTGAGACCAAGTGCCGCGACCCAAACCCCGTGGATAGCGGCTGTAGGGGCATCGATAGCAAGCATTGGAATTC TTATTGTACCACAACCCACACATTCGTGAAGGCCCTGACCATGGACGGCAAGCAGGCTGCCTGGCGCTTTATCAGGA TCGATACCGCTTGCGTGTGCGTGCTGTCCCGGAAGGCTGTGAGGTGAGTATAC

The sequence is synthesized by chemically synthesized mode, obtains native-NGF (118) precursor molecule coding DNA.With real 1 method of example is applied, by artificial synthesized native-NGF (118) the precursor molecule coding DNA (SEQ ID NO.4), is inserted into pCHO- In SU1 expression vectors, native-NGF (118) recombinant expression carrier is built；It screens to obtain recon through Kanr, It is correct through digestion identification, sequence verification sequence again, show that native-NGF (118) recombinant expression carrier is built successfully, is denoted as pCHO-SU1-native-NGF(118)。

Embodiment 2：The transient expression of pCHO-SU1-NGF (118) and pCHO-SU1-native-NGF (118)

In the present embodiment, prepared by pCHO-SU1-NGF (118) carriers and comparative example 1 that prepare embodiment 1 PCHO-SU1-native-NGF (118) carrier, transfects respectivelyNGF transient expressions, comparative analysis are carried out after cell The effect of the two expression of NGF.Vector plasmid pCHO-SU1-NGF (118) and pCHO-SU1-native-NGF (118) is with limitation Property endonuclease digestion linearisation before, be supercoiled form.The transient expression amount of usual super spirial plasmid can be higher than linear matter Grain.In the present embodiment, the plasmids of two kinds of forms of above two expression vector has carried out transient expression, vector plasmid it is linear For change method with embodiment 1, transient expression experiment process is as follows：

1) it transfects first 24 hours, using the CD FortiCHO of the glutamine containing 8mM^TMCulture medium presses 5 × 10⁵cells/mL Density secondary cultureCell；

2) the transfection same day countsCell will press 1 × 10 for the cell of transfection⁶cells/mL×30mL/ Bottle access 125ml triangle shake bottles；

3) plasmid (pCHO-SU1-NGF (118) or pCHO-SU1-native-NGF (118), the linear forms of 50 μ g are added With each portion of supercoiled form) to final volume be 1.5mL OptiPRO SFM culture medium in, be uniformly mixed, it is molten to obtain plasmid Liquid；

4) it is added the OptiPRO SFM's of the transfection reagent FreeStyle MAX Reagent to final volume 1.5mL of 50 μ l In culture medium, it is uniformly mixed；

5) the FreeStyle MAX Reagent after step 4) mixing are added to the plasmid solution of step 3) preparation immediately In, mixing is overturned, 10min is placed at room temperature for；

6) plasmid prepared by step 5) is slowly added dropwise with FreeStyle MAX Reagent mixed liquors into the thin of step 2) In born of the same parents, in 37 DEG C, 8%CO₂Shaken cultivation in condition carbon dioxide shaking table, shaking speed 106rpm；

7) 48h or 96h is cultivated, after each bottle culture is centrifuged 10min by 1000rpm, supernatant is taken, with mouse anti-rabbit 2.5S NGF antibody (primary antibody, Sigma Products, article No.：N6655)) and peroxidase label goat anti-rabbit igg (secondary antibody, Sigma Products, article No.：A0545 WesternBlot detections) are carried out, and (Sigma is public using humanβ-NGF's ELISA detection kit Take charge of product, Cat.No.RAB0380) detect NGF expression quantity in supernatant.

Culture supernatant ELISA testing results are as shown in following table and Fig. 2, no matter using linear plasmid or super spirial plasmid wink When transfectional cell expressed, pCHO-SU1-NGF (118) carrier expression quantity is pCHO-SU1-native-NGF (118) table Up to measuring 10 times or more, show to be higher than 1 order of magnitude of art methods using the method for the present invention NGF expression quantity.

The culture supernatant Western Blot testing results of super spirial plasmid transfection are as shown in figure 3, pCHO-SU1-NGF (118) carrier expression product is a uniform electrophoretic band, and pCHO-SU1-native-NGF (118) expression product is shown For a plurality of electrophoretic band, product and NGF (118) that proNGF, proNGF are not exclusively processed are corresponded to respectively.Show present invention side The expression product that method obtains is single, is more advantageous to downstream purification operation, destination protein purifies yield will higher.

Embodiment 3：NGF SP combine guiding native-NGF (118) efficient secretory expression with GNT

In the present embodiment, we provide the combination that data prove NGF SP sequences and GNT sequences, can efficiently guide Native-NGF (118) secretes outside host cell, achievees the purpose that improve secreting, expressing amount.

(1) native-NGF (118) (the GNT induced secretion of native-NGF of GNT guiding secretion (118), (118) referred to as Gis-NGF) recombinant expression carrier structure

In the present embodiment, the precursor molecule of native-NGF (118) be 1 precursor molecule of comparative example NGF SP sequences with GNT-Linker sequences are inserted between NGF pro sequences, it is preferred that there is NGF SP-GNT10-SGGGGSGGGGSGGGG-NGF Pro-NGF (118) structure, wherein NGF Pro sequence signatures are characterized in comparative example 1, have eliminated C-terminal region Outer potential 2 Furin restriction enzyme sites.NGF SP sequences and GNT10 sequences characterize above, in the present embodiment, NGF SP sequences select people's NGF signal peptide sequences, MSMLFYTLITAFLIGIQA；GNT10 sequences select HGEGTFTSDV.

In the present embodiment, the specific amino acid sequence of precursor molecule of native-NGF (118) as shown in SEQ ID NO.5, Sequence and Furin cleavage sequences after GNT10, mutation line out below, and NGF Pro sequences are shown with italic overstriking Go out.

SEQ ID NO.5：

It is counter to be translated into DNA sequence dna by above-mentioned native-NGF (118) precursor molecule amino acid sequence, with 1 method of embodiment into Row DNA sequence dna optimizes, and design obtains the DNA sequence dna for being suitable for encoding native-NGF (118) precursor molecule.Specific such as SEQ ID Shown in NO.6, wherein Avr II restriction enzyme sites (CCTAGG) and KOZAK sequences (GCCACC) are contained in 5 ' ends, 3 ' ends are contained Bstz17I restriction enzyme sites (GTATAC) and terminator codon (TGA), are shown with underscore.

SEQ ID NO.6：

CCTAGGGCCACCATGAGCATGCTGTTCTACACACTGATCACCGCTTTTCTGATCGGCATCCAGGCCCAT GGCGAGGGCACATTCACCAGCGACGTGTCTGGAGGAGGAGGATCAGGAGGAGGAGGATCTGGAGGAGGAGGAGAGCC TCACTCCGAGAGCAACGTGCCTGCTGGCCACACAATCCCACAGGCCCATTGGACCAAGCTGCAGCACAGCCTGGATA CAGCTCTGAGGAGGGCTGCTTCTGCCCCAGCTGCTGCCATCGCTGCCCGCGTGGCTGGCCAGACAAGGAATATCACC GTGGACCCCAGACTGTTCAAGAAGAGACGCCTGGCCTCTCCTCGGGTGCTGTTTTCCACACAGCCCCCTAGAGAGGC TGCCGATACCCAGGACCTGGATTTCGAAGTGGGAGGAGCTGCTCCCTTCAACAGGACACATCGGTCCAAGAGATCCA GCTCTCACCCCATCTTCCATAGGGGCGAGTTTAGCGTGTGCGACTCCGTGTCCGTGTGGGTGGGCGACAAGACCACA GCTACAGATATCAAGGGCAAGGAAGTGATGGTGCTGGGCGAAGTGAATATCAACAATTCCGTGTTCAAGCAGTACTT CTTTGAGACCAAGTGCCGCGACCCAAACCCCGTGGATTCCGGCTGTAGGGGCATCGATTCCAAGCATTGGAATAGCT ATTGTACCACAACCCACACATTCGTGAAGGCCCTGACCATGGACGGCAAGCAGGCTGCCTGGCGCTTTATCAGGATC GATACCGCTTGCGTGTGCGTGCTGTCTCGGAAGGCCGTGAGATGAGTATAC

The sequence is synthesized by chemically synthesized mode, obtains native-NGF (118) precursor molecule coding DNA.With real 1 method of example is applied, by artificial synthesized native-NGF (118) the precursor molecule coding DNA (SEQ ID NO.6), is inserted into pCHO- In SU1 expression vectors, NGF (118) recombinant expression carrier is built；It screens to obtain recon through Kanr, then through enzyme It is correct to cut identification, sequence verification sequence, shows that native-NGF (118) recombinant expression carrier is built successfully, is denoted as pCHO-SU1- Gis-NGF(118)。

(2) the steady of pCHO-SU1-Gis-NGF (118) and pCHO-SU1-native-NGF (118) turns expression by pCHO- PCHO-SU1-native-NGF (118) prepared by SU1-Gis-NGF (118) carriers and comparative example 1, first uses I digestions of Nru respectively It is linearized；According still further to the transfection method of embodiment 2, transfect respectivelyCell；Then according to the side of embodiment 1 Method carries out the pressurization screening of 10P/100M and 50P/1000M two-wheeled drugs respectively, obtains mixing clone's group's cell of stable transfection, Specific pressurization screening process is as follows：

1) after transfecting 48h, sampling counts, and prepares (the basal medium CD FortiCHO of screening and culturing medium -1^TMCulture medium, 8mM glutamine, 1:100 diluted Anti-ClumpingAgent, 10 μ g/ml Puromycin and 100nM MTX)；Centrifugation Cell is collected, cell is resuspended with screening and culturing medium -1, cell is pressed 5 × 10⁵The density of cells/mL × 40mL is transferred to T150 In culture bottle；

2) stationary culture takes cell count after 7-14 days, calculates cell survival rate, will as cell survival rate ＞ 30% Cell presses 3 × 10⁵In the ratio access 125ml triangle shake bottles of cells/mL × 30mL, shaking flask is placed in carbon dioxide shaking table Culture；

3) screening and culturing medium -1 is used to pass within every 3 days a generation, passage density is 3 × 10⁵Cells/mL × 30mL, when cell is deposited Motility rate ＞ 95%, first stage screening are completed, and cell mass is named as 10P/100M mixing clone groups at this time；

4) 10P/100M is mixed into clone group and cultivates counting, centrifugal treating, with (the basal medium CD of screening and culturing medium -2 FortiCHO^TMCulture medium, 8mM glutamine, 1:100 diluted Anti-Clumping Agent, 50 μ g/ml Puromycin With 1000nM MTX) cell is resuspended, by 4 × 10⁵Cells/mL × 30mL is accessed in shaking flask, starts the screening of second stage；

5) in second stage screening process, per counting is sampled to cell within 3-4 days, using screening and culturing medium -2, by 3 ×10⁵Cells/mL × 30mL is passed on, and as cell survival rate ＞ 95%, second stage screening is completed, and cell mass is named as at this time 50P/1000M mixing clone groups.

The 10P/100M and 50P/1000M of pCHO-SU1-Gis-NGF (118) stable transfection are mixed into clone's group's cell, PCHO-SU1-native-NGF (118) stable transfection 10P/100M and 50P/1000M mixing clone group's cell, respectively press 3 × 10⁵In the ratio access 500mL triangle shake bottles of cells/mL × 130mL, sampling on day 4 counts, and 4g/L is pressed into culture Glucose is added to continue to cultivate；At the 7th day, sampling counted and stays supernatant, adds glucose by 6g/L into culture and continues to train It supports, was sampled at the 9th day and stay supernatant.The 10P/100M of above two carrier stable transfection is mixed the 7th day of clone group and The 9th day culture supernatant of 50P/1000M mixing clone groups is examined with 2 method of embodiment with humanβ-NGF's ELISA detection kit Survey NGF expression quantity.

Culture supernatant ELISA testing results are as shown in following table and Fig. 4, no matter 10P/100M mixing clone groups cultivate for 7 days Object or 50P/1000M mixing clone's 9 days cultures of group, the table of pCHO-SU1-Gis-NGF (118) carrier stable transfected cells It is above pCHO-SU1-native-NGF (118) carrier, the NGF tables of especially 50P/1000M mixing clone's group's cultures in 9 days up to amount Up to amount, the former is 4.6 times of the latter.The combination for further proving NGF SP sequences and GNT sequences, can efficiently guide native- NGF (118) secretes outside host cell, significantly improves its secreting, expressing amount.

Embodiment 4：The expression of FGF21

FGF21 can be by increasing glucose transporters 1 (GLUT1) in mouse 3T3-L1 cells and people's PECTORAL LIMB SKELETON It expresses to increase noninsulin dependent glucose uptake, thus the value with potential treatment diabetes.FGF21 is in vivo and in vitro The help that leader peptide is not needed when expression is processed, is folded, it is only necessary to which signal peptide achieves that inside and outside cell expression (its precursor point Son is only made of signal peptide (28 amino acid) and ripe peptide sequence (181 amino acid), is denoted as preFGF21), production is ripe Albumen.This example demonstrates that not needing leader peptide for precursor molecule shortage leader peptide sequences or the expression of inside and outside cell The albumen processed, folded, equally available the method for the present invention is helped to realize stable, high efficient expression.

(1) acquisition of FGF21 precursor molecules coding DNA

In the present embodiment, FGF21 precursor molecules have the following structure：

NGF SP-GNT12-GGGGGGSGGGG-HHHHHH-GGGGSAAGG-FGF21Pro_mdf-FGF21.Wherein carry Histidine tag (HHHHHH), thus available immobilization metal chelate chromatography (IMAC) isolates and purifies secretory protein； The front and back label is Linker sequences, respectively GGGGGGSGGGG and GGGGSAAGG.

In the present embodiment, after involved FGF21 precursor molecules synthesize in the cell, in NGF SP sequences and GNT12 Under the guiding of combined sequence, signal peptide NGF SP sequences are cut off by signal peptidase (SPase) digestion in endoplasmic reticulum, and with former egg White form efficiently is secreted extracellular；In the present embodiment, FGF21 original albumen has GNT12-GGGGGGSGGGG-HHHHHH- GGGGSAAGG-FGF21Pro_mdf-FGF21 structures, then through site-specific protease digestion remove FGF21Pro_mdf and its Upstream sequence generates FGF21 mature peptides.

In the present embodiment, FGF21Pro_mdf be one section of FactorXa cutting sequences IEGR ↓, thus Factor may be used Xa digestions obtain FGF21 mature peptides；NGF SP are NGF signal peptide sequences, and mouse NGF signal peptide sequences are selected in the present embodiment, MSMLFYTLITAFLIGVQA；GNT12 is 12 amino acid sequences before GLP-1 analog N-terminals, and sequence is selected in the present embodiment For HGEGTFTSDLSK.In the present embodiment, the specific amino acid sequence of FGF21 precursor molecules is as shown in SEQ ID NO.7, GNT12 It is lined out below sequence, FGF21Pro_mdf sequences are shown with italic overstriking.

SEQ ID NO.7：

It is counter to be translated into DNA sequence dna by above-mentioned FGF21 precursor molecules amino acid sequence, referring concurrently to Chinese hamster ovary celI preference codon Table, and the factors such as the sub- degeneracy of combining cipher, G/C content, the mRNA structures of transcription and its stability, using OptimumGene^TM Software carries out DNA sequence dna optimization, and design obtains the DNA sequence dna for being suitable for encoding FGF21 precursor molecules.Specific such as SEQ ID Shown in NO.8, wherein Avr II restriction enzyme sites (CCTAGG) and KOZAK sequences (GCCACC) are contained in 5 ' ends, 3 ' ends are contained Bstz17I restriction enzyme sites (GTATAC) and terminator codon (TGA), are shown with underscore.

SEQ ID NO.8：

CCTAGGGCCACCATGTCTATGCTGTTCTACACCCTGATCACAGCCTTTCTGATCGGCGTTCAGGCTCAC GGCGAGGGCACCTTCACATCCGACCTGTCCAAAGGAGGAGGAGGAGGAGGATCCGGAGGAGGCGGCCACCATCACCA TCACCATGGAGGAGGAGGATCTGCTGCTGGAGGAATCGAGGGACGCCACCCACTGCCTGATTCTTCCCCTCTGCTGC AGTTCGGCGGCCAGGTGAGGCAGAGGTACCTGTACACCGACGATGCCCAGCAGACAGAGGCTCATCTGGAGATCAGG GAGGACGGAACCGTGGGAGGAGCTGCTGATCAGAGCCCCGAGTCTCTGCTGCAGCTGAAGGCCCTGAAGCCTGGCGT GATCCAGATCCTGGGCGTGAAGACAAGCAGGTTTCTGTGCCAGAGGCCAGACGGCGCCCTGTACGGCAGCCTGCACT TCGATCCCGAGGCTTGTTCTTTTAGAGAGCTGCTGCTGGAGGACGGCTACAACGTGTATCAGTCCGAGGCTCACGGA CTGCCACTGCATCTGCCTGGCAATAAGAGCCCTCATAGGGATCCAGCTCCCAGAGGACCAGCTCGCTTCCTGCCTCT GCCAGGACTGCCTCCAGCCCTGCCAGAGCCACCTGGCATCCTGGCTCCACAGCCACCAGACGTGGGAAGCTCTGATC CACTGTCTATGGTGGGACCATCCCAGGGCAGGTCCCCTAGCTATGCTTCTTGAGTATAC

The sequence is synthesized by chemically synthesized mode, obtains FGF21 precursor molecule coding DNAs.

By artificial synthesized FGF21 precursor molecules coding DNA (SEQ ID NO.8), with Avr II and Bstz17I double digestions It is connected on the equally pCHO-SU1 expression vectors through double digestion by T4DNA ligases, builds FGF21 recombinant expression carriers, Escherichia coli cloning bacterial strain TOP10 is converted, 37 DEG C of culture screening recombinations on the LB culture mediums containing 50 μ g/ml kanamycins Son, after digestion identification is correct, it is consistent that further sequencing is compared with implementation sequence, it was demonstrated that FGF21 recombinant expression carriers are built Success, is denoted as pCHO-SU1-FGF21.

With 1 method of embodiment, pCHO-SU1-FGF21 carriers are transfectedCell, through 10P/100M and 50P/ After the pressurization screening of 1000M two-wheeled drugs, mixing clone group is obtained.By mixing clone group cell, (50P/1000M pressurization screenings obtain Group is cloned in the mixing obtained) press 3 × 10⁵The ratio of cells/mL × 130mL accesses 500mL triangle shake bottles, in the 4th day by 4g/L to Glucose is added in culture, adds glucose by 6g/L within the 6th day；Continue culture to the 9th day, takes supernatant, use FGF21ELISA (Wuhan cloud clones Science and Technology Co., Ltd.'s product, article No. to detection kit：SEC918Hu FGF21 in culture supernatant) is detected to contain Amount.As a result show in mixing clone's group's cells and supernatant that 50P/1000M pressurization screenings obtain FGF21 contents up to 250~ 300mg/L shows that FGF21 obtains high efficient expression by the method for the invention.

Embodiment 5：The expression and preparation of NGF (117)

In the present embodiment, provide statistics indicate that β-NGF another kind functional variant thereof NGF (117) also can be square through the invention Method realizes efficient secretory expression.NGF (117) is that the C-terminal of the i.e. NGF of natural β-NGF mature peptides (120) lacks 3 amino acid (RRA/G), C-terminal 3 amino acid of missing that the patent document that notification number is CN102898514B discloses NGF (120) are advantageous In the promotion of expression.

(1) structure of NGF (117) engineering cell strain

In the present embodiment, NGF (117) is further to lack C-terminal 1 on the basis of NGF described in embodiment 1 (118) Amino acid (R)；In the present embodiment, by lacking last amino acids of NGF (118) precursor molecule C-terminal described in embodiment 1 (R) NGF (117) precursor molecule is obtained, concrete structure is as follows：NGF SP-GNT10-SGGGGG-HHHHHH-GGGGG-NGF Pro_mdf-NGF (117), as shown in SEQ ID NO.9, GNT10 and the sequence after mutation are following to draw specific amino acid sequence Line marks, and NGF Pro_mdf sequences are shown with italic overstriking.

SEQ ID NO.9：

In the present embodiment, by deleting NGF (118) precursor molecule DNA sequences encoding (SEQ ID described in embodiment 1 NO.2) the last one triplet sequences (AGG encodes arginine) of 3 ' end code areas, obtain NGF (117) precursor molecule (SEQ ID NO.9 DNA sequences encoding), specifically as shown in SEQ ID NO.10, wherein Avr II restriction enzyme sites (CCTAGG) are contained at 5 ' ends With KOZAK sequences (GCCACC), Bstz17I restriction enzyme sites (GTATAC) and terminator codon (TGA) are contained in 3 ' ends, following to draw Line is shown.

SEQ ID NO.10：

CCTAGGGCCACCATGAGCATGCTGTTCTACACACTGATCACCGCTTTTCTGATCGGCATCCAGGCCCAT GGCGAGGGCACATTCACCAGCGACGTGTCTGGAGGAGGAGGAGGACACCATCACCATCACCATGGCGGAGGAGGAGG AGAGCCTCACTCCGAGAGCAACGTGCCTGCTGGCCACACAATCCCACAGGCCCATTGGACCAAGCTGCAGCACAGCC TGGATACAGCTCTGAGGAGGGCTGCTTCTGCCCCAGCTGCTGCTATCGCTGCTAGGGTGGCTGGCCAGACACGGAAT ATCACCGTGGACCCCAGGCTGTTCAAGAAGAGACGCCTGGCCTCTCCCAGGGTGCTGTTCTCCACACAGCCACCTCG GGAGGCTGCTGATACCCAGGACCTGGATTTCGAAGTGGGAGGAGCTGCTCCCTTCAACAGAACCCATGGATCCGGAA GGGGATCCAGCTCTCACCCAATCTTCCATAGAGGCGAGTTTAGCGTGTGCGACTCCGTGTCCGTGTGGGTGGGCGAC AAGACCACAGCTACAGATATCAAGGGCAAGGAAGTGATGGTGCTGGGCGAAGTGAATATCAACAATTCCGTGTTCAA GCAGTACTTCTTTGAGACCAAGTGCAGAGACCCAAACCCCGTGGATTCCGGCTGTCGCGGCATCGATTCCAAGCATT GGAATAGCTATTGTACCACAACCCACACATTCGTGAAGGCTCTGACCATGGACGGCAAGCAGGCTGCCTGGAGGTTC ATCCGCATCGATACCGCCTGCGTGTGCGTGCTGTCTAGGAAGGCTGTGTGAGTATAC

The sequence is synthesized by chemically synthesized mode, obtains NGF (117) precursor molecule coding DNA；According to embodiment 1 Method, by NGF (117) the precursor molecule coding DNA (SEQ ID NO.10) be inserted into pCHO-SU1 expression vectors, structure PCHO-SU1-NGF (117) recombinant expression carrier, and transfectCell, through 10P/100M and 50P/1000M two-wheeled medicines After object pressurization screening, mixing clone group is obtained；It is finally screened to obtain stability and high efficiency expression of NGF (117) with limiting dilution assay again Monoclonal cell strain, as NGF (117) engineering cell strain.

(2) G-NGF (117) preparation process evaluation and its Quality Identification

According to the method for embodiment 1, NGF (117) engineering cell is cultivated；Culture supernatant is collected, according to the side of embodiment 1 Method, purifying obtain proNGF；Leader peptide and its upstream sequence are removed (because fibrin ferment is in its cutting sequence GSGR through fibrin ferment digestion The c-terminuses of the 4th amino acids (arginine, R) of ↓ G is cut, and mature peptide NGF (117) N-terminal of generation adds that there are one sweet ammonia Sour (G), is denoted by G-NGF (117)), then it is purified, G-NGF (117) is made.

By above-mentioned NGF (117) cultures and its purification process, repeat three batches of cultures and purification experiment, by what is received ProNGF sterlings and G-NGF (117) press Lowry methods and detect albumen concentration respectively, calculate process recovery ratio；According to the side of embodiment 1 Method uses RP-HPLC methods and IEX-HPLC methods to detect G-NGF (117) purity, TF-1 cells/MTS colorimetric determinations G-NGF respectively (117) specific activity；And Research Centre for Proteome Analysis(Shanghai) is entrusted to carry out N-terminal amino acid sequencing, and use matter Spectrometry detection molecules amount.

The results are shown in table below for three batches of batch experiments (every batch of volume of culture about 2L or so) and purification experiment, shows to pass through this Inventive method, NGF (117) realize efficient secretory expression, every liter of culture solution can express Primary product (proNGF) 240mg with On, G-NGF (117) 45mg (average value) can be prepared；G-NGF (117) average recovery rate 36.9%；G-NGF (117) specific activity is big In 990,000 U/mg.

The sequencing result of G-NGF (117) 15 amino acid of N-terminal is：GSSSHPIFHRGEFSV, it is consistent with implementation sequence； It is 13162.0Da (Fig. 5) that mass spectrography, which measures G-NGF (117) molecular weight, is consistent with its theoretical molecular weight 13161.86Da.

Embodiment 6：The expression of Leptin

Leptin (Leptin) has appetite-suppressing, promotes energy expenditure and adjusts human body energy metabolism, maintains normal blood Lipid metaboli adjusts growth and development, adjusts inflammatory reaction, promotes cell growth, the biological effects such as protection digestive system function. It will appear leptin in the patients such as lipodystrophy syndrome, hypothalamic amenorrhea, congenital and secondary leptin deficiency disease to lack Weary symptom；These patients are also accompanied by insulin resistance, hyperglycemia, dyslipidemia, endocrine disturbance, fatty liver etc. and face simultaneously Bed syndrome.Thus, leptin can be used for the alternative medicine of these patients, for improving patient's metabolic balance, reducing or disappearing Except clinical complication shape, life in patients is improved.The help that leader peptide is not needed when Leptin is expressed in vivo and in vitro is processed, is rolled over It is folded, it is only necessary to which that signal peptide achieves that inside and outside cell expression, and (its precursor molecule is only by signal peptide (21 amino acid) and maturation Peptide sequence (146 amino acid) forms, and is denoted as preLeptin), produce maturation protein.The present embodiment further demonstrates that, for preceding Body molecule lacks leader peptide sequences or cell expression in inside and outside does not need the albumen that the help of leader peptide is processed, folded, equally Stable, high efficient expression can be realized with the method for the present invention.

(1) acquisition of Leptin precursor molecules coding DNA

In the present embodiment, Leptin precursor molecules have the following structure：

NGF SP-GNT11-GGGGG-HHHHHH-GGGGGSGGGGSGGGGSA-Leptin Pro_mdf-Leptin.Its In carry histidine tag (HHHHHH), thus available immobilization metal chelate chromatography (IMAC) secretory protein detach it is pure Change；It is Linker sequences, respectively GGGGG and GGGGGSGGGGSGGGGSA before and after the label.

In the present embodiment, after involved Leptin precursor molecules synthesize in the cell, in NGF SP sequences and GNT11 Under the guiding of combined sequence, signal peptide NGF SP sequences are cut off by signal peptidase (SPase) digestion in endoplasmic reticulum, and with former egg White form efficiently is secreted extracellular；In the present embodiment, Leptin original albumen has GNT11-GGGGG-HHHHHH- GGGGGSGGGGSGGGGSA-Leptin Pro_mdf-Leptin structures, then removed through site-specific protease digestion LeptinPro_mdf and its upstream sequence generate Leptin mature peptides.

In the present embodiment, Leptin Pro_mdf be one section of enterokinase (Enterokinase) cutting sequence DDDDK ↓, because And enterokinase digestion may be used and obtain Leptin mature peptides；NGF SP are NGF signal peptide sequences, and people is selected in the present embodiment NGF signal peptide sequences, MSMLFYTLITAFLIGIQA；GNT11 is 11 amino acid sequences before GLP-1 analog N-terminals, this reality It is HGEGTFTSDVS to apply and select sequence in example.In the present embodiment, the specific amino acid sequence of Leptin precursor molecules such as SEQ ID It shown in NO.11, is lined out below GNT11 sequences, Leptin Pro_mdf sequences are shown with italic overstriking.

SEQ ID NO.11：

It is counter to be translated into DNA sequence dna by above-mentioned Leptin precursor molecules amino acid sequence, have a preference for password referring concurrently to Chinese hamster ovary celI Sublist, and the factors such as the sub- degeneracy of combining cipher, G/C content, the mRNA structures of transcription and its stability use OptimumGene^TMSoftware carries out DNA sequence dna optimization, and design obtains the DNA sequence dna for being suitable for encoding Leptin precursor molecules.Tool Body as shown in SEQ ID NO.12, wherein 5 ' end contain Avr II restriction enzyme sites (CCTAGG) and KOZAK sequences (GCCACC), 3 ' Bstz17I restriction enzyme sites (GTATAC) and terminator codon (TGA) are contained in end, are shown with underscore.

SEQ ID NO.12：

CCTAGGGCCACCATGTCCATGCTGTTCTACACCCTGATCACAGCCTTTCTGATCGGCATCCAGGCTCAC GGCGAGGGCACCTTCACAAGCGACGTGTCTGGCGGAGGAGGAGGACACCATCACCATCACCATGGAGGAGGAGGAGG ATCCGGAGGAGGAGGAAGCGGCGGCGGCGGCTCTGCTGACGATGACGATAAGGTGCCTATCCAGAAGGTGCAGGACG ATACCAAGACACTGATCAAGACCATCGTGACAAGAATCAACGATATCAGCCACACCCAGTCCGTGTCCAGCAAGCAG AAGGTGACAGGCCTGGACTTCATCCCCGGCCTGCATCCTATCCTGACCCTGAGCAAGATGGATCAGACACTGGCCGT GTACCAGCAGATCCTGACCTCCATGCCAAGCAGGAATGTGATCCAGATCTCTAACGACCTGGAGAATCTGCGGGATC TGCTGCACGTGCTGGCCTTTTCTAAGTCCTGCCATCTGCCCTGGGCTTCTGGACTGGAGACCCTGGACTCCCTGGGC GGCGTGCTGGAGGCCTCTGGCTATTCCACAGAGGTGGTGGCTCTGTCCCGCCTGCAGGGAAGCCTGCAGGACATGCT GTGGCAGCTGGATCTGTCCCCAGGCTGTTGAGTATAC

The sequence is synthesized by chemically synthesized mode, obtains Leptin precursor molecule coding DNAs.

By artificial synthesized Leptin precursor molecules coding DNA (SEQ ID NO.12), with the bis- enzymes of Avr II and Bstz17I It is connected on the equally pCHO-SU1 expression vectors through double digestion through T4DNA ligases after cutting, structure Leptin recombinant expressions carry Body converts escherichia coli cloning bacterial strain TOP10,37 DEG C of culture screening weights on the LB culture mediums containing 50 μ g/ml kanamycins Group, after digestion identification is correct, it is consistent that further sequencing is compared with implementation sequence, it was demonstrated that Leptin recombinant expression carrier structures Work(is built up, pCHO-SU1-Leptin is denoted as.

With 1 method of embodiment, pCHO-SU1-Leptin carriers are transfectedCell, through 10P/100M and 50P/ After the pressurization screening of 1000M two-wheeled drugs, mixing clone group is obtained.By mixing clone group cell, (50P/1000M pressurization screenings obtain Group is cloned in the mixing obtained) press 3 × 10⁵The ratio of cells/mL × 130mL accesses 500mL triangle shake bottles, in the 4th day by 4g/L to Glucose is added in culture, adds glucose by 6g/L within the 6th day；Continue culture to the 9th day, takes supernatant, use Leptin (Wuhan cloud clones Science and Technology Co., Ltd.'s product, article No. to ELISA detection kit：SEA084Hu it) detects in culture supernatant Leptin contents.As a result Leptin contents in mixing clone's group's cells and supernatant that 50P/1000M pressurization screenings obtain are shown Up to 200~280mg/L, show that Leptin obtains high efficient expression by the method for the invention.

Embodiment described above is only to absolutely prove preferred embodiment that is of the invention and being lifted, protection model of the invention It encloses without being limited thereto.Those skilled in the art on the basis of the present invention made by equivalent substitute or transformation, in the present invention Protection domain within.Protection scope of the present invention is subject to claims.

Sequence table

<110>Wuhan Haite Bio-pharmaceutical Co., Ltd

<120>One section of functional sequence and the application in secretory protein expression

<130> CN102898514B

<150> 2018100347246

<151> 2018-01-15

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 267

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 1

Met Ser Met Leu Phe Tyr Thr Leu Ile Thr Ala Phe Leu Ile Gly Ile

1 5 10 15

Gln Ala His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Gly Gly Gly

20 25 30

Gly Gly His His His His His His Gly Gly Gly Gly Gly Glu Pro His

35 40 45

Ser Glu Ser Asn Val Pro Ala Gly His Thr Ile Pro Gln Ala His Trp

50 55 60

Thr Lys Leu Gln His Ser Leu Asp Thr Ala Leu Arg Arg Ala Ala Ser

65 70 75 80

Ala Pro Ala Ala Ala Ile Ala Ala Arg Val Ala Gly Gln Thr Arg Asn

85 90 95

Ile Thr Val Asp Pro Arg Leu Phe Lys Lys Arg Arg Leu Ala Ser Pro

100 105 110

Arg Val Leu Phe Ser Thr Gln Pro Pro Arg Glu Ala Ala Asp Thr Gln

115 120 125

Asp Leu Asp Phe Glu Val Gly Gly Ala Ala Pro Phe Asn Arg Thr His

130 135 140

Gly Ser Gly Arg Gly Ser Ser Ser His Pro Ile Phe His Arg Gly Glu

145 150 155 160

Phe Ser Val Cys Asp Ser Val Ser Val Trp Val Gly Asp Lys Thr Thr

165 170 175

Ala Thr Asp Ile Lys Gly Lys Glu Val Met Val Leu Gly Glu Val Asn

180 185 190

Ile Asn Asn Ser Val Phe Lys Gln Tyr Phe Phe Glu Thr Lys Cys Arg

195 200 205

Asp Pro Asn Pro Val Asp Ser Gly Cys Arg Gly Ile Asp Ser Lys His

210 215 220

Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr

225 230 235 240

Met Asp Gly Lys Gln Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr Ala

245 250 255

Cys Val Cys Val Leu Ser Arg Lys Ala Val Arg

260 265

<210> 2

<211> 822

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

cctagggcca ccatgagcat gctgttctac acactgatca ccgcttttct gatcggcatc 60

caggcccatg gcgagggcac attcaccagc gacgtgtctg gaggaggagg aggacaccat 120

caccatcacc atggcggagg aggaggagag cctcactccg agagcaacgt gcctgctggc 180

cacacaatcc cacaggccca ttggaccaag ctgcagcaca gcctggatac agctctgagg 240

agggctgctt ctgccccagc tgctgctatc gctgctaggg tggctggcca gacacggaat 300

atcaccgtgg accccaggct gttcaagaag agacgcctgg cctctcccag ggtgctgttc 360

tccacacagc cacctcggga ggctgctgat acccaggacc tggatttcga agtgggagga 420

gctgctccct tcaacagaac ccatggatcc ggaaggggat ccagctctca cccaatcttc 480

catagaggcg agtttagcgt gtgcgactcc gtgtccgtgt gggtgggcga caagaccaca 540

gctacagata tcaagggcaa ggaagtgatg gtgctgggcg aagtgaatat caacaattcc 600

gtgttcaagc agtacttctt tgagaccaag tgcagagacc caaaccccgt ggattccggc 660

tgtcgcggca tcgattccaa gcattggaat agctattgta ccacaaccca cacattcgtg 720

aaggctctga ccatggacgg caagcaggct gcctggaggt tcatccgcat cgataccgcc 780

tgcgtgtgcg tgctgtctag gaaggctgtg aggtgagtat ac 822

<210> 3

<211> 239

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 3

Met Ser Met Leu Phe Tyr Thr Leu Ile Thr Ala Phe Leu Ile Gly Ile

1 5 10 15

Gln Ala Glu Pro His Ser Glu Ser Asn Val Pro Ala Gly His Thr Ile

20 25 30

Pro Gln Ala His Trp Thr Lys Leu Gln His Ser Leu Asp Thr Ala Leu

35 40 45

Arg Arg Ala Ala Ser Ala Pro Ala Ala Ala Ile Ala Ala Arg Val Ala

50 55 60

Gly Gln Thr Arg Asn Ile Thr Val Asp Pro Arg Leu Phe Lys Lys Arg

65 70 75 80

Arg Leu Ala Ser Pro Arg Val Leu Phe Ser Thr Gln Pro Pro Arg Glu

85 90 95

Ala Ala Asp Thr Gln Asp Leu Asp Phe Glu Val Gly Gly Ala Ala Pro

100 105 110

Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser Ser His Pro Ile Phe

115 120 125

His Arg Gly Glu Phe Ser Val Cys Asp Ser Val Ser Val Trp Val Gly

130 135 140

Asp Lys Thr Thr Ala Thr Asp Ile Lys Gly Lys Glu Val Met Val Leu

145 150 155 160

Gly Glu Val Asn Ile Asn Asn Ser Val Phe Lys Gln Tyr Phe Phe Glu

165 170 175

Thr Lys Cys Arg Asp Pro Asn Pro Val Asp Ser Gly Cys Arg Gly Ile

180 185 190

Asp Ser Lys His Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Val

195 200 205

Lys Ala Leu Thr Met Asp Gly Lys Gln Ala Ala Trp Arg Phe Ile Arg

210 215 220

Ile Asp Thr Ala Cys Val Cys Val Leu Ser Arg Lys Ala Val Arg

225 230 235

<210> 4

<211> 738

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

cctagggcca ccatgtctat gctgttctac acactgatca ccgcttttct gatcggcatc 60

caggccgagc ctcattccga gagcaacgtg cctgctggcc acacaatccc acaggcccat 120

tggaccaagc tgcagcactc tctggacaca gctctgagga gggctgcttc cgccccagct 180

gctgccatcg ctgcccgcgt ggctggccag acaaggaata tcaccgtgga ccccagactg 240

ttcaagaaga gacgcctggc ctcccctcgg gtgctgttta gcacacagcc ccctagagag 300

gctgccgata cccaggacct ggatttcgaa gtgggaggag ctgctccctt caacaggacc 360

caccggagca agagatccag ctctcacccc atcttccata ggggcgagtt ctccgtgtgc 420

gactccgtgt ccgtgtgggt gggcgacaag accacagcta cagatatcaa gggcaaggaa 480

gtgatggtgc tgggcgaagt gaatatcaac aattccgtgt tcaagcagta cttctttgag 540

accaagtgcc gcgacccaaa ccccgtggat agcggctgta ggggcatcga tagcaagcat 600

tggaattctt attgtaccac aacccacaca ttcgtgaagg ccctgaccat ggacggcaag 660

caggctgcct ggcgctttat caggatcgat accgcttgcg tgtgcgtgct gtcccggaag 720

gctgtgaggt gagtatac 738

<210> 5

<211> 264

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 5

Met Ser Met Leu Phe Tyr Thr Leu Ile Thr Ala Phe Leu Ile Gly Ile

1 5 10 15

Gln Ala His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Gly Gly Gly

20 25 30

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Glu Pro His Ser Glu

35 40 45

Ser Asn Val Pro Ala Gly His Thr Ile Pro Gln Ala His Trp Thr Lys

50 55 60

Leu Gln His Ser Leu Asp Thr Ala Leu Arg Arg Ala Ala Ser Ala Pro

65 70 75 80

Ala Ala Ala Ile Ala Ala Arg Val Ala Gly Gln Thr Arg Asn Ile Thr

85 90 95

Val Asp Pro Arg Leu Phe Lys Lys Arg Arg Leu Ala Ser Pro Arg Val

100 105 110

Leu Phe Ser Thr Gln Pro Pro Arg Glu Ala Ala Asp Thr Gln Asp Leu

115 120 125

Asp Phe Glu Val Gly Gly Ala Ala Pro Phe Asn Arg Thr His Arg Ser

130 135 140

Lys Arg Ser Ser Ser His Pro Ile Phe His Arg Gly Glu Phe Ser Val

145 150 155 160

Cys Asp Ser Val Ser Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp

165 170 175

Ile Lys Gly Lys Glu Val Met Val Leu Gly Glu Val Asn Ile Asn Asn

180 185 190

Ser Val Phe Lys Gln Tyr Phe Phe Glu Thr Lys Cys Arg Asp Pro Asn

195 200 205

Pro Val Asp Ser Gly Cys Arg Gly Ile Asp Ser Lys His Trp Asn Ser

210 215 220

Tyr Cys Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr Met Asp Gly

225 230 235 240

Lys Gln Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr Ala Cys Val Cys

245 250 255

Val Leu Ser Arg Lys Ala Val Arg

260

<210> 6

<211> 813

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

cctagggcca ccatgagcat gctgttctac acactgatca ccgcttttct gatcggcatc 60

caggcccatg gcgagggcac attcaccagc gacgtgtctg gaggaggagg atcaggagga 120

ggaggatctg gaggaggagg agagcctcac tccgagagca acgtgcctgc tggccacaca 180

atcccacagg cccattggac caagctgcag cacagcctgg atacagctct gaggagggct 240

gcttctgccc cagctgctgc catcgctgcc cgcgtggctg gccagacaag gaatatcacc 300

gtggacccca gactgttcaa gaagagacgc ctggcctctc ctcgggtgct gttttccaca 360

cagcccccta gagaggctgc cgatacccag gacctggatt tcgaagtggg aggagctgct 420

cccttcaaca ggacacatcg gtccaagaga tccagctctc accccatctt ccataggggc 480

gagtttagcg tgtgcgactc cgtgtccgtg tgggtgggcg acaagaccac agctacagat 540

atcaagggca aggaagtgat ggtgctgggc gaagtgaata tcaacaattc cgtgttcaag 600

cagtacttct ttgagaccaa gtgccgcgac ccaaaccccg tggattccgg ctgtaggggc 660

atcgattcca agcattggaa tagctattgt accacaaccc acacattcgt gaaggccctg 720

accatggacg gcaagcaggc tgcctggcgc tttatcagga tcgataccgc ttgcgtgtgc 780

gtgctgtctc ggaaggccgt gagatgagta tac 813

<210> 7

<211> 241

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 7

Met Ser Met Leu Phe Tyr Thr Leu Ile Thr Ala Phe Leu Ile Gly Val

1 5 10 15

Gln Ala His Gly Glu Gly Thr Phe Thr Ser Asp Leu Ser Lys Gly Gly

20 25 30

Gly Gly Gly Gly Ser Gly Gly Gly Gly His His His His His His Gly

35 40 45

Gly Gly Gly Ser Ala Ala Gly Gly Ile Glu Gly Arg His Pro Leu Pro

50 55 60

Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr

65 70 75 80

Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg

85 90 95

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu

100 105 110

Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val

115 120 125

Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu Tyr Gly

130 135 140

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu

145 150 155 160

Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro Leu

165 170 175

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly

180 185 190

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu

195 200 205

Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp

210 215 220

Pro Leu Ser Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala

225 230 235 240

Ser

<210> 8

<211> 744

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

cctagggcca ccatgtctat gctgttctac accctgatca cagcctttct gatcggcgtt 60

caggctcacg gcgagggcac cttcacatcc gacctgtcca aaggaggagg aggaggagga 120

tccggaggag gcggccacca tcaccatcac catggaggag gaggatctgc tgctggagga 180

atcgagggac gccacccact gcctgattct tcccctctgc tgcagttcgg cggccaggtg 240

aggcagaggt acctgtacac cgacgatgcc cagcagacag aggctcatct ggagatcagg 300

gaggacggaa ccgtgggagg agctgctgat cagagccccg agtctctgct gcagctgaag 360

gccctgaagc ctggcgtgat ccagatcctg ggcgtgaaga caagcaggtt tctgtgccag 420

aggccagacg gcgccctgta cggcagcctg cacttcgatc ccgaggcttg ttcttttaga 480

gagctgctgc tggaggacgg ctacaacgtg tatcagtccg aggctcacgg actgccactg 540

catctgcctg gcaataagag ccctcatagg gatccagctc ccagaggacc agctcgcttc 600

ctgcctctgc caggactgcc tccagccctg ccagagccac ctggcatcct ggctccacag 660

ccaccagacg tgggaagctc tgatccactg tctatggtgg gaccatccca gggcaggtcc 720

cctagctatg cttcttgagt atac 744

<210> 9

<211> 266

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 9

Met Ser Met Leu Phe Tyr Thr Leu Ile Thr Ala Phe Leu Ile Gly Ile

1 5 10 15

Gln Ala His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Gly Gly Gly

20 25 30

Gly Gly His His His His His His Gly Gly Gly Gly Gly Glu Pro His

35 40 45

Ser Glu Ser Asn Val Pro Ala Gly His Thr Ile Pro Gln Ala His Trp

50 55 60

Thr Lys Leu Gln His Ser Leu Asp Thr Ala Leu Arg Arg Ala Ala Ser

65 70 75 80

Ala Pro Ala Ala Ala Ile Ala Ala Arg Val Ala Gly Gln Thr Arg Asn

85 90 95

Ile Thr Val Asp Pro Arg Leu Phe Lys Lys Arg Arg Leu Ala Ser Pro

100 105 110

Arg Val Leu Phe Ser Thr Gln Pro Pro Arg Glu Ala Ala Asp Thr Gln

115 120 125

Asp Leu Asp Phe Glu Val Gly Gly Ala Ala Pro Phe Asn Arg Thr His

130 135 140

Gly Ser Gly Arg Gly Ser Ser Ser His Pro Ile Phe His Arg Gly Glu

145 150 155 160

Phe Ser Val Cys Asp Ser Val Ser Val Trp Val Gly Asp Lys Thr Thr

165 170 175

Ala Thr Asp Ile Lys Gly Lys Glu Val Met Val Leu Gly Glu Val Asn

180 185 190

Ile Asn Asn Ser Val Phe Lys Gln Tyr Phe Phe Glu Thr Lys Cys Arg

195 200 205

Asp Pro Asn Pro Val Asp Ser Gly Cys Arg Gly Ile Asp Ser Lys His

210 215 220

Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr

225 230 235 240

Met Asp Gly Lys Gln Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr Ala

245 250 255

Cys Val Cys Val Leu Ser Arg Lys Ala Val

260 265

<210> 10

<211> 819

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

cctagggcca ccatgagcat gctgttctac acactgatca ccgcttttct gatcggcatc 60

caggcccatg gcgagggcac attcaccagc gacgtgtctg gaggaggagg aggacaccat 120

caccatcacc atggcggagg aggaggagag cctcactccg agagcaacgt gcctgctggc 180

cacacaatcc cacaggccca ttggaccaag ctgcagcaca gcctggatac agctctgagg 240

agggctgctt ctgccccagc tgctgctatc gctgctaggg tggctggcca gacacggaat 300

atcaccgtgg accccaggct gttcaagaag agacgcctgg cctctcccag ggtgctgttc 360

tccacacagc cacctcggga ggctgctgat acccaggacc tggatttcga agtgggagga 420

gctgctccct tcaacagaac ccatggatcc ggaaggggat ccagctctca cccaatcttc 480

catagaggcg agtttagcgt gtgcgactcc gtgtccgtgt gggtgggcga caagaccaca 540

gctacagata tcaagggcaa ggaagtgatg gtgctgggcg aagtgaatat caacaattcc 600

gtgttcaagc agtacttctt tgagaccaag tgcagagacc caaaccccgt ggattccggc 660

tgtcgcggca tcgattccaa gcattggaat agctattgta ccacaaccca cacattcgtg 720

aaggctctga ccatggacgg caagcaggct gcctggaggt tcatccgcat cgataccgcc 780

tgcgtgtgcg tgctgtctag gaaggctgtg tgagtatac 819

<210> 11

<211> 208

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 11

Met Ser Met Leu Phe Tyr Thr Leu Ile Thr Ala Phe Leu Ile Gly Ile

1 5 10 15

Gln Ala His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Gly Gly Gly

20 25 30

Gly Gly His His His His His His Gly Gly Gly Gly Gly Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Ala Asp Asp Asp Asp Lys Val Pro

50 55 60

Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val

65 70 75 80

Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln

85 90 95

Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr

100 105 110

Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr

115 120 125

Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn

130 135 140

Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu

145 150 155 160

Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu

165 170 175

Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln

180 185 190

Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys

195 200 205

<210> 12

<211> 645

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

cctagggcca ccatgtccat gctgttctac accctgatca cagcctttct gatcggcatc 60

caggctcacg gcgagggcac cttcacaagc gacgtgtctg gcggaggagg aggacaccat 120

caccatcacc atggaggagg aggaggatcc ggaggaggag gaagcggcgg cggcggctct 180

gctgacgatg acgataaggt gcctatccag aaggtgcagg acgataccaa gacactgatc 240

aagaccatcg tgacaagaat caacgatatc agccacaccc agtccgtgtc cagcaagcag 300

aaggtgacag gcctggactt catccccggc ctgcatccta tcctgaccct gagcaagatg 360

gatcagacac tggccgtgta ccagcagatc ctgacctcca tgccaagcag gaatgtgatc 420

cagatctcta acgacctgga gaatctgcgg gatctgctgc acgtgctggc cttttctaag 480

tcctgccatc tgccctgggc ttctggactg gagaccctgg actccctggg cggcgtgctg 540

gaggcctctg gctattccac agaggtggtg gctctgtccc gcctgcaggg aagcctgcag 600

gacatgctgt ggcagctgga tctgtcccca ggctgttgag tatac 645

Claims (12)

1. one section of functional sequence, which is characterized in that amino acid sequence from N-terminal to C-terminal successively by：NGF SP, GNT, Linker and Pro_mdf is formed by connecting；

The amino acid sequence of the NGF SP is：MSMLFYTLIT (A/V) (F/L) LIG (I/V) QA, wherein the 11st amino acids For alanine (A) or valine (V), the 12nd amino acids are phenylalanine (F) or leucine (L), and the 16th amino acids are different Leucine (I) or valine (V)；

The amino acid sequence of the GNT is：Preceding 6~12 amino acid sequences of H (G/A) EGTFTSD (V/L) S (S/K), wherein 2nd amino acids are glycine (G) or alanine (A), and the 10th amino acids are valine (V) or leucine (L), and the 12nd is Serine (S) or lysine (K)；

The amino acid sequence of the Linker is：Containing in glycine (G), serine (S), alanine (A) and threonine (T) extremely Few 1 amino acid, sequence length are not more than 20 amino acid；

The amino acid sequence of the Pro_mdf contains site-specific protease cutting sequence, is free of precursor protein enzyme Cut sequence.

2. functional sequence according to claim 1, which is characterized in that between the Linker and Pro_mdf, be also associated with Tag and Linker.

3. functional sequence according to claim 2, which is characterized in that the Tag is histidine tag, Flag labels, HA Label, c-Myc labels or green fluorescent protein (GFP).

4. according to any functional sequence of claims 1 to 3, which is characterized in that the site-specific protease is solidifying Hemase, Ⅹ factor of blood coagulation (FactorXa), marmor erodens (TEV) protease, HRV HRV 3CPs or enterokinase (Enterokinase)。

5. the encoding gene of any functional sequence of Claims 1 to 4.

6. a kind of secretory protein precursor molecule, which is characterized in that connected by any functional sequence C-terminal of Claims 1 to 4 Secretory protein maturation peptide sequence forms.

7. secretory protein precursor molecule according to claim 6, which is characterized in that the secretory protein is nerve growth factor Sub (β-NGF), transforming growth factor (TGF-β 1), albumin, Ⅸ factor of blood coagulation (Factor Ⅸ), Von Willebrand because Sub (von Willebrand factor, vWF), human endostatin (Endostatin), leptin (Leptin), Insulin-Like life The long factor -1 (IGF-1), fibroblast growth factor 21 (FGF21), monoclonal antibody or monoclonal antibody fragment or they Functional variant thereof.

8. the encoding gene of the secretory protein precursor molecule described in claim 6 or 7.

9. a kind of expression vector, which is characterized in that the encoding gene containing secretory protein precursor molecule according to any one of claims 8 and Expression control element.

10. a kind of mammalian cell, which is characterized in that contain the expression vector described in claim 9.

11. mammalian cell according to claim 10, which is characterized in that its initial cell is that Chinese hamster ovary is thin Born of the same parents (CHO), human embryonic kidney 293 cell, COS cells, Hela cells or mdck cell.

12. a kind of preparation method of secretory protein, which is characterized in that include the following steps：

(1) by the expression vector transfection mammalian cell described in claim 9；

(2) screening containing described in claim 9 expression vector or be integrated with secretory protein precursor molecule according to any one of claims 8 Encoding gene cell strain；

(3) culture gained cell strain collects the former albumen (proprotein) that culture solution and purifying cells secret out of；

(4) site-specific protease digestion original albumen is used, and isolates and purifies to obtain destination protein.