CN108567973B - Placenta-like chondroitin sulfate A immune composition and application thereof - Google Patents

Abstract

The invention relates to a placenta-like chondroitin sulfate A immune composition and application, and particularly discloses an immune composition for contraception, wherein the immune composition comprises at least one placenta trophoblast cell specific expression polysaccharide and/or protein antigen, and the embryo or placenta trophoblast cell specific expression polysaccharide is selected from placenta-like chondroitin sulfate A. The immune composition also comprises a B cell dominant epitope of the placenta-like chondroitin sulfate A core protein CSPG 4. The invention firstly provides the conception that the contraceptive vaccine aims at the key and sensitive period of the formation of placenta and the development of embryo in the early stage of implantation, performs the key cell trophoblast cell in the targeted implantation, and improves the sensitivity and the effectiveness of contraception.

Description

Placenta-like chondroitin sulfate A immune composition and application thereof

Technical Field

The invention relates to the field of biological pharmacy, and in particular relates to a placenta-like chondroitin sulfate A immune composition and application thereof.

Background

At present, no contraceptive vaccine is applied to clinical practice. The targets of contraceptive vaccines are primarily directed against hormones or certain components of germ cells, which hormones or components associated with germ cells often play a key role in the reproductive process, such as by inhibiting germ cell production (sperm or egg) or inhibiting germ cell function, and impeding normal pregnancy progression and maintenance^[1]. Among these components, sperm became the first contraceptive vaccine target, the hybrid of Nobel prize winner 1899The einer and the Metnikoff respectively carry out anti-sperm antibody research, and the injection of the anti-sperm antibody can play a contraceptive role; subsequently, the first anti-sperm contraceptive vaccine was issued by Morris in 1937, although this vaccine produced a reversible contraceptive effect in fertile women, whose undefined side effects prevented its clinical use^[2]. Currently, a variety of hormones and germ cell components are used to develop contraceptive vaccines (see table 1).

TABLE 1 targeting molecules of contraceptive vaccines of prior art

First, contraceptive vaccines that target hormone molecules and their receptors. Suitable specific anti-hormone antibodies can block the normal functioning of the hormones required for reproductive activities, and immunization of a mature individual with the hormones stimulates the body to produce a sufficient titer of biologically neutralizing antibodies that the vaccinee can maintain contraceptive status as long as there is a sufficient titer of antibodies^[5]. Currently, GnRH has been validated by various animal experiments, such as controlling wild animal populations by immunodeployment, and in human clinical trials GnRH has been used to prolong anovulatory periods in postpartum women, as well as for male contraception and prostate cancer therapy [3^,10]. FSH contraceptive vaccine has been carried out in male phase I clinical experiments to mainly evaluate immunogenicity and influence on spermatogenesis, but the obtained results are not ideal, and the FSH contraceptive vaccine is only found to have weak immunogenicity, can reduce the number and activity of sperms, but has no significant influence on other parameters of semen^[4]. The hCG vaccine can prevent the identification of maternal pregnancy to terminate early pregnancy, and the clinical experiments of the first phase and the second phase are successfully carried out on women at present, and the hCG vaccine is found to be a very promising contraceptive vaccine^[11,12]. Several hCG-based contraceptive vaccines have been developed for a wide range of preclinical and clinical studies, such as the beta subunit hCG vaccine and the carboxy-terminal peptide beta subunit hCG vaccine^[13-15]These vaccines prevent the luteinizing effect of hCG by neutralizing itOr interfere with peri-implantation, and the vaccine is also used to inhibit excessive secretion of steroid hormones, such as hysteromyoma, polycystic ovary syndrome, endometriosis and precocious puberty^[11]. However, contraceptive vaccines targeting hormones and their receptors still have the risk of contraceptive failure, and can cause secretion disorder in the body, disturb ovarian function and affect health.

Second, germ cell associated molecules are targeted. The cell surface usually has antigen molecules, and these surface antigens usually have tissue specificity and strong immunogenicity, and can easily stimulate the body to produce corresponding antibodies. The zona pellucida antigen is one of the zona pellucida antigens, is a non-cellular component, specific extracellular matrix glycoprotein, covers the surfaces of ova of female germ cells and peri-implantation period embryos, plays a key role in the processes of follicular formation, fertilization, early embryonic development and the like, and is considered to be a promising candidate contraceptive vaccine^[16]. The zona pellucida contraceptive vaccine may be one kind of abortifacient vaccine through preventing zona pellucida from being hydrolyzed by uterine proteinase to affect sperm penetration or embryo implantation^[8,17]. The zona pellucida contraceptive vaccine needs to induce an organism to generate high zona pellucida antibody titer to prevent fertilization, but the high zona pellucida antibody is difficult to maintain usually, and can cause ovarian damage to cause premature inactivation of primordial follicles, so that the zona pellucida contraceptive vaccine is difficult to popularize and apply before solving the defect of damaging ovaries.

There are some specific proteins on the surface of the male germ cell sperm, so that the contraceptive vaccine targeting the sperm may be very promising^[18]. Sperm can be used as autoantigen and alloantigen, and can stimulate individuals of both sexes to produce antibodies, which have been prevented from fertilization and embryonic development in vivo and in vitro^[7]. Immunization of various species, including humans, with sperm or sperm extracts stimulates the body to produce anti-sperm antibodies, resulting in infertility^[7]. Therefore, the sperms can stimulate the organism to generate immune response, and the organism can be promoted to keep the sterile state by maintaining a certain anti-sperm antibody titer. Sperm-targeted contraceptive vaccines, however, are generally not assured of preventing because of the inability to maintain high antibody titersThe failure of contraception due to the entry of all sperm into the embryoid body and the serious challenge of sperm source prevent the popularization and application of sperm contraceptive vaccines.

[ REFERENCE ] to

1.Gupta SK,Shrestha A,Minhas V:Milestones in contraceptive vaccines development and hurdles in their application.Human vaccines&immunotherapeutics 2014,10(4):911-925.

2.Lekhwani S,Vaswani N,Ghalaut VS,Shanker V,Singh R:Immunocontraceptives:How far from realityAdvanced biomedical research2014,3:247.

3.Barmat LI,Chantilis SJ,Hurst BS,Dickey RP:A randomized prospective trial comparing gonadotropin-releasing hormone(GnRH)antagonist/recombinant follicle-stimulating hormone(rFSH)versus GnRH-agonist/rFSH in women pretreated with oral contraceptives before in vitro fertilization.Fertility and sterility 2005,83(2):321-330.

4.Schally AV,Parlow AF,Carter WH,Saito M,Bowers CY,Arimura A:Studies on the site of action of oral contraceptive steroids.II.Plasma LH and FSH levels after administration of antifertility steroids and LH-releasing hormone(LH-RH).Endocrinology 1970,86(3):530-541.

5.Delves PJ:How far from a hormone-based contraceptive vaccine？Journal of reproductive immunology 2004,62(1-2):69-78.

6.Talwar GP,Gupta JC,Rulli SB,Sharma RS,Nand KN,Bandivdekar AH,Atrey N,Singh P:Advances in development of a contraceptive vaccine against human chorionic gonadotropin.Expert opinion on biological therapy 2015,15(8):1183-1190.

7.Shi J,Yang Z,Wang M,Cheng G,Li D,Wang Y,Zhou Y,Liu X,Xu C:Screening of an antigen target for immunocontraceptives from cross-reactive antigens between human sperm and Ureaplasma urealyticum.Infection and immunity 2007,75(4):2004-2011.

8.Gupta SK,Gupta N,Suman P,Choudhury S,Prakash K,Gupta T,Sriraman R,Nagendrakumar SB,Srinivasan VA:Zona pellucida-based contraceptive vaccines for human and animal utility.Journal of reproductive immunology 2011,88(2):240-246.

9.Ferro VA:Current advances in antifertility vaccines for fertility control and noncontraceptive applications.Expert review of vaccines 2002,1(4):443-452.

10.Perez-Lopez FR:Pituitary repetitive stimulation with GnRH/TRH in women treated with three different oral steroid contraceptives.Acta endocrinologica 1990,122(2):163-167.

11.Talwar GP,Singh OM,Gupta SK,Hasnain SE,Pal R,Majumbar SS,Vrati S,Mukhopadhay A,Srinivasan J,Deshmukh U et al:The HSD-hCG vaccine prevents pregnancy in women:feasibility study of a reversible safe contraceptive vaccine.American journal of reproductive immunology 1997,37(2):153-160.

12.Manning PA:Immunogenicity trial of a contraceptive vaccine based on human chorionic gonadotropin.Vaccine 1986,4(4):271.

13.Stevens VC:Progress in the development of human chorionic gonadotropin antifertility vaccines.American journal of reproductive immunology 1996,35(3):148-155.

14.Saxena HM:Predictions of Immunological Cross-Reactions of C-Terminal Peptide of Human Chorionic Gonadotropin beta-Chain Based Contraceptive Vaccine with Autoantigens.Russian journal of immunology:RJI:official journal of Russian Society of Immunology 1999,4(2):151-158.

15.Zhang FC,Wang N,Liu DM,Jian Y,Chen YZ,Shen XZ,Cao YQ,Wang B:Development of Female Contraceptive Vaccine Through DNA Inoculation of Human Chorionic Gonadotropin Beta Subunit(hCGss).Methods in molecular medicine 2000,29:439-449.

16.Gupta SK,Srivastava N,Choudhury S,Rath A,Sivapurapu N,Gahlay GK,Batra D:Update on zona pellucida glycoproteins based contraceptive vaccine.Journal of reproductive immunology 2004,62(1-2):79-89.

17.Gupta SK,Jethanandani P,Afzalpurkar A,Kaul R,Santhanam R:Prospects of zona pellucida glycoproteins as immunogens for contraceptive vaccine.Human reproduction update 1997,3(4):311-324.

18.Naz RK:Development of genetically engineered human sperm immunocontraceptives.Journal of reproductive immunology 2009,83(1-2):145-150.

Although the research of contraceptive vaccines has made great progress in different aspects, at present, no contraceptive vaccine is applied in clinical practice, and the development of contraceptive vaccines is in the research stage. The problems with the above-mentioned very promising target antigen vaccines include: the first targeted hormone and its receptor may cause secretion disorder in the body, affecting the normal function of the body; secondly, targeting germ cells can cause tissue damage, and irreversible infertility occurs; the third target vaccine molecule can not generate enough antibody titer, so that the contraceptive effect is influenced, and the contraceptive failure is caused. Therefore, the research, development and clinical application of the contraceptive vaccine have wide prospects, and the contraceptive vaccine which is high in efficiency, appropriate in price, comfortable to use, capable of being popularized and applied and low in species selectivity is urgently needed to meet the requirements of human contraception, foreign animal invasion and wild animal population unbalance prevention and control.

Disclosure of Invention

The invention provides the conception that the contraceptive vaccine aims at the key and sensitive period of placenta formation and embryo development, namely the embryo attachment period, and the key cell trophoblast cell is executed by targeted attachment, so that the sensitivity and the effectiveness of contraception can be improved. The pl-CSA specifically secreted by the placenta trophoblast is used alone or combined with the B cell dominant antigen epitope of the core protein CSPG4 to prepare the contraceptive vaccine, the B cell dominant antigen epitope of the core protein CSPG4 is used for inducing the antigen reaction of B cells, the immunity is enhanced, the contraceptive effect is further improved, and thus the safe and effective contraceptive vaccine is prepared.

In one aspect, the invention provides a contraceptive immune composition comprising at least one placental trophoblast cell that specifically expresses a polysaccharide and/or protein antigen.

In the technical scheme of the invention, the embryo or placenta trophoblast cell specifically expresses polysaccharide selected from placenta-like chondroitin sulfate A.

In the technical scheme of the invention, the immune composition further comprises an immunopotentiator which induces an antigen response of B cells, wherein the immunopotentiator is selected from B cell dominant epitopes of placenta-like chondroitin sulfate A core protein CSPG4, preferably, the B cell dominant epitopes of placenta-like chondroitin sulfate A core protein CSPG4 are shown as sequence SEQ ID No.2 or homologues thereof.

IVAVDEPTRPIYRFTQ SEQ ID No.2

In the technical scheme of the invention, the mass ratio of the embryo or placenta trophoblast cells to the B cell dominant antigen epitope of CSPG4 is 1-100: 1, preferably 1 to 10: 1.

in the technical scheme of the invention, the immunological composition for contraception also comprises an adjuvant.

In the technical scheme of the invention, the adjuvant is selected from Freund's complete adjuvant, Freund's incomplete adjuvant, aluminum (aluminum phosphate or aluminum hydroxide), saponin, Quil A, RIBBI adjuvant, dimethyl dioctadecyl ammonium bromide (DDA), monophosphoryl lipid A (MPL), Trehalose Dimycolate (TDM), trehalose dibehenate (dibehenate) and Muramyl Dipeptide (MDP), poly I: C and the like.

In another aspect, the present invention provides a pharmaceutical composition comprising the immune composition of the present invention.

In the technical scheme of the invention, the pharmaceutical composition also comprises other active ingredients for contraception and/or pregnancy cessation. The active ingredient for contraception and/or pregnancy cessation may illustratively be desogestrel ethinyl estradiol, nonoxynol suppositories, nonoxynol, mifepristone, levonorgestrel ethinyl.

In another aspect, the invention provides the use of the immunological composition of the invention in the preparation of a medicament for preventing the attachment of an embryo to the endometrium.

In another aspect of the invention there is provided the use of an immunological composition as described herein for preventing the attachment of an embryo to the endometrium.

In another aspect, the invention provides the use of an immunogenic composition according to the invention in the manufacture of a medicament for the cessation of pregnancy.

In another aspect of the invention there is provided the use of an immunological composition as described herein for the cessation of pregnancy.

In another aspect, the invention provides the use of an immunological composition according to the invention for the preparation of a contraceptive medicament.

In another aspect of the invention there is provided the use of an immunological composition as described herein for contraception.

In a further aspect of the invention there is provided a method of inhibiting pregnancy in a human or non-human animal by immunizing the human or non-human animal with an immunogenic composition according to the invention, which method comprises administering to the animal a therapeutically effective amount of a composition comprising one or more of the immunogenic compositions according to the invention.

In the technical scheme of the invention, the embryo is attached to endometrium, and the object or subject for contraception or pregnancy interruption is a human or non-human animal, including a domesticated animal and a non-domesticated animal.

In one embodiment of the invention, the non-human animal is a domestic animal. Such as, but not limited to, dogs, cats, rats, mice, cows, horses, sheep, pigs, rabbits, etc.

In the technical scheme of the invention, the non-human animal is a wild animal. For example, but not limited to, the wild animal is a dog, cat, rat, mouse, bat, fox, raccoon, squirrel, possum, wolf, rabbit, and the like.

In still another aspect, the invention provides the use of the placenta trophoblast cell specifically expressing polysaccharide and/or protein antigen as a target for contraception or prevention of embryo attachment to endometrium or pregnancy interruption, or as a target for screening drugs for contraception or prevention of embryo attachment to endometrium or pregnancy interruption.

In the present invention, a pharmaceutically acceptable carrier may be included in the immunological or pharmaceutical composition, including but not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and immunization composition may be sterile and compatible with the mode of administration. The immunological or pharmaceutical composition may also contain other adjuvants commonly used in pharmaceutical preparations, such as small amounts of wetting, emulsifying or pH buffering agents.

The immunological or pharmaceutical composition of the present invention may be a liquid solution, suspension, emulsion, sustained-release formulation or powder. Any of the usual pharmaceutical carriers such as sterile saline solution or sesame oil may be used. The medium may also contain conventional pharmaceutical auxiliary substances such as pharmaceutically acceptable salts for adjusting the osmotic pressure, buffers, preservatives and the like.

The administration of the immunological or pharmaceutical compositions of the present invention may be by any route, including, but not limited to, by oral, transdermal, mucosal (e.g., vaginal, rectal, buccal or nasal mucosa), injection (e.g., intramuscular, subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal), or by inhalation (e.g., oral or nasal). The adjuvants in the immunological composition or vaccine or medicament of the present invention and the preparation method can be adjusted according to the administration mode.

In the present invention, the term "implantation" means that the embryotrophy layer is gradually linked to the endometrium histologically and physiologically, so that the blastocyst is fixed to the endometrium, and this physiological process becomes implantation.

In the present invention, the terms "pharmaceutical composition" and "immunological composition" are to be understood in their broadest sense, e.g. immunological composition is a composition capable of eliciting an immune response and pharmaceutical composition is a composition capable of eliciting the development of the body of a subject towards a desired healthy state.

Advantageous effects

1. The invention firstly provides the conception that the contraceptive vaccine aims at the key and sensitive period of the formation of placenta and the development of embryo in the early stage of implantation, performs the key cell trophoblast cell in the targeted implantation, and improves the sensitivity and the effectiveness of contraception.

2. The pl-CSA vaccine targets trophoblast cells, which exist in blastocyst trophectoderm and placenta, have low cross reactivity with other normal cells of the body (such as tissue cells of thalamus-pituitary-ovary and the like), and do not easily damage the normal functions of tissues and organs of the body.

3. The pl-CSA is macromolecular polysaccharide, has a stable structure and strong immunogenicity, and can generate higher antibody titer for immunized animals; meanwhile, the combination of pl-CSA and B cell dominant antigen epitope of the core protein CSPG4 can induce the antigen reaction of B cells and enhance the immunity, thereby increasing the contraceptive effect;

4. the pl-CSA is easy to obtain, and the similarity of the pl-CSA from different species is higher. The pl-CSA content in trophoblast cells is rich, the pl-CSA content in waste pig placentas is also rich, and the pl-CSA can be separated and purified from the pig placentas to change waste into valuable.

Drawings

Fig. 1 is a working principle diagram of a contraceptive vaccine.

Fig. 2 is a technical route diagram of the present invention.

FIG. 3 is a graph showing the expression of pl-CSA in human, mouse and pig placental trophoblast cells and co-localization with CSPG 4. pl-CSA was fluorescently stained with rVAR2 and Dylight650 labeled anti-6 × His monoclonal antibody, CSPG4 was fluorescently stained with rabbit anti-CSPG 4 monoclonal antibody and FITC labeled goat anti-rabbit secondary antibody, DAPI labeled nuclei, Merge pictures, human placental trophoblast was from the placenta delivered, mouse placental trophoblast was from the placenta 15d of pregnancy, pig placenta and myometrium were from the placenta 70d of pregnancy and myometrium. From the confocal results, it can be seen that pl-CSA and CSPG4 are contained in human, mouse and pig placental trophoblasts, while no pl-CSA and CSPG4 are expressed in pig utero-muscle.

FIG. 4 is a graph showing the results of pl-CSA immunization of BABL/c mice. Wherein, the A.pl-CSA sample and the standard substance have the same wave scanning surface and the absorption wavelength; B. dissecting conditions of experimental mice; C. testing the weight change condition of the mouse; D. experimental murine antibody levels; E. the conception rate of the experimental mice.

FIG. 5 is a graph showing the results of the pL-CSA and its core protein B cell dominant epitope CBZ-1 assembled vaccine immunization of BABL/c mice. A. Testing the weight change condition of the mouse; B. the pregnancy rate of the experimental mouse; C. murine antibody levels were tested.

FIG. 6 is a graph showing the results of body weight changes in mice subjected to acute toxicity tests.

FIG. 7 is a graph showing the results of histological section and HE staining of the internal organs (including liver, spleen and kidney) of immunized mice.

Detailed Description

The following examples illustrate certain specific features and/or embodiments. These examples should not be construed as limiting the disclosure to the specific features or embodiments described.

Example 1 expression and localization of pl-CSA and its core protein CSPG4

This part is performed by means of immunofluorescence. Firstly, collecting human placenta after delivery, placenta 15d after mouse pregnancy and uterine placenta 70d after pig pregnancy, and fully fixing 4% paraformaldehyde; tablets were prepared as in example 5; 3% H₂O₂(10min) inactivating endogenous peroxidase; maintaining citrate buffer solution with pH of 6.0 in water bath at 95 deg.c for 10min to repair antigen; incubating rabbit anti-CSPG 4 antibody (1:200) and home-made rVAR2-His-tag (1:100) reagent at 4 ℃ overnight; PBST (containing 0.1% Triton X-100) was soaked 3 times for 5min each time; FITC-labeled secondary goat anti-rabbit antibody (1:1000) and Dylight 650-labeled monoclonal anti-6 XHis antibody (1:1000) were incubated at room temperature for 40 min; PBST immersion-washing for 3 times, each time for 5 min; DAPI counterstaining nuclei; PBST (containing 0.1% Triton X-100) was washed 3 times for 5min → mounting with the anti-fluorescence quenching mounting agent, and photographed by observation with a fluorescence confocal microscope. The results of the experiment are shown in FIG. 3. From the results in FIG. 3, it can be seen that pl-CSA and CSPG4 are contained in human, mouse and pig placental trophoblasts, while no pl-CSA and CSPG4 are expressed in pig utero muscle.

EXAMPLE 2 preparation of immunizing agent

Preparation and purification of placental-like chondroitin sulfate a:

(1) crushing pig placenta or semi-mechanically separating continuously cultured trophoblast cell line to obtain histiocyte serous fluid;

(2) mixing the histiocyte serous fluid obtained in the step (1) with a lysis solution (V cell serous fluid: V lysis solution is 1:10), wherein the lysis solution contains RNase, DNase I, pancreatin and protease K to obtain lysed histiocyte serous fluid;

(3) inactivating the enzyme in the lysate by using the lysed histiocyte serous fluid obtained in the step (2); adding Sevag liquid with the volume of 1/4 to remove protein, and obtaining a pl-CSA crude product;

(4) adding a BamH I restriction enzyme site to the 5 'end and adding a Sal I restriction enzyme site to the 3' end of a gene sequence SEQ ID No.1 of a plasmodium infected erythrocyte surface antigen VAR2 CSA; connecting the gene fragment SEQ ID No.1 with pET28a (+) prokaryotic expression vector, transforming Escherichia coli BL21 competent cell for prokaryotic expression, and carrying out Ni by using rVAR2 terminal 6 × His label²⁺Affinity chromatography gave high purity rVAR2 (684.1. mu.g/mL).

SEQ ID No.1 is shown below

GGATCCCTGGAAAACTACATCAAGGGCGACCCCTATTTCGCTGAGTACGCTACAAAACTGAGCTTCATCCTGAACCCCAGCGACGCCAACAACCCCAGCGGCGAGACAGCCAACCACAACGACGAGGCCTGCAACTGCAACGAGAGCGGCATCAGCAGCGTGGGCCAGGCTCAGACATCCGGCCCTAGCAGCAACAAGACCTGTATCACCCACAGCTCCATCAAGACCAACAAGAAAAAAGAATGCAAGGACGTGAAGCTGGGCGTGCGGGAGAACGACAAGGATCTGAAGATCTGCGTGATCGAGGACACCAGCCTGAGCGGCGTGGACAACTGCTGCTGCCAGGATCTGCTGGGCATCCTGCAGGAAAACTGCAGCGACAACAAGCGGGGCAGCAGCTCCAACGACAGCTGCGACAATAAGAACCAGGACGAGTGCCAGAAAAAGCTGGAAAAGGTGTTCGCCAGCCTGACCAACGGCTACAAGTGCGATAAGTGCAAGAGCGGCACCTCCCGGTCCAAGAAGAAGTGGATCTGGAAGAAGTCCAGCGGCAACGAGGAAGGCCTGCAGGAAGAGTACGCCAACACCATCGGCCTGCCCCCCAGGACCCAGAGCCTGTACCTGGGCAATCTGCCCAAACTGGAAAACGTGTGCGAGGATGTGAAGGACATCAAC TTCGACACCAAAGAGAAGTTTCTGGCCGGCTGCCTGATCGTGTCCTTCCACGAGGGCAAGAATCTGAAGAAGCGCTACCCCCAGAATAAGAACAGCGGCAACAAAGAAAACCTGTGCAAGGCTCTGGAATACAGCTTCGCCGACTACGGCGACCTGATCAAGGGCACCTCCATCTGGGACAACGAGTACACAAAGGACCTGGAACTGAATCTGCAGAACAACTTCGGCAAGCTGTTCGGCAAGTACATCAAGAAGAACAATACCGCCGAGCAGGACACCTCCTACAGCTCCCTGGACGAGCTGCGCGAGTCTTGGTGGAATACCAATAAGAAGTACATCTGGACCGCCATGAAGCACGGCGCCGAGATGAACATCACCACCTGTAACGCCGACGGCTCCGTGACCGGCAGCGGCTCCAGCTGCGACGACATCCCCACCATCGACCTGATCCCCCAGTACCTGAGATTTCTGCAGGAATGGGTCGAGAACTTCTGCGAGCAGCGGCAGGCCAAAGTGAAGGACGTGATCACCAACTGCAAGAGCTGCAAAGAATCCGGCAACAAATGCAAGACCGAGTGCAAAACCAAGTGCAAGGATGAGTGCGAGAAGTACAAGAAGTTCATCGAGGCCTGCGGCACAGCCGGCGGAGGCATCGGAACAGCCGGCAGCCCCTGGTCCAAGAGATGGGACCAGATCTACAAGCGGTACAGCAAGCACATCGAGGACGCCAAGCGGAACCGGAAGGCCGGCACCAAGAACTGCGGCACCAGCTCCACCACCAACGCCGCTGCCAGCACCGACGAGAATAAGTGCGTGCAGAGCGACATCGACAGCTTTTTCAAGCACCTGATCGATATCGGCCTGACCACCCCCAGCAGCTACCTGAGCAACGTGCTGGACGACAACATCTGTGGCGCCGACAAGGCCCCCTGGACAACCTATACAACATACACTACAACCGAGAAGTGCAACAAAGAGCGGGACAAGAGCAAGAGCCAGAGCAGCGACACCCTGGTGGTGGTGAACGTGCCCAGCCCCCTGGGCAACACACCCTACCGGTACAAGTACGCCTGCCAGTGCAAGATCCCCACCAACGAGGAAACATGCGACGACCGGAAAGAATACATGAACCAGTGGTCCTGCGGGAGCGCTCGGACCATGAAGAGAGGGTATAAGAACGATAACTACGAACTGTGCAAGTACAACGGCGTGGATGTGAAGCCCACCACCGTGCGGAGCAACTCCAGCAAGCTGGACGGCAACGACGTGACCTTCTTCAACCTGTTCGAGCAGTGGAACAAAGAAATCCAGTACCAGATCGAGCAGTACATGACCAACGCCAACATCAGCTGCATCGATGAGAAAGAAGTGCTGGACAGCGTCTCCGACGAGGGCACCCCCAAAGTGCGGGGAGGCTACGAGGACGGCCGGAACAACAACACAGATCAGGGCACAAATTGCAAAGAAAAGTGCAAGTGCTACAAGCTGTGGATCGAGAAGATCAACGATCAGTGGGGCAAGCAGAAGGACAACTACAACAAGTTCCGGTCCAAGCAGATCTACGACGCCAATAAGGGCAGCCAGAACAAAAAGGTGGTGTCCCTGAGCAACTTCCTGTTCTTCAGCTGCTGGGAGGAATACATCCAGAA GTACTTCAACGGCGATTGGAGCAAGATCAAGAACATCGGCTCCGACACCTTCGAGTTTCTGATCAAGAAGTGCGGCAACAACAGCGCCCACGGCGAGGAAATCTTCAGCGAGAAGCTGAAGAACGCCGAGAAGAAGTGCAAAGAGAACGAGAGCACCGACACCAATATCAACAAGAGCGAGACATCCTGCGACCTGAACGCCACCAACTACATCCGGGGCTGCCAGAGCAAGACCTACGACGGCAAGATCTTCCCCGGCAAGGGCGGCGAGAAGCAGTGGATTTGCAAGGACACCATCATCCACGGCGACACCAACGGCGCCTGCATCCCCCCTCGCACCCAGAACCTGTGCGTGGGCGAGCTGTGGGACAAGTCCTACGGCGGCAGATCCAACATCAAGAACGATACCAAAGAACTGCTGAAAGAGAAGGTCGAC。

(5) Coupling the high purity rVAR2 obtained in step (4) with NHS activated agarose (concentration 4%): the successfully coupled agarose gel was a pL-CSA rVAR2 affinity column; and connecting the liquid storage bottle, the pipeline, the electrode tee joint, the constant flow pump, the chromatographic column, the pipeline, the constant flow pump, the electrode tee joint and the sample or waste liquid collecting bottle to complete the construction of the affinity chromatography purification system.

(6) And (3) separating the chromatographic column obtained in the step 5) of the crude pl-CSA obtained in the step (3), collecting the high-purity pl-CSA, and detecting the concentration of the pl-CSA by a phenol-sulfuric acid method.

Preparation of pl-CSA vaccine and pl-CSA + CBZ-1 vaccine

According to bioinformatics analysis (http:// crdd. osdd. net/raghava/abcpred /) CSPG4 protein (ID: NP-001888.2) B cell dominant epitope, CBZ-1 with higher parameter of B cell dominant epitope is selected, the sequence is shown as SEQ ID No.2 (IVAVDEPTRPIYRFTQ SEQ ID No.2), and the polypeptide is synthesized by chemistry SEQ ID No. 2; and mixing the polypeptide and the purified pl-CSA according to the mass ratio of 1:1-1:10, and completing self-assembly under an ultrasonic condition to obtain pl-CSA + CBZ-1 immunogen particles.

Purified pl-CSA was dispensed as solution pl-CSA immunogen particles. And respectively mixing and emulsifying the obtained pl-CSA immunogen particles, the pl-CSA + CBZ-1 immunogen particles and Freund's complete adjuvant and incomplete adjuvant to prepare the pl-CSA vaccine and the pl-CSA + CBZ-1 vaccine.

EXAMPLE 3 evaluation of immunogenicity and contraceptive Effect of pl-CSA

TABLE 2 pI-CSA vaccine immunization cohort

Immune grouping: female BALB/c mice, 6 weeks old, were randomly divided into 4 groups, and 20 mice (Table 2) per group were fed with 40 additional BALB/c male mice, 10 weeks old, using PBS as a negative control.

② an immunization program: each group of female mice fed and drunk water freely, 2 mice were inoculated with the pl-CSA and pl-CSA + CBZ-1 vaccines for 0, 1 and 2 weeks (0 week was set at the time of purchase) respectively in each cage for 3 times, the first time was mixed with the immunogen with Freund's complete adjuvant, and the second and third times were mixed with the immunogen with Freund's incomplete adjuvant. At the 4 th week, the female mice and the male mice of each group are combined in cages, and whether pregnancy occurs is monitored by adopting B ultrasonic on the 9 th day after the vaginal embolism. If pregnancy is established, i.e. the embryo has been successfully attached, the mice are sacrificed after the 15 th day of pregnancy, the embryo development is observed dissectively, and serum is collected for indirect ELISA to detect antibody levels; if the male mice are not pregnant, 6 oestrus cycles are continuously carried out, all female mice detect the negative embolism, and the female mice are proved to complete the mating. 6 estrus cycle non-pregnant mice were sacrificed and serum was collected for detection of antibody production levels by indirect ELISA.

The contraceptive vaccine Ig1 group used with pl-CSA alone reduced the mouse conception rate to 43%, and the blank group NcIg1 conception rate to 75%; the contraceptive vaccine Ig2 group prepared by assembling pl-CSA and the polypeptide of the B cell dominant antigen epitope CBZ-1(IVAVDEPTRPIYRFTQ) of the core protein thereof reduces the pregnancy rate of mice to 35 percent, and the pregnancy rate of the blank group ncIg2 is 85 percent. The experimental result shows that the pl-CSA immunizing agent and the pl-CSA + CBZ-1 immunizing agent can obviously reduce the pregnancy rate compared with a blank control group, and the pl-CSA + CBZ-1 group has better contraception effect compared with the pl-CSA.

EXAMPLE 4 evaluation of safety of pl-CSA contraceptive vaccines

Acute toxicity test: female BALB/c mice at 6 weeks were randomly divided into 8 groups of 10 mice each and administered intramuscularly; wherein the pl-CSA immunizing agent group 4 comprises a pl-CSA-Tg1 group (100 μ g/body), a pl-CSA-Tg2 group (200 μ g/body), a pl-CSA-Tg3 group (400 μ g/body) and a pl-CSA-Tg4 group (800 μ g/body); the pl-CSA + CBZ-1 immunizing agent 4 groups, including CBZ-1-Tg1 group (100. mu.g/body), CBZ-1-Tg2 group (200. mu.g/body), CBZ-1-Tg3 group (400. mu.g/body), CBZ-1-Tg4 group (800. mu.g/body), were administered in a single dose of 200. mu.L/body, continuously observed at 2w, analyzed for signs change and death.

The experimental result shows that except that 1 mouse in the CBZ-1-Tg4 group died within 10min after injection, the body mass of other mice has no significant difference (figure 6), no obvious abnormality is seen in 2w successive observation after the injection, the 14 th cervical dislocation animal is dissected, and the general anatomy of the heart, the liver, the spleen, the lung, the kidney, the gastrointestinal tract and the brain has no obvious pathological changes (figure 7).

Example 5 evaluation of antibody levels by Indirect ELISA

Antibody levels in the sera of pregnant and non-pregnant mice were measured for the PBS, pl-CSA and pl-CSA + CBZ-1 groups of mice in example 3, respectively.

Respectively diluting purified pl-CSA polysaccharide 2 μ g serving as antigen in 0.05M carbonate to coat in a 96-well plate, and keeping the solution at 200 μ L/well at 4 ℃ overnight; discarding the coating solution, washing with 200 μ L PBST buffer solution for 3 times, each time for 5 min; adding 200 μ L of confining liquid (5% skimmed milk)Dissolving the powder in PBST, pH 7.2), and incubating for 2.5h at 37 ℃; PBST is washed for 3 times, 5min each time; diluting mouse serum to be detected with 1:1000 BSA (dissolved in PBST), incubating at 37 deg.C for 45min and 100 μ L/well; PBST was washed 3 times with 10min 1% BSA each time diluting HRP-labeled goat anti-mouse IgG at 1:10000, 100. mu.L/well, incubated at 37 ℃ for 45 min; discarding the secondary antibody, and thoroughly washing PBST for 5 times, each time for 5 min; adding TMB developing solution 50 μ L/well, developing at room temperature in dark room for 10 min; 2M H was added₂SO₄The reaction was stopped at 50. mu.L/well. OD450 values were read in a microplate reader within 15 min.

The experimental results are shown in fig. 4D and 5C. The experimental results show that the antibody levels after the pl-CSA + CBZ vaccine and the pl-CSA vaccine are obviously increased compared with the blank group, and the antibody levels of the non-pregnant mice in the vaccine group and the blank group are higher than the antibody levels of the pregnant mice, and have obvious difference. The experimental results also confirm that high antibody levels affect embryo engraftment and thus enable successful contraception in mice.

Example 6 tissue HE and immunohistochemical staining

The liver, spleen and kidney of the mouse obtained in example 3 were individually prepared and examined for toxicity by HE staining, and no significant pathological changes were observed.

Tabletting: tissue samples were fixed with 4% neutral paraformaldehyde (Bouin's solution) for no less than 48h, soaked overnight in tap water and sliced: (1) ethanol gradient dehydration: 70% ethanol (2h) → 80% ethanol (2h) → 90% ethanol (30min) → 95% ethanol (30min) → 100% ethanol (30 min). (2) And (3) xylene transparency: 50% ethanol xylene (12min) → 100% xylene (10 min). (3) Wax dipping: 50% xylene wax (2h) → 100% paraffin wax (1 h). (4) Slicing: 5 μm sections were selected in succession. (5) And (3) displaying and fishing pieces: spreading the slide with distilled water at 45 ℃, and cleaning the slide and fishing the slide. (6) Baking slices: placing in an oven at 60 deg.C for 20 min. (7) Dewaxing: 100% xylene (1min) → 100% xylene (1 min). (8) Hydration: 100% ethanol (2min) → 95% ethanol (1min) → 85% ethanol (1min) → 75% ethanol (1min) → natural air-drying (can be stored at-20 ℃ for later use).

HE staining: the paraffin cut prepared above → hematoxylin staining solution (5min) → distilled water running water light wash (5sec) → 1% hydrochloric acid ethanol (3sec) → distilled water running water light wash (15sec) → 0.5% eosin staining (45sec) → distilled water running water light wash (30sec) → 80% ethanol (2sec) → 90% ethanol (2sec) → 95% ethanol (5sec) → carbolic acid xylene (5min) → xylene (1min) → neutral gum sealing (the gum is observed moving after drying), and bubbles are prevented from being generated). The dynamic change of the placenta tissue structure in each gestation period is observed and observed under a microscope, and a picture is taken.

Experimental results referring to fig. 7, HE staining results showed that the tissue sections of the internal organs (including liver, spleen and kidney) of the immunized mice did not significantly change substantially in accordance with the results of the PBS group, demonstrating that the contraceptive vaccine containing pl-CSA is substantially safe to use.

SEQUENCE LISTING

<110> Shenzhen advanced technology research institute of Chinese academy of sciences

<120> placenta chondroitin sulfate A immune composition and application thereof

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 2760

<212> DNA

<213> Artificial sequence

<400> 1

ggatccctgg aaaactacat caagggcgac ccctatttcg ctgagtacgc tacaaaactg 60

agcttcatcc tgaaccccag cgacgccaac aaccccagcg gcgagacagc caaccacaac 120

gacgaggcct gcaactgcaa cgagagcggc atcagcagcg tgggccaggc tcagacatcc 180

ggccctagca gcaacaagac ctgtatcacc cacagctcca tcaagaccaa caagaaaaaa 240

gaatgcaagg acgtgaagct gggcgtgcgg gagaacgaca aggatctgaa gatctgcgtg 300

atcgaggaca ccagcctgag cggcgtggac aactgctgct gccaggatct gctgggcatc 360

ctgcaggaaa actgcagcga caacaagcgg ggcagcagct ccaacgacag ctgcgacaat 420

aagaaccagg acgagtgcca gaaaaagctg gaaaaggtgt tcgccagcct gaccaacggc 480

tacaagtgcg ataagtgcaa gagcggcacc tcccggtcca agaagaagtg gatctggaag 540

aagtccagcg gcaacgagga aggcctgcag gaagagtacg ccaacaccat cggcctgccc 600

cccaggaccc agagcctgta cctgggcaat ctgcccaaac tggaaaacgt gtgcgaggat 660

gtgaaggaca tcaacttcga caccaaagag aagtttctgg ccggctgcct gatcgtgtcc 720

ttccacgagg gcaagaatct gaagaagcgc tacccccaga ataagaacag cggcaacaaa 780

gaaaacctgt gcaaggctct ggaatacagc ttcgccgact acggcgacct gatcaagggc 840

acctccatct gggacaacga gtacacaaag gacctggaac tgaatctgca gaacaacttc 900

ggcaagctgt tcggcaagta catcaagaag aacaataccg ccgagcagga cacctcctac 960

agctccctgg acgagctgcg cgagtcttgg tggaatacca ataagaagta catctggacc 1020

gccatgaagc acggcgccga gatgaacatc accacctgta acgccgacgg ctccgtgacc 1080

ggcagcggct ccagctgcga cgacatcccc accatcgacc tgatccccca gtacctgaga 1140

tttctgcagg aatgggtcga gaacttctgc gagcagcggc aggccaaagt gaaggacgtg 1200

atcaccaact gcaagagctg caaagaatcc ggcaacaaat gcaagaccga gtgcaaaacc 1260

aagtgcaagg atgagtgcga gaagtacaag aagttcatcg aggcctgcgg cacagccggc 1320

ggaggcatcg gaacagccgg cagcccctgg tccaagagat gggaccagat ctacaagcgg 1380

tacagcaagc acatcgagga cgccaagcgg aaccggaagg ccggcaccaa gaactgcggc 1440

accagctcca ccaccaacgc cgctgccagc accgacgaga ataagtgcgt gcagagcgac 1500

atcgacagct ttttcaagca cctgatcgat atcggcctga ccacccccag cagctacctg 1560

agcaacgtgc tggacgacaa catctgtggc gccgacaagg ccccctggac aacctataca 1620

acatacacta caaccgagaa gtgcaacaaa gagcgggaca agagcaagag ccagagcagc 1680

gacaccctgg tggtggtgaa cgtgcccagc cccctgggca acacacccta ccggtacaag 1740

tacgcctgcc agtgcaagat ccccaccaac gaggaaacat gcgacgaccg gaaagaatac 1800

atgaaccagt ggtcctgcgg gagcgctcgg accatgaaga gagggtataa gaacgataac 1860

tacgaactgt gcaagtacaa cggcgtggat gtgaagccca ccaccgtgcg gagcaactcc 1920

agcaagctgg acggcaacga cgtgaccttc ttcaacctgt tcgagcagtg gaacaaagaa 1980

atccagtacc agatcgagca gtacatgacc aacgccaaca tcagctgcat cgatgagaaa 2040

gaagtgctgg acagcgtctc cgacgagggc acccccaaag tgcggggagg ctacgaggac 2100

ggccggaaca acaacacaga tcagggcaca aattgcaaag aaaagtgcaa gtgctacaag 2160

ctgtggatcg agaagatcaa cgatcagtgg ggcaagcaga aggacaacta caacaagttc 2220

cggtccaagc agatctacga cgccaataag ggcagccaga acaaaaaggt ggtgtccctg 2280

agcaacttcc tgttcttcag ctgctgggag gaatacatcc agaagtactt caacggcgat 2340

tggagcaaga tcaagaacat cggctccgac accttcgagt ttctgatcaa gaagtgcggc 2400

aacaacagcg cccacggcga ggaaatcttc agcgagaagc tgaagaacgc cgagaagaag 2460

tgcaaagaga acgagagcac cgacaccaat atcaacaaga gcgagacatc ctgcgacctg 2520

aacgccacca actacatccg gggctgccag agcaagacct acgacggcaa gatcttcccc 2580

ggcaagggcg gcgagaagca gtggatttgc aaggacacca tcatccacgg cgacaccaac 2640

ggcgcctgca tcccccctcg cacccagaac ctgtgcgtgg gcgagctgtg ggacaagtcc 2700

tacggcggca gatccaacat caagaacgat accaaagaac tgctgaaaga gaaggtcgac 2760

<210> 2

<211> 16

<212> PRT

<213> B cell dominant epitope of placental-like chondroitin sulfate A core protein CSPG4

<400> 2

Ile Val Ala Val Asp Glu Pro Thr Arg Pro Ile Tyr Arg Phe Thr Gln

1 5 10 15

Claims (9)

1. An immune composition for contraception, which comprises a placenta trophoblast cell specific expression polysaccharide, wherein the placenta trophoblast cell specific expression polysaccharide is placenta-like chondroitin sulfate A, and the immune composition also comprises an immunopotentiator for inducing the antigen reaction of B cells;

the immunopotentiator is a B cell dominant epitope of placenta-like chondroitin sulfate A core protein CSPG 4;

the B cell dominant epitope of the placenta-like chondroitin sulfate A core protein CSPG4 is shown as a sequence SEQ ID No. 2.

2. The immunological composition for contraception as claimed in claim 1, wherein the mass ratio of placenta trophoblast cells specifically expressing polysaccharide to B cell dominant epitope of placenta-like chondroitin sulfate A core protein CSPG4 is 1-10: 1.

3. a contraceptive vaccine composition according to any one of claims 1 to 2, further comprising an adjuvant.

4. The contraceptive immune composition of claim 3, wherein the adjuvant is selected from the group consisting of Freund's complete adjuvant, Freund's incomplete adjuvant, aluminum, saponin, QuilA, RIBBI adjuvant, dimethyldioctadecylammonium bromide, monophosphoryl lipid A, trehalose dimycolate, trehalose dibehenate, and muramyl dipeptide, poly I: C.

5. A pharmaceutical composition comprising an immunogenic composition according to any one of claims 1 to 4.

6. The pharmaceutical composition of claim 5, wherein the pharmaceutical composition comprises more than one set of separately packaged immunization compositions.

7. The pharmaceutical composition according to claim 5, further comprising other contraceptive and/or pregnancy-arresting active ingredients.

8. Use of the immunological composition of any one of claims 1 to 4 or the pharmaceutical composition of any one of claims 5 to 7 for contraception in human and non-human animals for non-diagnostic and therapeutic purposes.

9. Use of the immunological composition of any one of claims 1 to 4 or the pharmaceutical composition of any one of claims 5 to 7 for the manufacture of a medicament for contraception in human and non-human animals.

Images