CN108567973A - A kind of placenta sample chondroitin sulfate A (CSA) immune composition and application - Google Patents

Abstract

The present invention relates to a kind of placenta sample chondroitin sulfate A (CSA) immune composition and applications, specifically disclose a kind of contraception immune composition, wherein include at least one placental trophoblasts specifically expressing polysaccharide and/or proteantigen, the embryo or placental trophoblasts specifically expressing polysaccharide are selected from placenta sample chondroitin sulfate A (CSA).Also include the B cell dominant antigen epitope of placenta sample chondroitin sulfate A (CSA) core protein CSPG4 in immune composition.Present invention firstly provides pregnancy vaccines for the attached key for planting early stage such a placentation and embryonic development, sensitive period, targets the attached viewpoint planted and execute key cells trophocyte, improves the sensibility and validity of contraception.

Description

A kind of placenta sample chondroitin sulfate A (CSA) immune composition and application

Technical field

The present invention relates to field of biological pharmacy, and in particular to a kind of placenta sample chondroitin sulfate A (CSA) immune composition and application.

Background technology

Currently, a kind of pregnancy vaccine is applied to clinical practice not yet.The target of pregnancy vaccine mainly for hormone or The thin certain components of reproduction, these hormones or usually play key effect with reproduction cell related component in reproductive process, such as By inhibiting reproduction cell to generate (sperm either ovum) or inhibit the function of reproduction cell, and hinder normal pregnancy progress And maintenance^[1].In these components, sperm becomes first pregnancy vaccine target, the Nobel laureate in 1899 Landsteiner and Metnikoff has carried out AsAb research respectively, and injection AsAb can play the effect of contraception Fruit；Subsequent surgeon Morris has applied for the United States Patent (USP) of first anti-sperm pregnancy vaccine in nineteen thirty-seven, although this epidemic disease Seedling can generate reversible contraceptive effect in child-bearing woman, and indefinite side effect hinders its clinical application^[2].Currently, It is used to carry out the research (such as table 1) of pregnancy vaccine there are many hormone and reproduction cell component.

The targeted molecular of the existing research pregnancy vaccine of table 1.

First, target the pregnancy vaccine of hormone molecule and its receptor.Suitable specificity antihormones antibody can block life It is biological to generate having for enough titres with the ripe individual stimulation body of hormone immunity for the enforcement for growing hormone normal function needed for activity The antibody of neutrality, as long as there is enough antibody titers, vaccine inoculation person can keep contraception state^[5].Currently, GnRH is It is verified by many animals, wild animal population is such as controlled by immunocastration, in the clinical trial of people, GnRH is used to extend the No-clay weak interbed phase of postpartum women, while being used for the treatment [3 of male contraception and prostate cancer^,10]。FSH Pregnancy vaccine has carried out I phase clinical trials on male, mainly assesses its immunogenicity and on spermatogenetic influence, But obtained result is unsatisfactory, it is found that it only has very weak immunogenicity, can reduce the quantity and vigor of sperm, but right The other parameters of sperm do not make significant difference^[4].HCG vaccines can prevent maternal gestational identification from terminating early pregnancy, at present I phases and II phase clinical trials are successfully carried out with women, it is found that it is a kind of very promising contraception epidemic disease Seedling^[11,12].Several pregnancy vaccines based on hCG have carried out extensive preclinical phase and the clinical phase is studied, as β is sub- single Position hCG vaccines and carboxy terminal peptide β subunits hCG vaccines^[13-15], these vaccines hinder by neutralizing the rush corpus luteum of hCG and acting on Only or the interference attached plant of peri-implantation embryo, this kind of vaccine are also used to inhibit the excessive secretion of steroid hormone, such as uterus muscle Tumor, polycystic ovary syndrome, mullerianosis and sex premature etc.^[11].But targeting hormone and its receptor class pregnancy vaccine are still So there are the risks of contraceptive failure, and organism endocrine can be caused disorderly, upset ovarian function, unhealthful.

Second, target reproduction cell relevant molecule.The antigen molecule that cell surface usually there will be, these surface antigens are logical Often with specificity in a organized way, immunogenicity is strong, is easy stimulation body and generates corresponding antibody.Oolemma antigen is one of them, This be a kind of acellular composition, specificity extracellular matrix glycoprotein, be covered in female sex cell ovum and peri-implantation Embryonic surface plays a crucial role, it is considered to be very promising during folliculogenesis, fertilization, early embryonic development etc. Candidate pregnancy vaccine^[16].Oolemma pregnancy vaccine may influence Sperm penetration by preventing oolemma by uterus protease hydrolytic Or Embryonic limb bud cell, become a kind of induced abortion vaccine^[8,17].Oolemma pregnancy vaccine needs body is induced to generate very high anti-transparent Band antibody titer could prevent to be fertilized, but excessively high anti-vitellary membrane antibody is generally difficult to maintain, and may cause destroying in overy, Cause primordial follicle premature inactivation, therefore popularization and application are hardly resulted in before solving damage ovary this defect.

There is also the albumen of some specificity for male sex-cell sperm surface, therefore the pregnancy vaccine for targeting sperm may There is very much foreground^[18].Sperm can become autoantigen and alloantigen, and the individual of two kinds of genders can be stimulated to generate antibody, AsAb is prevented fertilization and embryonic development in vivo and in vitro^[7].Different plant species are immunized with sperm or Sperm extract, Including people, body can be stimulated to generate AsAb, so as to cause infertile^[7].Therefore sperm can stimulate body to generate Immune response maintains certain AsAb titre that body can be promoted to keep infertile state.But target sperm Pregnancy vaccine usually because that cannot maintain antibody titers, cannot ensure that preventing all sperms from entering becomes pregnant shape body and cause contraception mistake It loses, while the source of sperm receives serious challenge, these situations hinder the popularization and application of sperm pregnancy vaccine.

【Bibliography】

1.Gupta SK,Shrestha A,Minhas V:Milestones in contraceptive vaccines development and hurdles in their application.Human vaccines& immunotherapeutics 2014,10(4):911-925.

2.Lekhwani S,Vaswani N,Ghalaut VS,Shanker V,Singh R: Immunocontraceptives:How far from realityAdvanced biomedical research2014,3: 247.

3.Barmat LI,Chantilis SJ,Hurst BS,Dickey RP:A randomized prospective trial comparing gonadotropin-releasing hormone(GnRH)antagonist/recombinant follicle-stimulating hormone(rFSH)versus GnRH-agonist/rFSH in women pretreated with oral contraceptives before in vitro fertilization.Fertility and sterility 2005,83(2):321-330.

4.Schally AV,Parlow AF,Carter WH,Saito M,Bowers CY,Arimura A:Studies on the site of action of oral contraceptive steroids.II.Plasma LH and FSH levels after administration of antifertility steroids and LH-releasing hormone(LH-RH).Endocrinology 1970,86(3):530-541.

5.Delves PJ:How far from a hormone-based contraceptive vaccine Journal of reproductive immunology 2004,62(1-2):69-78.

6.Talwar GP,Gupta JC,Rulli SB,Sharma RS,Nand KN,Bandivdekar AH,Atrey N,Singh P:Advances in development of a contraceptive vaccine against human chorionic gonadotropin.Expert opinion on biological therapy 2015,15(8):1183- 1190.

7.Shi J,Yang Z,Wang M,Cheng G,Li D,Wang Y,Zhou Y,Liu X,Xu C:Screening of an antigen target for immunocontraceptives from cross-reactive antigens between human sperm and Ureaplasma urealyticum.Infection and immunity 2007,75 (4):2004-2011.

8.Gupta SK,Gupta N,Suman P,Choudhury S,Prakash K,Gupta T,Sriraman R, Nagendrakumar SB,Srinivasan VA:Zona pellucida-based contraceptive vaccines for human and animal utility.Journal of reproductive immunology 2011,88(2): 240-246.

9.Ferro VA:Current advances in antifertility vaccines for fertility control and noncontraceptive applications.Expert review of vaccines 2002,1 (4):443-452.

10.Perez-Lopez FR:Pituitary repetitive stimulation with GnRH/TRH in women treated with three different oral steroid contraceptives.Acta endocrinologica 1990,122(2):163-167.

11.Talwar GP,Singh OM,Gupta SK,Hasnain SE,Pal R,Majumbar SS,Vrati S, Mukhopadhay A,Srinivasan J,Deshmukh U et al:The HSD-hCG vaccine prevents pregnancy in women:feasibility study of a reversible safe contraceptive vaccine.American journal of reproductive immunology 1997,37(2):153-160.

12.Manning PA:Immunogenicity trial of a contraceptive vaccine based on human chorionic gonadotropin.Vaccine 1986,4(4):271.

13.Stevens VC:Progress in the development of human chorionic gonadotropin antifertility vaccines.American journal of reproductive immunology 1996,35(3):148-155.

14.Saxena HM:Predictions of Immunological Cross-Reactions of C- Terminal Peptide of Human Chorionic Gonadotropin beta-Chain Based Contraceptive Vaccine with Autoantigens.Russian journal of immunology:RJI: official journal of Russian Society of Immunology 1999,4(2):151-158.

15.Zhang FC,Wang N,Liu DM,Jian Y,Chen YZ,Shen XZ,Cao YQ,Wang B: Development of Female Contraceptive Vaccine Through DNA Inoculation of Human Chorionic Gonadotropin Beta Subunit(hCGss).Methods in molecular medicine 2000,29:439-449.

16.Gupta SK,Srivastava N,Choudhury S,Rath A,Sivapurapu N,Gahlay GK, Batra D:Update on zona pellucida glycoproteins based contraceptive vaccine.Journal of reproductive immunology 2004,62(1-2):79-89.

17.Gupta SK,Jethanandani P,Afzalpurkar A,Kaul R,Santhanam R:Prospects of zona pellucida glycoproteins as immunogens for contraceptive vaccine.Human reproduction update 1997,3(4):311-324.

18.Naz RK:Development of genetically engineered human sperm immunocontraceptives.Journal of reproductive immunology 2009,83(1-2):145-150.

Although the research of the vaccine of contraception achieves significant progress in terms of different, there is presently no a kind of contraception epidemic diseases Seedling is applied to clinical practice, and exploitation pregnancy vaccine has been at conceptual phase.Above-mentioned very promising target antigen vaccine is deposited The problem of include：First targeting hormone and its receptor may cause organism endocrine to lack of proper care, and influence body normal function；The Two, targeting reproduction cell may cause tissue damage, and it is infertile that irreversibility occurs；Third target Vaccine molecules cannot generate Enough antibody titers, influence contraceptive effect, cause contraceptive failure.Therefore the research, exploitation of pregnancy vaccine and clinical application tool Hold out broad prospects, there is an urgent need to it is a kind of efficiently, price it is suitable, using it is comfortable, can promote and apply, species selectivity is low keeps away Pregnant vaccine meets the needs of human contraception, exotic animals invasion and unbalance prevention and control of wild animal population.

Invention content

Present invention firstly provides pregnancy vaccine for such a placentation of embryo's attached plant phase and embryonic development key, Sensitive period targets the attached viewpoint planted and execute key cells trophocyte, can improve the sensibility and validity of contraception. B cell dominant antigen epitope group by the pl-CSA of placental trophoblast specific secretion individually or with its core protein CSPG4 Conjunction prepares pregnancy vaccine, and the antigen-reactive of B cell is induced using the B cell dominant antigen epitope of its core protein CSPG4, increases Strong immunization, further increases contraceptive effect, to prepare a kind of safe and effective pregnancy vaccine.

One aspect of the invention provides a kind of contraception immune composition, wherein thin comprising at least one placental trophoblast Born of the same parents' specifically expressing polysaccharide and/or proteantigen.

In the inventive solutions, the embryo or placental trophoblasts specifically expressing polysaccharide are selected from placenta sample Chondroitin sulfate A (CSA).

In the inventive solutions, also include in immune composition in immune composition also include induction B cell Antigen reactive immunopotentiator, the immunopotentiator are selected from the B cell of placenta sample chondroitin sulfate A (CSA) core protein CSPG4 Dominant antigen epitope, it is preferable that the B cell dominant antigen epitope such as sequence of the placenta sample chondroitin sulfate A (CSA) core protein CSPG4 Arrange SEQ ID No.2 or its homologue.

IVAVDEPTRPIYRFTQ SEQ ID No.2

In the inventive solutions, embryo or placental trophoblasts specifically expressing polysaccharide and/or proteantigen with The mass ratio of the B cell dominant antigen epitope of CSPG4 is 1-100：1, preferably 1-10：1.

In the inventive solutions, also include adjuvant in contraception immune composition.

In the inventive solutions, adjuvant be selected from Freund's complete adjuvant, incomplete Freund's adjuvant, aluminium (aluminum phosphate or Aluminium hydroxide), saponin(e, Quil A, RIBBI adjuvants, GERBU Adjuvant 100 (DDA), monophosphoryl lipid A (MPL), Trehalose dimycolate (TDM), two behenate of trehalose (dibehenate) and muramyl dipeptide (MDP), poly- I:C etc..

Another aspect of the invention provides a kind of pharmaceutical composition, wherein containing the immune combination of the present invention Object.

In the inventive solutions, also include other contraceptions and/or interruption of pregnancy in the pharmaceutical composition Active constituent.The active constituent of the contraception and/or interruption of pregnancy can be illustratively Desogestrel ethinyloestradiol, nonylbenzene alcohol Ether bolt, nonoxinol, mifepristone, Levonorgestrel, Levonorgestrel quinestrol.

Another aspect of the invention provides immune composition of the present invention and is preparing the attached plant of prevention embryo in uterus Purposes in the drug of inner membrance.

Another aspect of the invention provides immune composition of the present invention for preventing the attached plant of embryo in intrauterine Purposes in film.

Another aspect of the invention provides immune composition of the present invention in the drug for preparing interruption of pregnancy Purposes.

Another aspect of the invention provides immune composition of the present invention for the purposes in interruption of pregnancy.

Another aspect of the invention provides purposes of the immune composition of the present invention in preparing contraceptive.

Another aspect of the invention provides immune composition of the present invention for the purposes in contraception.

Another aspect of the present invention provides immune composition of the present invention and presses down in the immune mankind and non-human animal The method of the mankind or non-human pregnant processed, the method include to include one or more hairs to animal dosage treatment effective amount The bright immune composition.

In the inventive solutions, the embryo it is attached plant in endometrium, contraception or the object of interruption of pregnancy or Class that subject is a human or inhuman animal, including performing animal and non-performing animal.

In the inventive solutions, the non-human animal is performing animal.Such as, but not limited to, dog, cat, Rat, mouse, ox, horse, sheep, pig, rabbit etc..

In the inventive solutions, the non-human animal is wild animal.Such as, but not limited to, it is wild dynamic Object is dog, cat, rat, mouse, bat, fox, racoon, squirrel, didelphid, wolf, rabbit etc..

Another aspect of the present invention provides placental trophoblasts specifically expressing polysaccharide and/or proteantigen as contraception Or prevent the attached plant of embryo in the purposes of endometrium or the action target spot of interruption of pregnancy, or as screening contraception or prevent embryo Attached plant is in the purposes of endometrium or the drug target of interruption of pregnancy.

In the present invention, can include pharmaceutical acceptable carrier, including but not limited to salt in immune composition or pharmaceutical composition Water, buffered saline, glucose, water, glycerine, ethyl alcohol and combinations thereof.Carrier and immune composition can be sterile, and with to Prescription formula matches.Immune composition or pharmaceutical composition can also common other auxiliary materials in pharmaceutical preparation, such as containing few Measure wetting agent, emulsifier or pH buffer.

The present invention immune composition or pharmaceutical composition can be liquid solution, suspension, lotion, sustained release forms or Pulvis.Any commonly employed pharmaceutical carrier such as sterile saline solution or sesame oil can be used.Medium can also include the medicine of routine With auxiliary substance such as the officinal salt of adjustment osmotic pressure, buffer, preservative.

The immune composition of the present invention or the administering mode of pharmaceutical composition can be by any approach, including but do not limit to In by oral cavity, percutaneous, mucous membrane (for example, vagina, rectum, oral cavity or schneiderian membrane), injection (for example, muscle, subcutaneous, vein It is interior, parenteral, in peritonaeum, intrathecal) or pass through sucking (for example, oral cavity or nose).According to the difference of administering mode, Immune composition or vaccine of the present invention or the auxiliary material in drug and preparation method can be adjusted.

In the present invention, described " attached plant " is identical as " implantation " meaning, refers to that embryonic trophoblasts are gradually sent out with endometrium The contact of raw histology and physiology, makes blastocyst be bonded to endometrium, this physiology course becomes attached plant.

In the present invention, described " pharmaceutical composition " and " immune composition " understand in its broadest sense, for example, immune Composition is the composition that can be triggered an immune response, and pharmaceutical composition is that can play initiation subject's body to be good for expected The composition of Kang Fangxiang development.

Advantageous effect

1, present invention firstly provides pregnancy vaccine for the attached key for planting early stage such a placentation and embryonic development, Sensitive period targets the attached viewpoint planted and execute key cells trophocyte, improves the sensibility and validity of contraception.

2, that the targeting of pl-CSA vaccines is trophocyte, these cells are present in blastaea trophectoderm and placenta, Only have lower cross reactivity with body others normal cell (such as Hypothalamus-Pituitary-Ovaries histocyte), it is not easy to Damage the enforcement of body tissue organ normal function.

3, pl-CSA is macromolecular polysaccharide, and structure is relatively stable, and immunogenicity is strong, and immune animal can generate higher anti- Body titre；Pl-CSA is combined with the B cell dominant antigen epitope of its core protein CSPG4 simultaneously, the anti-of B cell can be induced Original reaction, enhances immunization, to increase contraceptive effect；

4, pl-CSA is easier to obtain, and different plant species source pl-CSA similitudes are higher.Pl- in trophocyte CSA comparision contents are abundant, and pl-CSA contents are also very abundant in discarded pig placenta, and isolating and purifying pl-CSA from pig placenta can To turn waste into wealth.

Description of the drawings

Fig. 1 is pregnancy vaccine fundamental diagram.

Fig. 2 is the Technology Roadmap of the present invention.

Fig. 3 be pl-CSA people, mouse and pig placental trophoblasts expression and with the common location figure of CSPG4.pl- CSA is to carry out fluorescent staining with anti-6 × His monoclonal antibodies that rVAR2 and Dylight650 is marked, and CSPG4 is with rabbit-anti The goat antirabbit secondary antibody of CSPG4 monoclonal antibodies and FITC labels carries out fluorescent staining, and DAPI marks nucleus, and Merge is figure Piece combines, and Human plactnta trophoderm comes from gestation 15d placentas, pig placenta and uterus muscle from childbirth placenta, mouse placental trophoblast Layer comes from gestation 70d placentas and uterus muscle.By total focusing results figure it is found that in the placental trophoblast of the mankind, mouse and pig Pl-CSA and CSPG4 are contained, and is expressed without pl-CSA and CSPG4 in pig uterus muscle.

Fig. 4 is that BABL/c mouse results figures are immunized in pl-CSA.Wherein, A.pl-CSA samples and standard items pop surface sweeping are inhaled Receive consistent wavelength；B. experimental mouse anatomy；C. experimental mouse changes of weight situation；D. experimental mouse antibody level；E. experimental mouse by Pregnant rate.

Fig. 5 is that pl-CSA and its core protein B cell dominant antigen epitope CBZ-1 assembles vaccine immunity BABL/c mouse knots Fruit is schemed.A. experimental mouse changes of weight situation；B. experimental mouse pregnancy rate；C. experimental mouse antibody level.

Fig. 6 is acute toxicity testing mouse changes of weight result figure.

Fig. 7 is immunized mice internal organ (including liver, spleen and kidney) histotomy, HE coloration result figures.

Specific implementation mode

Illustrate certain specific features and/or embodiment with the following example.These embodiments are not construed as The disclosure is limited to described specific features or embodiment.

The expression and positioning of embodiment 1pl-CSA and its core protein CSPG4

This part is carried out by the way of immunofluorescence.First, the childbirth placenta, mouse pregnancy 15d placentas of collector and Pig gestation 70d placenta uterinas, 4% paraformaldehyde are fixed fully；According to the mode film-making of embodiment 5；3%H₂O₂(10min) goes out Endogenous peroxydase living；95 DEG C of water-baths of citrate buffer of pH6.0 keep 10min to carry out antigen retrieval；Rabbit-anti CSPG4 antibody (1:And homemade rVAR2-His-tag (1 200):100) 4 DEG C of overnight incubations of reagent；PBST (contains 0.1% Triton X-100) it embathes 3 times, each 5min；The goat-anti rabbit secondary antibody (1 of FITC labels:1000) it is marked with Dylight650 Anti- 6 × His monoclonal antibodies (1:1000), it is incubated at room temperature 40min；PBST embathes 3 times, each 5min；DAPI redyes core；PBST (X-100 containing 0.1%Triton) embathes 3 times, each 5min → anti-fluorescent quenching mountant mounting, confocal microscope Observation is taken pictures.Experimental result is referring to Fig. 3.It can be seen that in the placental trophoblast of the mankind, mouse and pig from Fig. 3 results and include Pl-CSA and CSPG4, and expressed without pl-CSA and CSPG4 in pig uterus muscle.

The preparation of 2 immunizing agent of embodiment

It prepares and purifies placenta sample chondroitin sulfate A (CSA)：

(1) trophocyte that pig placenta is crushed or continuously cultivates is half mechanically decoupled, obtains histocyte slurries；

(2) the histocyte slurries that step (1) obtains are mixed into (V cell slurries with lysate:Lysate=1 V:10), Contain RNase, DNase I, pancreatin and protease K, the histocyte slurries cracked in lysate；

(3) enzyme in the histocyte slurries inactivation lysate for the cracking for obtaining step (2)；1/4 volume is added Sevag liquid removing proteins, obtain pl-CSA crude products；

(4) BamH is added to the 5 ' ends of Infected With Plasmodium erythrocyte surface antigen VAR2CSA gene order SEQ ID No.1 Sal I restriction enzyme sites are added in I restriction enzyme sites, 3 ' ends；By genetic fragment SEQ ID No.1 and pET28a (+) prokaryotic expression carrier It is connected, converts e. coli bl21 competent cell, carry out prokaryotic expression, Ni is carried out using the ends rVAR2 6 × His labels²⁺Parent And chromatography, obtain the rVAR2 (684.1 μ g/mL) of high-purity.

SEQ ID No.1 are as follows

GGATCCCTGGAAAACTACATCAAGGGCGACCCCTATTTCGCTGAGTACGCTACAAAACTGAGCTTCATCCTGAACCC CAGCGACGCCAACAACCCCAGCGGCGAGACAGCCAACCACAACGACGAGGCCTGCAACTGCAACGAGAGCGGCATCA GCAGCGTGGGCCAGGCTCAGACATCCGGCCCTAGCAGCAACAAGACCTGTATCACCCACAGCTCCATCAAGACCAAC AAGAAAAAAGAATGCAAGGACGTGAAGCTGGGCGTGCGGGAGAACGACAAGGATCTGAAGATCTGCGTGATCGAGGA CACCAGCCTGAGCGGCGTGGACAACTGCTGCTGCCAGGATCTGCTGGGCATCCTGCAGGAAAACTGCAGCGACAACA AGCGGGGCAGCAGCTCCAACGACAGCTGCGACAATAAGAACCAGGACGAGTGCCAGAAAAAGCTGGAAAAGGTGTTC GCCAGCCTGACCAACGGCTACAAGTGCGATAAGTGCAAGAGCGGCACCTCCCGGTCCAAGAAGAAGTGGATCTGGAA GAAGTCCAGCGGCAACGAGGAAGGCCTGCAGGAAGAGTACGCCAACACCATCGGCCTGCCCCCCAGGACCCAGAGCC TGTACCTGGGCAATCTGCCCAAACTGGAAAACGTGTGCGAGGATGTGAAGGACATCAAC TTCGACACCAAAGAGAAGTTTCTGGCCGGCTGCCTGATCGTGTCCTTCCACGAGGGCAAGAATCTGAAGAAGCGCTA CCCCCAGAATAAGAACAGCGGCAACAAAGAAAACCTGTGCAAGGCTCTGGAATACAGCTTCGCCGACTACGGCGACC TGATCAAGGGCACCTCCATCTGGGACAACGAGTACACAAAGGACCTGGAACTGAATCTGCAGAACAACTTCGGCAAG CTGTTCGGCAAGTACATCAAGAAGAACAATACCGCCGAGCAGGACACCTCCTACAGCTCCCTGGACGAGCTGCGCGA GTCTTGGTGGAATACCAATAAGAAGTACATCTGGACCGCCATGAAGCACGGCGCCGAGATGAACATCACCACCTGTA ACGCCGACGGCTCCGTGACCGGCAGCGGCTCCAGCTGCGACGACATCCCCACCATCGACCTGATCCCCCAGTACCTG AGATTTCTGCAGGAATGGGTCGAGAACTTCTGCGAGCAGCGGCAGGCCAAAGTGAAGGACGTGATCACCAACTGCAA GAGCTGCAAAGAATCCGGCAACAAATGCAAGACCGAGTGCAAAACCAAGTGCAAGGATGAGTGCGAGAAGTACAAGA AGTTCATCGAGGCCTGCGGCACAGCCGGCGGAGGCATCGGAACAGCCGGCAGCCCCTGGTCCAAGAGATGGGACCAG ATCTACAAGCGGTACAGCAAGCACATCGAGGACGCCAAGCGGAACCGGAAGGCCGGCACCAAGAACTGCGGCACCAG CTCCACCACCAACGCCGCTGCCAGCACCGACGAGAATAAGTGCGTGCAGAGCGACATCGACAGCTTTTTCAAGCACC TGATCGATATCGGCCTGACCACCCCCAGCAGCTACCTGAGCAACGTGCTGGACGACAACATCTGTGGCGCCGACAAG GCCCCCTGGACAACCTATACAACATACACTACAACCGAGAAGTGCAACAAAGAGCGGGACAAGAGCAAGAGCCAGAG CAGCGACACCCTGGTGGTGGTGAACGTGCCCAGCCCCCTGGGCAACACACCCTACCGGTACAAGTACGCCTGCCAGT GCAAGATCCCCACCAACGAGGAAACATGCGACGACCGGAAAGAATACATGAACCAGTGGTCCTGCGGGAGCGCTCGG ACCATGAAGAGAGGGTATAAGAACGATAACTACGAACTGTGCAAGTACAACGGCGTGGATGTGAAGCCCACCACCGT GCGGAGCAACTCCAGCAAGCTGGACGGCAACGACGTGACCTTCTTCAACCTGTTCGAGCAGTGGAACAAAGAAATCC AGTACCAGATCGAGCAGTACATGACCAACGCCAACATCAGCTGCATCGATGAGAAAGAAGTGCTGGACAGCGTCTCC GACGAGGGCACCCCCAAAGTGCGGGGAGGCTACGAGGACGGCCGGAACAACAACACAGATCAGGGCACAAATTGCAA AGAAAAGTGCAAGTGCTACAAGCTGTGGATCGAGAAGATCAACGATCAGTGGGGCAAGCAGAAGGACAACTACAACA AGTTCCGGTCCAAGCAGATCTACGACGCCAATAAGGGCAGCCAGAACAAAAAGGTGGTGTCCCTGAGCAACTTCCTG TTCTTCAGCTGCTGGGAGGAATACATCCAGAAGTACTTCAACGGCGATTGGAGCAAGATCAAGAACATCGGCTCCGA CACCTTCGAGTTTCTGATCAAGAAGTGCGGCAACAACAGCGCCCACGGCGAGGAAATCTTCAGCGAGAAGCTGAAGA ACGCCGAGAAGAAGTGCAAAGAGAACGAGAGCACCGACACCAATATCAACAAGAGCGAGACATCCTGCGACCTGAAC GCCACCAACTACATCCGGGGCTGCCAGAGCAAGACCTACGACGGCAAGATCTTCCCCGGCAAGGGCGGCGAGAAGCA GTGGATTTGCAAGGACACCATCATCCACGGCGACACCAACGGCGCCTGCATCCCCCCTCGCACCCAGAACCTGTGCG TGGGCGAGCTGTGGGACAAGTCCTACGGCGGCAGATCCAACATCAAGAACGATACCAAAGAACTGCTGAAAGAGAAG GTCGAC。

(5) rVAR2 and the NHS activated agarose (concentration 4%) of the high-purity obtained in step (4) are coupled：Success is even The Ago-Gel of connection had both been the rVAR2 affinity columns of pl-CSA；Connect liquid storage bottle, pipeline, electrode threeway, constant flow pump, layer Column, pipeline, constant flow pump, electrode two-way, sample or waste collection bottle are analysed, the establishment of affinitive layer purification system is completed.

(6) the pl-CSA crude Steps 5 that will be obtained in step (3)) obtained by chromatographic column detach, collect high-purity Pl-CSA detects pl-CSA concentration with Phenol sulfuric acid procedure.

Prepare pl-CSA vaccines and pl-CSA+CBZ-1 vaccines

According to bioinformatic analysis (http://crdd.osdd.net/raghava/abcpred/) CSPG4 albumen (ID：NP_001888.2) B cell dominant antigen epitope, the CBZ-1 of the higher B cell dominant antigen epitope of selection parameter, sequence is such as (IVAVDEPTRPIYRFTQ SEQ ID No.2), chemically synthesized polypeptide SEQ ID No.2 shown in SEQ ID No.2；By polypeptide With the pl-CSA in mass ratio 1 of purifying:1-1:10 mixing, ultrasound condition complete self assembly, obtain pl-CSA+CBZ-1 immunogenes Particle.

The pl-CSA of purifying is configured to solution pl-CSA immunogene particles.By obtained pl-CSA immunogenes particle and Pl-CSA+CBZ-1 immunogenes particle is mixed with Freund's complete adjuvant and Freund's incomplete adjuvant, is emulsified respectively, prepares pl-CSA vaccines With pl-CSA+CBZ-1 vaccines.

The immunogenicity and contraceptive effect of embodiment 3pl-CSA is evaluated

Table 2.pl-CSA vaccine immunities are grouped

1. immune grouping：6 week old female BAl BIcs/c mouse, are randomly divided into 4 groups, using PBS as negative control, every group 20 (table 2) in addition raises 40 10 week old BALB/c hero mouse.

2. immune programme：Each group female mice is freely eaten and drinking-water, per 2, cage, is inoculated with pl-CSA and pl-CSA+ The time of CBZ-1 vaccines is respectively 0,1,2 week (being set as when buying 0 week), is immunized 3 times, is helped completely using Freund for the first time altogether Agent is mixed with immunogene, second and third time is mixed using incomplete Freund's adjuvant with immunogene.Start within 4th week by each group female mice with Male mouse mates, and monitors whether to be pregnant using B ultrasound within the 9th day after finding cloudy bolt.If pregnancy, i.e., embryo is attached plants successfully, then exists Gestation put to death mouse after the 15th day, and embryonic development is dissected and observed, and collected serum, and antibody level is detected for indirect ELISA；Such as Fruit is not pregnant, and continuous 6 oestrous cycles mate with male mouse, and all female mices are to detect cloudy bolt, it was demonstrated that all female mices are complete Conclusion of the business is matched.6 oestrous cycle non-pregnant mouses are put to death, serum is collected, the generation for indirect ELISA detection antibody is horizontal.

Mouse pregnancy rate is reduced to 43% with the pl-CSA pregnancy vaccine Ig1 groups being used alone, blank group NcIg1 becomes pregnant Rate is 75%；It is assembled with pl-CSA and its core protein B cell dominant antigen epitope CBZ-1 (IVAVDEPTRPIYRFTQ) polypeptide Mouse pregnancy rate is reduced to 35% by the pregnancy vaccine Ig2 groups of preparation, and blank group ncIg2 pregnancy rates are 85%.Experimental result is aobvious Show, pl-CSA immunizing agents compare blank control group with pl-CSA+CBZ-1 immunizing agents and can significantly reduce pregnancy rate, and pl-CSA+ Contraceptive effect of the CBZ-1 groups compared to pl-CSA is more preferably.

The safety evaluatio of embodiment 4pl-CSA pregnancy vaccines

Acute toxicity testing：6 weeks female BAl BIcs/c mouse are randomly divided into 8 groups, every group 10, take intramuscular injection to Medicine；Wherein 4 groups of pl-CSA immunizing agents, including pl-CSA-Tg1 groups (100 μ g/ are only), pl-CSA-Tg2 groups (200 μ g/ are only), pl- CSA-Tg3 groups (400 μ g/ are only), pl-CSA-Tg4 groups (800 μ g/ are only)；4 groups of pl-CSA+CBZ-1 immunizing agents, including CBZ-1- Tg1 groups (100 μ g/ are only), CBZ-1-Tg2 groups (200 μ g/ are only), CBZ-1-Tg3 groups (400 μ g/ are only), CBZ-1-Tg4 groups (800 μ G/ is only), only, 2w, the variation of analysis sign and death condition is observed continuously in 200 μ L/ of single-dose.

Experimental result shows, except after 1 mouse drug administration by injection of CBZ-1-Tg4 groups in 10min it is dead in addition to, remaining mouse constitution There was no significant difference (Fig. 6) for amount, and 2w is continuously seen after administration, is showed no obvious abnormalities, the de- neck execution animal dissects of 14d, the heart, Liver, spleen, lung, kidney, gastrointestinal tract, brain gross anatomy are without apparent pathological change (Fig. 7).

5 indirect ELISA of embodiment evaluates antibody level

For PBS groups, pl-CSA groups and the pl-CSA+CBZ-1 group mouse in embodiment 3, detect respectively pregnant mouse with The Serum Antibody of unpregnancy mouse is horizontal.

It is diluted in 0.05M carbonate as antigen using 2 μ g of pl-CSA polysaccharide after purification respectively and is coated in 96 orifice plates, 200 μ L/well, 4 DEG C overnight；Discard coating buffer, 200 μ L PBST buffer solution for cleaning 3 times, every time 5 minutes；200 μ L confining liquids are added (5% skimmed milk power is dissolved in PBST, pH=7.2), is incubated 2.5h by 37 DEG C；PBST is cleaned 3 times, each 5min；1%BSA (is dissolved in PBST 1) is pressed:1000 dilution mouse serum to be checked, 100 μ L/well, 37 DEG C of incubation 45min；PBST cleanings 3 times, every time 10min1%BSA presses 1:10000 dilution HRP mark sheep anti-mouse igg, 100 μ L/well, 37 DEG C of incubation 45min；Secondary antibody is discarded, PBST thoroughly cleaning 5 times, each 5min；It is added 50 μ L/well of TMB developing solutions, room temperature, develop the color in darkroom 10min；2M is added H₂SO₄50 μ L/well terminate reaction.OD450 numerical value is read in 15min in microplate reader.

Experimental result is referring to Fig. 4 D and Fig. 5 C.Experimental result explanation resists after giving pl-CSA+CBZ vaccines and pl-CSA vaccines Body level significantly rises compared to blank group, regardless of give vaccine group or in blank group unpregnancy mouse antibody Level is above the antibody level of pregnant mouse, and there is significant difference.Experimental result also demonstrates, the level of high antibody It affects the attached plant of embryo and then mouse is enable successfully to practise contraception.

Embodiment 6 organizes HE and immunohistochemical staining

Liver, spleen and kidney is taken film-making and to observe each organ respectively by HE dyeing and be the mouse that embodiment 3 obtains No toxic reaction, without apparent pathological change.

Film-making：Tissue sample is fixed through 4% neutral paraformaldehyde (Bouin's liquid) is no less than 48h, flowing water in tap water Slice is made after embathing overnight：(1) Gradient elution using ethanol：70% ethyl alcohol (2h) → 80% ethyl alcohol (2h) → 90% ethyl alcohol (30min) → 95% ethyl alcohol (30min) → 100% ethyl alcohol (30min) → 100% ethyl alcohol (30min).(2) dimethylbenzene is transparent： 50% dimethylamino ethanol benzene (12min) → 100% dimethylbenzene (10min) → 100% dimethylbenzene (10min).(3) waxdip：50% 2 Toluene paraffin (2h) → 100% paraffin (1h) → 100% paraffin (1h).(4) it is sliced：5 μm are reelected slice.(5) exhibition piece and fishing piece： 45 DEG C of distilled water open up piece, and clean glass slide drags for piece.(6) piece is baked：60 DEG C of ovens place 20min.(7) it dewaxes：100% dimethylbenzene (1min) → 100% dimethylbenzene (1min).(8) aquation：100% ethyl alcohol (2min) → 95% ethyl alcohol (1min) → 85% ethyl alcohol (1min) → 75% ethyl alcohol (1min) → nature airing (can -20 DEG C save backup).

HE is dyed：The paraffin section of above-mentioned formulation → hematoxylin dyeing liquor (5min) → distilled water flowing water fine laundering (5sec) → 1% acidic alcohol (3sec) → distilled water flowing water rinses the Yihong (15sec) → 0.5% liquid and dyes (45sec) → distilled water flowing water Rinse (30sec) → 80% ethyl alcohol (2sec) → 90% ethyl alcohol (2sec) → 95% ethyl alcohol (5sec) → carbolic acid dimethylbenzene (just mobile observation after natural gum is dry, avoids generating (5min) → dimethylbenzene (1min) → dimethylbenzene (1min) → neutral gum sealing Bubble).Microscopically observation observes placenta tissue structure in the dynamic change of each gestational age, takes pictures.

For experimental result referring to attached drawing 7, HE coloration results show that immunized mice internal organ (including liver, spleen and kidney) histotomy has no It substantially change almost the same with PBS group results, it was demonstrated that the pregnancy vaccine comprising pl-CSA uses basic security.

SEQUENCE LISTING

<110>Shenzhen Institutes of Advanced Technology, Chinese Academy of Science

<120>A kind of placenta sample chondroitin sulfate A (CSA) immune composition and application

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 2760

<212> DNA

<213>Artificial sequence

<400> 1

ggatccctgg aaaactacat caagggcgac ccctatttcg ctgagtacgc tacaaaactg 60

agcttcatcc tgaaccccag cgacgccaac aaccccagcg gcgagacagc caaccacaac 120

gacgaggcct gcaactgcaa cgagagcggc atcagcagcg tgggccaggc tcagacatcc 180

ggccctagca gcaacaagac ctgtatcacc cacagctcca tcaagaccaa caagaaaaaa 240

gaatgcaagg acgtgaagct gggcgtgcgg gagaacgaca aggatctgaa gatctgcgtg 300

atcgaggaca ccagcctgag cggcgtggac aactgctgct gccaggatct gctgggcatc 360

ctgcaggaaa actgcagcga caacaagcgg ggcagcagct ccaacgacag ctgcgacaat 420

aagaaccagg acgagtgcca gaaaaagctg gaaaaggtgt tcgccagcct gaccaacggc 480

tacaagtgcg ataagtgcaa gagcggcacc tcccggtcca agaagaagtg gatctggaag 540

aagtccagcg gcaacgagga aggcctgcag gaagagtacg ccaacaccat cggcctgccc 600

cccaggaccc agagcctgta cctgggcaat ctgcccaaac tggaaaacgt gtgcgaggat 660

gtgaaggaca tcaacttcga caccaaagag aagtttctgg ccggctgcct gatcgtgtcc 720

ttccacgagg gcaagaatct gaagaagcgc tacccccaga ataagaacag cggcaacaaa 780

gaaaacctgt gcaaggctct ggaatacagc ttcgccgact acggcgacct gatcaagggc 840

acctccatct gggacaacga gtacacaaag gacctggaac tgaatctgca gaacaacttc 900

ggcaagctgt tcggcaagta catcaagaag aacaataccg ccgagcagga cacctcctac 960

agctccctgg acgagctgcg cgagtcttgg tggaatacca ataagaagta catctggacc 1020

gccatgaagc acggcgccga gatgaacatc accacctgta acgccgacgg ctccgtgacc 1080

ggcagcggct ccagctgcga cgacatcccc accatcgacc tgatccccca gtacctgaga 1140

tttctgcagg aatgggtcga gaacttctgc gagcagcggc aggccaaagt gaaggacgtg 1200

atcaccaact gcaagagctg caaagaatcc ggcaacaaat gcaagaccga gtgcaaaacc 1260

aagtgcaagg atgagtgcga gaagtacaag aagttcatcg aggcctgcgg cacagccggc 1320

ggaggcatcg gaacagccgg cagcccctgg tccaagagat gggaccagat ctacaagcgg 1380

tacagcaagc acatcgagga cgccaagcgg aaccggaagg ccggcaccaa gaactgcggc 1440

accagctcca ccaccaacgc cgctgccagc accgacgaga ataagtgcgt gcagagcgac 1500

atcgacagct ttttcaagca cctgatcgat atcggcctga ccacccccag cagctacctg 1560

agcaacgtgc tggacgacaa catctgtggc gccgacaagg ccccctggac aacctataca 1620

acatacacta caaccgagaa gtgcaacaaa gagcgggaca agagcaagag ccagagcagc 1680

gacaccctgg tggtggtgaa cgtgcccagc cccctgggca acacacccta ccggtacaag 1740

tacgcctgcc agtgcaagat ccccaccaac gaggaaacat gcgacgaccg gaaagaatac 1800

atgaaccagt ggtcctgcgg gagcgctcgg accatgaaga gagggtataa gaacgataac 1860

tacgaactgt gcaagtacaa cggcgtggat gtgaagccca ccaccgtgcg gagcaactcc 1920

agcaagctgg acggcaacga cgtgaccttc ttcaacctgt tcgagcagtg gaacaaagaa 1980

atccagtacc agatcgagca gtacatgacc aacgccaaca tcagctgcat cgatgagaaa 2040

gaagtgctgg acagcgtctc cgacgagggc acccccaaag tgcggggagg ctacgaggac 2100

ggccggaaca acaacacaga tcagggcaca aattgcaaag aaaagtgcaa gtgctacaag 2160

ctgtggatcg agaagatcaa cgatcagtgg ggcaagcaga aggacaacta caacaagttc 2220

cggtccaagc agatctacga cgccaataag ggcagccaga acaaaaaggt ggtgtccctg 2280

agcaacttcc tgttcttcag ctgctgggag gaatacatcc agaagtactt caacggcgat 2340

tggagcaaga tcaagaacat cggctccgac accttcgagt ttctgatcaa gaagtgcggc 2400

aacaacagcg cccacggcga ggaaatcttc agcgagaagc tgaagaacgc cgagaagaag 2460

tgcaaagaga acgagagcac cgacaccaat atcaacaaga gcgagacatc ctgcgacctg 2520

aacgccacca actacatccg gggctgccag agcaagacct acgacggcaa gatcttcccc 2580

ggcaagggcg gcgagaagca gtggatttgc aaggacacca tcatccacgg cgacaccaac 2640

ggcgcctgca tcccccctcg cacccagaac ctgtgcgtgg gcgagctgtg ggacaagtcc 2700

tacggcggca gatccaacat caagaacgat accaaagaac tgctgaaaga gaaggtcgac 2760

<210> 2

<211> 16

<212> PRT

<213>The B cell dominant antigen epitope of placenta sample chondroitin sulfate A (CSA) core protein CSPG4

<400> 2

Ile Val Ala Val Asp Glu Pro Thr Arg Pro Ile Tyr Arg Phe Thr Gln

1 5 10 15

Claims (10)

1. a kind of contraception immune composition, wherein including at least one placental trophoblasts specifically expressing polysaccharide and/or egg Bai Kangyuan.

2. contraception immune composition according to claim 1, the embryo or placental trophoblasts specifically expressing Polysaccharide is selected from placenta sample chondroitin sulfate A (CSA).

3. also including induction B cell according to claim 1-2 any one of them contraception immune compositions, in immune composition Antigen reactive immunopotentiator, it is preferable that the immunopotentiator be selected from placenta sample chondroitin sulfate A (CSA) core protein The B cell dominant antigen epitope of CSPG4, it is highly preferred that the B cell of the placenta sample chondroitin sulfate A (CSA) core protein CSPG4 is excellent Gesture epitope such as sequence SEQ ID No.2 or its homologue.

4. contraception immune composition according to claim 3, embryo or placental trophoblasts specifically expressing polysaccharide and/ Or the mass ratio of the B cell dominant antigen epitope of proteantigen and CSPG4 is 1-100：1, preferably 1-10：1.

5. according to claim 1-4 any one of them contraception in immune composition contraception immune composition also include assistant Agent；Preferably, adjuvant is selected from Freund's complete adjuvant, incomplete Freund's adjuvant, aluminium (aluminum phosphate or aluminium hydroxide), saponin(e, Quil A, RIBBI adjuvants, GERBU Adjuvant 100 (DDA), monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), two behenate of trehalose (dibehenate) and muramyl dipeptide (MDP), poly- I:C.

6. a kind of pharmaceutical composition, wherein the one or more immune compositions of claim 1-5 any one of them are contained, it is excellent Selection of land contains the immune composition of one group or more independent packaging in pharmaceutical composition.

Also include other contraceptions and/or interruption of pregnancy 7. pharmaceutical composition according to claim 6, in pharmaceutical composition Active constituent.

8. placental trophoblasts specifically expressing polysaccharide and/or proteantigen as contraception or prevent the attached plant of embryo in endometrium Or the purposes of the action target spot of interruption of pregnancy, or as screening contraception or prevent the attached plant of embryo in endometrium or interruption of pregnancy Drug target purposes.

9. claim 1-5 any one of them immune composition or claim 6-7 any one of them pharmaceutical compositions exist Purposes of the attached plant of embryo in endometrium or interruption of pregnancy is practised contraception or prevents for the mankind and non-human animal, preferably Ground, the purposes are used for non-diagnostic and therapeutic purposes.

10. claim 1-5 any one of them immune composition or claim 6-7 any one of them pharmaceutical compositions exist It prepares for the mankind and non-human animal's contraceptive or prevents the attached plant of embryo in the drug of endometrium or the medicine of interruption of pregnancy Purposes in object or immune formulation.