CN108559754A - A kind of recombinant protein of porcine reproductive and respiratory syndrome virus GP5 genetic modifications and its application - Google Patents

A kind of recombinant protein of porcine reproductive and respiratory syndrome virus GP5 genetic modifications and its application Download PDF

Info

Publication number
CN108559754A
CN108559754A CN201810147635.2A CN201810147635A CN108559754A CN 108559754 A CN108559754 A CN 108559754A CN 201810147635 A CN201810147635 A CN 201810147635A CN 108559754 A CN108559754 A CN 108559754A
Authority
CN
China
Prior art keywords
recombinant
respiratory syndrome
porcine reproductive
prrsv
syndrome virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810147635.2A
Other languages
Chinese (zh)
Other versions
CN108559754B (en
Inventor
姜平
侯贺飞
白娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201810147635.2A priority Critical patent/CN108559754B/en
Publication of CN108559754A publication Critical patent/CN108559754A/en
Application granted granted Critical
Publication of CN108559754B publication Critical patent/CN108559754B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Analytical Chemistry (AREA)
  • Epidemiology (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention discloses recombinant protein and its application of a kind of porcine reproductive and respiratory syndrome virus GP5 genetic modifications, the porcine reproductive and respiratory syndrome virus GP5 protein coding genes of codon optimization are any one of following (1)~(3) DNA moleculars：(1) DNA molecular shown in SEQ ID NO.3 in sequence table；(2) hybridize under strict conditions with the DNA sequence dna that (1) limits and encode the DNA molecular of porcine reproductive and respiratory syndrome virus GP5 albumen；(3) DNA sequence dna limited with (1) at least DNA molecular with 90% homology and coding porcine reproductive and respiratory syndrome virus GP5 albumen.First passage of the present invention deletes transmembrane region genetic fragment and Escherichia coli inclined preferendum codon genetic modification, synthetic gene segment, constructs prokaryotic expression carrier, successfully obtains the GP5 recombinant proteins of high efficient expression, rabbit body immunity test proves that the albumen has preferable immunological characteristic.

Description

A kind of recombinant protein of porcine reproductive and respiratory syndrome virus GP5 genetic modifications and its Using
Technical field
The invention belongs to animal medicine technical fields, and in particular to a kind of porcine reproductive and respiratory syndrome virus GP5 genes The recombinant protein of modification and its application.
Background technology
Porcine reproductive and respiratory syndrome (porcine reproductive and respiratory syndrome, PRRS it is) that pregnant sow premature labor, miscarriage, production stillborn foetus, the mummification of fetus and the dyspneic infection of piglet are caused caused by PRRSV Disease.This disease is broken out in the U.S. earliest, is at present world-wide prevalence, huge economic loss is caused to global pig breeding industry.
PRRSV belongs to Arteriviridae, is single strand plus RNA virus, Genome Size is about 15kb, can according to genotype It is divided into Europe class using LV strains as representative and using VR2332 as the american type of representative, China's Major Epidemic strain is american type. PRRSV has the open reading frame of 9 non-segmented negatives, encodes a variety of non-structural proteins and 8 structural proteins, wherein GP5 and M albumen It is the major structural protein of virus, GP5 albumen is also known as E protein, is encoded by ORF5, is a kind of transmembrane glycoprotein, is located at virus It is glycosylated envelope protein on the coating of particle.GP5 albumen has preferable immunogenicity, can induce and generates neutralizing antibody, The infectivity of virus can be neutralized in vitro, and for animal body after neutralizing antibody appearance, antiserum mainly identifies GP5 albumen.
This research is by highly pathogenic PRRSV BB0907 strains, in characteristics such as analysis GP5 antigenicities, signal peptide and transmembrane regions On the basis of, first passage deletes transmembrane region genetic fragment and Escherichia coli inclined preferendum codon genetic modification, synthetic gene Segment constructs prokaryotic expression carrier, successfully obtains the GP5 recombinant proteins of high efficient expression, and rabbit body immunity test proves, the albumen With preferable immunological characteristic.Indirect ELISA antibody detection method is successfully established for PRRSV antibody tests, this method specificity It is 91.567% with IDEXX companies PRRSV ELISA antibody assay kit coincidence rates with sensibility up to 90% or more, tool There is important application foreground.
Invention content
The purpose of the present invention is to provide a kind of porcine reproductive and respiratory syndrome virus GP5 encoding histones of codon optimization Gene and its application.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of porcine reproductive and respiratory syndrome virus GP5 protein coding genes of codon optimization are following (1)~(3) Any one of DNA molecular：
(1) DNA molecular shown in SEQ ID NO.3 in sequence table；
(2) hybridize under strict conditions with the DNA sequence dna that (1) limits and encode porcine reproductive and respiratory syndrome virus GP5 The DNA molecular of albumen；
(3) DNA sequence dna limited with (1) is at least with 90%, at least with 95%, at least with 96%, at least have 97%, at least with the 98% or at least DNA with 99% homology and coding porcine reproductive and respiratory syndrome virus GP5 albumen Molecule.
Recombinant vector, expression cassette, transgenic cell line containing above-mentioned encoding gene or recombinant bacterium.
Above-mentioned recombinant vector is that the encoding gene is inserted into the carrier that prokaryotic expression carrier obtains；The prokaryotic expression Carrier is specially colibacillus expression plasmid pET-28a (+).
Above-mentioned recombinant bacterium is that the recombinant vector is imported the recombinant bacterium obtained in purpose bacterium, and the purpose bacterium is specially big Enterobacteria；The Escherichia coli are specially further e. coli bl21.
Above-mentioned encoding gene or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium is preparing GP5 recombinations Application in albumen.
A method of GP5 recombinant proteins are prepared, for the above-mentioned recombinant bacterium that ferments, tunning is collected and is purified, Obtain GP5 recombinant proteins.
Adopt the GP5 recombinant proteins prepared with the aforedescribed process.
GP5 recombinant proteins prepared by the above method are preparing porcine reproductive and respiratory syndrome virus vaccine or are establishing PRRSV Application in GP5 indirect ELISA antibody assay kits.
A kind of porcine reproductive and respiratory syndrome virus vaccine or PRRSV GP5 indirect ELISA antibody assay kits, including GP5 recombinant proteins prepared by the above method.
A kind of PRRSV GP5 indirect ELISA antibody detection methods, the GP5 prepared with the antigen coat liquid dilution above method Recombinant protein, peridium concentration are 10 μ g/mL, and 37 DEG C/2h+4 DEG C overnight (37 DEG C of coating 2h, then stay overnight for 4 DEG C)；5% skimmed milk 37 DEG C of closing 1h；It is added 1:100 times of diluted serum to be checked, concurrently set PRRSV negative serums and positive serum (1:100), 37 DEG C of reaction 1h；With HRP-SPA (1:15000) it is secondary antibody, 37 DEG C of effect 45min, using TMB as chromogenic substrate progress routine ELISA is detected, and calculates S/P values, i.e. S/P=(sample measure that hole OD450nm values-negative control hole be averaged OD450nm values)/(positive The property control wells OD450nm values-negative control hole that is averaged is averaged OD450nm values)；It is judged to the positive, S/P as S/P >=0.383< It is feminine gender when 0.347, is judged to when between 0.347 and 0.383 suspicious.
Beneficial effects of the present invention：
Porcine reproductive and respiratory syndrome virus (PRRSV) is a kind of important pathogen for influencing world's pig breeding industry, causes gestation Sow premature labor, miscarriage, production stillborn foetus, the mummification of fetus and piglet breathing problem and death, cause huge to global pig breeding industry Economic loss.Currently, the disease antibody test has the methods of ELISA, IFA and IPMA, the antibody assay kit of commercialization main It is PRRSV N protein ELISA antibody assay kits and the totivirus antigen ELISA antibody assay kit of purifying, but cannot For judging Swinery immunity level of protection, can not be used to differentiate infection and immune antiboidy.GP5 is the important immunoprotections of PRRSV Albumen is to develop the important candidate targeted molecular of PRRSV genetic engineering subunit vaccines.The protein gene size is 600bp, coding 200 amino acid, there are two transmembrane regions for tool, prokaryotic expression system cannot be used to obtain effective expression.This research will be highly pathogenic PRRSVBB0907 strains, on the basis of analyzing the characteristics such as GP5 antigenicities, signal peptide and transmembrane region, first passage deletes transmembrane region Genetic fragment and Escherichia coli inclined preferendum codon genetic modification, synthetic gene segment successfully construct high efficient expression The prokaryotic expression carrier pET-28a-GP5/3m of GP5 recombinant proteins.By IPTG induced expression condition optimizings, successfully obtain efficiently The GP5 recombinant proteins of expression.Using inclusion body purification method, purification of recombinant proteins is prepared, breast is mixed using Freund's adjuvant Change prepares vaccine, and rabbit body immunity test proves, which has preferable immunological characteristic.Immune rabbit anteserum PRRSV ELISA antibody Potency is up to 1:51200.Western blot confirm this it is how anti-can occur with the GP5 albumen of PRRSV and baculovirus expression it is special Property reaction, indirect immunofluorescence assay (IFA) confirms PRRSV in the antibody energy specific recognition cell, and can neutralize PRRSV.Indirect ELISA antibody detection method is established using the albumen, best a concentration of 10 μ g/mL of antigen coat, serum Optimum dilution degree is 1:100.With porcine circovirus 2 type (PCV2), swine fever virus (CSFV), Pseudorabies virus (PRV), aftosa The 7 boar cause of disease no cross reactions such as viral (FMDV), encephalomyocarditis virus (EMCV) and haemophilus parasuis (HPS).Relatively IDEXX companies PRRSV ELISA antibody assay kits, this method relative sensitivity and relative specificity are 90.56% He 92.86%, two kinds of coincidence rates are 91.567%.The research devises PRRSV GP5 optimization codon genes and prepares and obtains for the first time Antigenic excellent recombinant protein was obtained, special GP5 protein antibodies are prepared for, there are a variety of serological reaction characteristics, be used in combination In establishing PRRSV GP5ELISA antibody detection methods, there is important application foreground.
Description of the drawings
Fig. 1 is PRRSV GP5 gene prokaryotic MOLECULE DESIGN policy maps
Wherein, A.GP5 protein transmembranes area analyzes：Through TMHMM Server, the analysis of V2.0 softwares, GP5 albumen there are two across Film area.B.GP5 and its new design molecular gene composition.GP5 genes and GP5/3 genes：Corresponding with A figures, red is transmembrane region, Pink is extracellular region, and blue is intracellular region, and GP5/3 is made of extracellular region and intracellular region gene.GP5/3m genes：With GP5/3 Based on, it is optimized by Escherichia coli inclined preferendum codon gene.
Fig. 2 is PRRSV GP5 gene recombination plasmid prokaryotic expression products SDS-PAGE
Wherein, M：Protein Marker；1.pET-28a-GP5/3m；2.pET-28a-GP5/3；3.pET-28a-GP5；
Fig. 3 is that PRRSV GP5 prokaryotic expression products SDS-PAGE (left side) and Western Blot (right side) are identified
Wherein, M：Protein Marker；1. the precipitation of induced expression cellular lysate product；2. induced expression cellular lysate produces The centrifugation supernatant object of object；3. purifying inclusion body destination protein
Fig. 4 is the specificity that Western blot detect rabbit anti-serum
Wherein, M：Protein Marker；1：Baculovirus expression GP5 albumen；2：Sf9 blank controls；3：Purifying PRRSV；4：MARC-145 cell controls；
Fig. 5 is the PRRSV (× 200) that rabbit anti-serum IFA detects Marc145 cell infections
Wherein, A~C：1:10 diluted GP5m antiserums；B：1:50 diluted GP5m antiserums；C：1:100 times diluted GP5m antiserums；D：PRRSV N protein monoclonal antibody positive controls；E：Rabbit negative serum control
Specific implementation mode
One, materials and methods
1. plasmid, bacterial strain, virus
PET-28a (+), e. coli bl21, Marc-145 cells, PRRSV BB0907 (GenBank accession number: HQ315835) strain is preserved by this laboratory.GP5 monoclonal antibodies are by China Agriculture Academe Shanghai Veterinary Institute teacher Tong Guangzhi It give, HRP labels goat anti-mouse IgG, HRP label goat anti-rabbit IgG antibodies are purchased from green skies company, limit restriction endonuclease EcoR I and Xho I are purchased from TaKaRa companies, and Supersignal West Pico hypersensitive ECL chemical luminescence reagent kits are purchased from Pierce companies, other reagents are that domestic analysis is pure.
2. structure and the identification of target gene recombinant plasmid
PRRSV BB0907 strain GP5 gene orders are searched from NCBI, using TMHMM Server, v.2.0 website is soft Part analyzes the protein transmembrane area (Figure 1A), and after the gene order of transmembrane region is deleted, rest segment is connected by AAA amino acid, closes It is Escherichia coli inclined preferendum codon gene at acquisition GP5/3 genetic fragments, then to its codon optimization, synthesis obtains GP5/3m Genetic fragment (Figure 1B).Using PCR method by two restriction enzyme sites of EcoR I and XhoI, target gene fragment is cloned respectively To colibacillus expression plasmid pET-28a (+), structure obtains recombinant plasmid pET-28a-GP5, pET-28a-GP5/3 and pET- 28a-GP5/3m carries out target gene sequencing, it was demonstrated that objective gene sequence is correct by Jin Sirui Bioisystech Co., Ltd.
3. recombinant protein IPTG induced expressions and purifying
Recombinant plasmid pET-28a-GP5, pET-28a-GP5/3 and pET-28a-GP5/3m are converted respectively to Escherichia coli BL21 is applied on the LB tablets containing kanamycins, selects single bacterium colony, cultivated in LB nutrient solutions, adds final concentration of 1mM IPTG induces 4h in 37 DEG C, by bacterium sample in 4 DEG C, 12 000rmin-110min is centrifuged, precipitation is collected, thalline is resuspended with PBS, surpasses After sound cracking, SDS-PAGE, omparison purpose protein expression effect are carried out.PET-28a-GP5/3m Escherichia coli induced expressions are taken to produce Object centrifuges after ultrasound cracking, collects precipitation.It is carried out by inclusion body protein purification process, prepares the destination protein of purifying.It adopts It is identified with Western blot methods.
4.SDS-PAGE and Western blot
It carries out according to a conventional method.12% (w/v, g/100ml) polyacrylamide gel is prepared, SDS-PAGE electrophoresis is carried out, Albumen is transferred to NC films after electrophoresis, NC films are put into PBST (the 10mM Na containing 10% (w/v, g/100ml) skimmed milk2HPO4、 2mM KH2PO4, 137mMNaCL, 2.7mM KCL, 0.5% (v/v) Tween-20) in confining liquid, 4 DEG C of closings are overnight.It is washed with PBST Wash 3 times, then with GP5 monoclonal antibodies (1：1000 dilutions) incubation at room temperature 2h, NC films are washed 5 times with PBST.1 is pressed with PBST:1000 is dilute Secondary antibody (sheep anti mouse lgG-HRP) is released, (25 DEG C) effect 1h of room temperature will be equal after ECL luminescent solutions (A liquid, B liquid) equivalent mixing after washing It is even to be applied on NC films, it is placed in exposure instrument and carries out graded exposure and preserve photo.
5. recombinant protein immunological characteristic measures
Using purifying protein GP5/3m, a concentration of 2mg/mL, with isometric Freund's adjuvant mixing and emulsifying.Take 1.5Kg bodies Weight rabbit 2, skin of back multiple intradermal injections, accumulated dose are 1mL/, are spaced 3 weeks booster immunizations.First immunisation Freund Freund's complete adjuvant, the 2nd and the 3rd immune incomplete Freund's adjuvant.3 weeks ear edge vein exploitating bloods after immune, with purifying PRRSV antigens Indirect ELISA method detects antibody titer.When antibody titer reaches 1:10000 or more, rabbit heart blood is acquired, through 5000r min-110min is centrifuged, collects serum, -20 DEG C of preservations, and carry out following identification.
5.1 indirect ELISA antibody titers measure
The PRRSV BB0907 virus liquids of purifying 0.05mol/L sodium carbonate-bicarbonates buffer solution (pH9.6) is diluted To 2mg/mL coated elisa plates, 100 holes μ L/, 37 DEG C of incubation 2h are closed with 5% skimmed milk, and the rabbit that 2 doubling dilutions are added is mostly anti- Serum is compared with negative rabbit anteserum, and secondary antibody is 1:250 diluted HRP mark goat anti-rabbit igg, TMB colour developings, microplate reader to read Take OD450nmAbsorbance value.
5.2 Western blot detect how anti-specificity
Using PRRSV concentrated antigens, GP5 Protein reconstitutions baculoviral (Fan et al., Plus One 2015) and GP5/ 3m albumen and SF9 cell controls carry out.Primary antibody is 1:The rabbit polyvalent antibody that 1000 dilutions prepare, secondary antibody 1:1000 dilutions Goat-anti rabbit lgG-HRP, remaining step is the same as method 4.
5.3 indirect immunofluorescence assay (IFA)
It carries out according to a conventional method.96 orifice plate of Marc-145 cells of PRRSV BB0907 (MOI=0.01) infection 36h is taken, After being cleaned with PBS, 100 μ L 1 are added per hole:1(v:V) methanol：Acetone cell fixer, fixed cell 30min.After fixation Cell is washed three times with PBS.PBS 1 is added:10、1:50 and 1:100 diluted rabbit polyvalent antibodies, while setting up PRRSV N proteins Monoclonal antibody (1:100 dilutions) it is positive control, negative rabbit anteserum is negative control, 37 DEG C of effect 1h.1 is added after washing:200 dilutions FITC label goat-anti rabbit secondary antibody, positive controls be added 1:The sheep anti mouse secondary antibody of 200 diluted FITC labels, 37 DEG C of effects 1h.It is washed three times with PBS.It sets and is observed under inverted fluorescence microscope, and preservation of taking pictures.
5.4 virus neutralization tests
By good 96 porocyte culture plates of Marc-145 cell inoculations of growth conditions, 100 holes μ L wait for that cell is paved with list Layer.With cell growth maintaining liquid (the DMEM culture solutions for containing 2% (v/v) FBS) dilution PRRSV BB0907 viruses to 200TCID50/ ML after being mixed well with the rabbit polyvalent antibody of isometric doubling dilution, sets and acts on 1h in 37 DEG C of water-baths, and 96 hole cell culture are added Plate, 100 holes μ L/, then 100 holes μ l of cell maintenance medium are added, 37 DEG C are put into, 5%CO2It cultivates 3 days in cell incubator, sees day by day Cytopathy is examined, with the highest serum extension rate of complete neutralization viral cytopathic, is judged to neutralize antibody titers.
The foundation of 6.PRRSV GP5 indirect ELISA antibody detection methods
The optimization of 6.1 ELISA reaction conditions
The most suitable working concentration and serum optimum dilution degree of antigen are detected with square formation titration.With 0.05mol/L sodium carbonate- Sodium bicarbonate buffer liquid (pH9.6) carries out doubling dilution to GP5m albumen (0.2mg/mL), per 100 μ L of hole, 37 DEG C 2h or 37 DEG C 2h+4 DEG C is coated with enzyme reaction plate overnight；5% 37 DEG C of skimmed milk closes 1h or 37 DEG C of closing 2h；It is separately added into 1:100、1: 150、1:200 and 1:250 times of diluted PRRSV negative serums and positive serum, 37 DEG C of reaction 1h；With HRP-SPA (1:10000 Or 1:15000) it is secondary antibody, 37 DEG C of effect 45min, using TMB as chromogenic substrate progress routine ELISA detections.Calculate S/P values.I.e. S/P=(sample measure that hole OD450nm values-negative control hole be averaged OD450nm values)/(Positive control wells are averaged OD450nm values- Negative control hole is averaged OD450nm values).
The determination of 6.2 critical values
60 parts are detected with the indirect ELISA method of foundation and comes from not immune PRRSV vaccines, and through IDEXX companies PRRSV Antibody assay kit is detected as the pig anteserum sample of negative antibody, calculates the S/P values { S/P=(samples of 30 parts of negative serums Hole OD450nm values-negative control hole is measured to be averaged OD450nm values)/(Positive control wells are averaged OD450nm values-negative control hole Average OD450nm values) } average valueWith standard deviation (SD).S/P values >=When for the positive, S/P values< When for feminine gender；It is between the two suspicious, sample need to be detected again, S/P values when examining again >=When for the positive, S/P values<When for feminine gender.
6.3 specific test
Porcine circovirus 2 type (PCV2), swine fever virus (CSFV), Pseudorabies virus are detected with the criterion of foundation simultaneously (PRV), the positive of the 7 boar cause of diseases such as foot and mouth disease virus (FMDV), encephalomyocarditis virus (EMCV) and haemophilus parasuis (HPS) Serum, while the control of PRRSV standard positive and negative is set, it is anti-to determine whether antigen occurs to intersect with other Prevention of Common Occurrence Porcine Disease positive serums It answers.
6.4 sensibility, specificity and coincidence rate analysis
The serum sample that 320 parts of different antibodies potency are detected with the ELISA detection method of foundation, with IDEXX companies PRRSV The testing result of ELISA antibody assay kits is compared, and the sensibility, specificity and coincidence rate of this method are analyzed.
Relative sensitivity (%)={ number positive/(number positive+false negative number) } × 100%
Relative specificity (%)={ negative number/(negative number+false positive number) } × 100%
Total coincidence rate (%)={ (number positive+feminine gender number)/detection sum } × 100%
Two, result
2.1 target gene prokaryotic expression plasmids are built and the detection of expression effect
By the GP5/3 (as shown in SEQ ID NO.2) and GP5/3m of GP5 genes (as shown in SEQ ID NO.1) and synthesis (as shown in SEQ ID NO.3) target gene fragment is cloned into pET-28a carriers respectively, obtain recombinant plasmid pET-28a-GP5, PET-28a-GP5/3 and pET-28a-GP5/3m, gene sequencing result meet design, GP5/3 and GP5/3m target gene is big Small is 456bp.
3 recombinant plasmids pET-28a-GP5, pET-28a-GP5/3 and pET-28a-GP5/3m are converted respectively to large intestine Bacillus BL21, by IPTG induced expressions, SDS-PAGE is the results show that pET-28a-GP5 plasmids cannot express, pET-28a- GP5/3m expression purpose efficiency is apparently higher than pET-28a-GP5/3 expression plasmids, destination protein size about 16kDa (Fig. 2), and with The form of inclusion body purification is expressed.
2.2 GP5/3m prokaryotic expressions recombinant protein purifications and identification
PET-28a-GP5/3m is converted to e. coli bl21, by IPTG induced expressions, SDS-PAGE identifications, it was demonstrated that It is expressed in the form of inclusion body purification.Western Blot preferably react special the results show that the albumen has with GP5 monoclonal antibodies Property.Destination protein is extracted using inclusion body purification method, size about 16kDa, purity is up to 90% or more (Fig. 3).
2.3 rabbit body test results
2.3.1 PRRSV ELISA antibody titers
Using the GP5m recombinant protein immunizing rabbits of purifying, the 3rd time immune preceding ELISA antibody titers are 1:12800, again 10 days Culling heart bloods after immune detach serum, measure ELISA antibody titers, result 1:51200 (tables 1).
1 indirect ELISA of table detects rabbit-anti PRRSV serum antibody titers
Table 1 Determination of the antibody titer of rabbit serum by indirect ELISA
2.3.2 Western blot response characteristics
As a result see Fig. 4, which has preferable response characteristic with PRRSV concentrated antigens and GP5 Protein reconstitution baculovirals, Band can be exposed in corresponding position, and is not reacted with SF9 cell controls.
2.3.3 IFA response characteristics
Take 1:10、1:50 and 1:The rabbit anti-serum of 100 3 dilutions detects PRRSV infection Marc-145 cells, as a result There is specificity fluorescent reaction (Fig. 5), it was demonstrated that the antibody has IFA characteristics.
2.3.4 virus neutralizes characteristic measurement
By after rabbit anti-serum doubling dilution with 200TCID50PRRSVBB0907 strain mixed in equal amounts, with negative rabbit anteserum As a contrast, Marc-145 cells are inoculated with after 37 effect 1h, 72h are observed, the results show that the serum is to PRRSV BB0907 strains With neutralization activity, neutralize antibody titers 1:8.
The foundation of 2.4 PRRSVGP5 indirect ELISA antibody detection methods
2.4.1 the optimization of reaction condition
Recombination GP5m albumen peridium concentration and serum diluting multiple to be checked is determined by square formation burette test, it is basic herein On each reaction condition of indirect ELISA is optimized, result is：With 0.05mol/L sodium carbonate-bicarbonate buffer solutions (pH9.6) antigen is diluted, peridium concentration is 10 μ g/mL, and 37 DEG C/2h+4 DEG C overnight；5% 37 DEG C of skimmed milk closes 1h；It is added 1: 100 diluted serum to be checked, concurrently set PRRSV negative serums and positive serum (1:100 times of dilutions), 37 DEG C of reaction 1h；With HRP-SPA(1:15000) it is secondary antibody, 37 DEG C act on 45min, with TMB developing solutions, are protected from light 37 DEG C/10min, and sulfuric acid is added and terminates Liquid finally measures OD450nm values.
2.4.2 the determination of critical value
The indirect ELISA method established using this research is detected 60 parts and comes from not immune PRRSV vaccines, and through IDEXX Company's PRRSV antibody assay kits are detected as negative Swine serum, be calculated 30 parts of negative serum S/P values average value and Standard deviation is respectivelySD=0.036.According to Principle of Statistics, S/P (sample) >=When for the positive, S/P (samples This)<When for feminine gender, be judged to when falling between suspicious.As a result it shows：It is judged to the positive, S/P as S/P >=0.383 <It is feminine gender when 0.347, is judged to when between 0.347 and 0.383 suspicious.
2.4.3 specific test
6 boar cause of disease positive serums are detected in aforementioned manners, and result is negative (table 2), shows the antigen and PCV2, pig Without cross method, this method has compared with high specific for pest CSFV, PRV, FMDV, EMCV and haemophilus parasuis antibody.
2 specific test result of table
Table 3 Results of specificity of indirect ELISA
2.4.4 sensibility
120 parts of PRRSV infections and immune Swine serum are acquired, with IDEXX companies PRRSV ELISA antibody assay kits Testing result is the positive, is detected with this method, and as a result 109 parts are the positive, and this method sensibility is 90.83%.
2.4.5 repeated
As stated above using 3 batches of antigens, while 10 parts of PRRSV Positive Seras and 10 parts of negative serums, knot being detected Fruit is consistent, S/P value differences different ranging from 1.5%~9.5%, and respectively less than 10%.
2.4.6 coincidence rate
The ELISA method and IDEXX companies PRRSV ELISA antibody assay kits established with this research detect simultaneously 320 parts of clinical Swine serum samples the results are shown in Table 4, and two methods coincidence rate is 91.567%.Opposite IDEXX companies PRRSV ELISA antibody assay kits, this method relative sensitivity and relative specificity are 90.56% and 92.86%.
The indirect ELISA detection method that 3 researchs of table are established is compared with the testing result of commercial kit
Table 4 Comparison of the established indirect ELISA with commercial detection kit
GP5 gene orders 1：
atgttggggaagtgcttgaccgcgtgctgttgctcgcgattgctttttttgtggtgtatcgtgccgttctatcttgc tgtgctcgccaacgccagcaacagcaacagctctcatattcagttgatttataacttaacgctatgtgagctgaatg gcacagattggctggcacaaaaatttgactgggcagtggagacttttgtcatcttccccgtgttgactcacattgtt tcctatggagcactcaccaccagccatttccttgacacagttggtctagccactgtgtccaccgccggatattatca cgggcggtatgtcttgagtagcatttacgcagtctgtgctctggctgcgctgatttgctttgtcattaggcttgcga agaactgcatgtcctggcgctactcttgtaccagatataccaacttccttctggacactaagggcagactctatcgt tggcggtcacccgtcattgtggagaaagggggtaaggttgaggtcgaaggtcacctgatcgacctcaagagagttgt gcttgatggttccgcggcaacccctttaaccagagtttcagcggaacaatggggtcgtctctag
GP5/3 gene orders 2：
agcaacagcaacagctctcatattcagttgatttataacttaacgctatgtgagctgaatggcacagattggctggc acaaaaatttgactgggcagtggagacttttgtcatcttccccgtgttgactcacattgtttcctatggagcactca ccaccagccatttccttgacacagttggtctagccactgtgtccaccgccggatattatcacgggcggggatctaag aactgcatgtcctggcgctactcttgtaccagatataccaacttccttctggacactaagggcagactctatcgttg gcggtcacccgtcattgtggagaaagggggtaaggttgaggtcgaaggtcacctgatcgacctcaagagagttgtgc ttgatggttccgcggcaacccctttaaccagagtttcagcggaacaatggggtcgtctc
GP5/3m gene orders 3
agcaacagcaacagcagccacatccagctgatttacaacctgaccctgtgcgagctgaacggtaccgactggctggc gcaaaagttcgattgggcggtggaaaccttcgttatctttccggtgctgacccacattgttagctatggcgcgctga ccaccagccactttctggacaccgttggtctggcgaccgtgagcaccgcgggttactatcacggtcgtggatctaag aactgcatgagctggcgttacagctgcacccgttataccaacttcctgctggataccaaaggtcgtctgtaccgttg gcgtagcccggtgatcgttgagaagggtggcaaagttgaggtggaaggtcacctgattgacctgaaacgtgttgttc tggatggtagcgcggcgaccccgctgacccgtgtgagcgcggaacagtggggccgtctg
Sequence table
<110>Agricultural University Of Nanjing
<120>A kind of recombinant protein of porcine reproductive and respiratory syndrome virus GP5 genetic modifications and its application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 603
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
atgttgggga agtgcttgac cgcgtgctgt tgctcgcgat tgcttttttt gtggtgtatc 60
gtgccgttct atcttgctgt gctcgccaac gccagcaaca gcaacagctc tcatattcag 120
ttgatttata acttaacgct atgtgagctg aatggcacag attggctggc acaaaaattt 180
gactgggcag tggagacttt tgtcatcttc cccgtgttga ctcacattgt ttcctatgga 240
gcactcacca ccagccattt ccttgacaca gttggtctag ccactgtgtc caccgccgga 300
tattatcacg ggcggtatgt cttgagtagc atttacgcag tctgtgctct ggctgcgctg 360
atttgctttg tcattaggct tgcgaagaac tgcatgtcct ggcgctactc ttgtaccaga 420
tataccaact tccttctgga cactaagggc agactctatc gttggcggtc acccgtcatt 480
gtggagaaag ggggtaaggt tgaggtcgaa ggtcacctga tcgacctcaa gagagttgtg 540
cttgatggtt ccgcggcaac ccctttaacc agagtttcag cggaacaatg gggtcgtctc 600
tag 603
<210> 2
<211> 444
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
agcaacagca acagctctca tattcagttg atttataact taacgctatg tgagctgaat 60
ggcacagatt ggctggcaca aaaatttgac tgggcagtgg agacttttgt catcttcccc 120
gtgttgactc acattgtttc ctatggagca ctcaccacca gccatttcct tgacacagtt 180
ggtctagcca ctgtgtccac cgccggatat tatcacgggc ggggatctaa gaactgcatg 240
tcctggcgct actcttgtac cagatatacc aacttccttc tggacactaa gggcagactc 300
tatcgttggc ggtcacccgt cattgtggag aaagggggta aggttgaggt cgaaggtcac 360
ctgatcgacc tcaagagagt tgtgcttgat ggttccgcgg caaccccttt aaccagagtt 420
tcagcggaac aatggggtcg tctc 444
<210> 3
<211> 444
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
agcaacagca acagcagcca catccagctg atttacaacc tgaccctgtg cgagctgaac 60
ggtaccgact ggctggcgca aaagttcgat tgggcggtgg aaaccttcgt tatctttccg 120
gtgctgaccc acattgttag ctatggcgcg ctgaccacca gccactttct ggacaccgtt 180
ggtctggcga ccgtgagcac cgcgggttac tatcacggtc gtggatctaa gaactgcatg 240
agctggcgtt acagctgcac ccgttatacc aacttcctgc tggataccaa aggtcgtctg 300
taccgttggc gtagcccggt gatcgttgag aagggtggca aagttgaggt ggaaggtcac 360
ctgattgacc tgaaacgtgt tgttctggat ggtagcgcgg cgaccccgct gacccgtgtg 420
agcgcggaac agtggggccg tctg 444

Claims (9)

1. a kind of porcine reproductive and respiratory syndrome virus GP5 protein coding genes of codon optimization are in following (1)~(3) Any DNA molecular：
(1) DNA molecular shown in SEQ ID NO.3 in sequence table；
(2) hybridize under strict conditions with the DNA sequence dna that (1) limits and encode porcine reproductive and respiratory syndrome virus GP5 albumen DNA molecular；
(3) DNA sequence dna limited with (1) at least with 90%, at least with 95%, at least with 96%, at least with 97%, At least with 98% or at least with 99% homology and encode porcine reproductive and respiratory syndrome virus GP5 albumen DNA molecular.
2. the recombinant vector, expression cassette, transgenic cell line containing encoding gene described in claim 1 or recombinant bacterium.
3. recombinant vector as claimed in claim 2, it is characterised in that：The recombinant vector is by volume described in claim 1 Code gene is inserted into the carrier that prokaryotic expression carrier obtains；The prokaryotic expression carrier is preferably colibacillus expression plasmid pET- 28a(+)。
4. recombinant bacterium as claimed in claim 2, it is characterised in that：The recombinant bacterium is that the recombinant vector is imported purpose bacterium In obtained recombinant bacterium, the purpose bacterium is preferably Escherichia coli；The Escherichia coli are more preferably Escherichia coli BL21。
5. recombinant vector, expression cassette, transgenic cell line described in encoding gene described in claim 1 or claim 2 or again Application of the group bacterium in preparing GP5 recombinant proteins.
6. a kind of method preparing GP5 recombinant proteins, which is characterized in that for the recombinant bacterium described in fermentation claim 2 or 4, receive Collection tunning is simultaneously purified to get to GP5 recombinant proteins.
7. method of claim 6 prepare GP5 recombinant proteins prepare porcine reproductive and respiratory syndrome virus vaccine or Establish the application in PRRSV GP5 indirect ELISA antibody assay kits.
8. a kind of porcine reproductive and respiratory syndrome virus vaccine or PRRSV GP5 indirect ELISA antibody assay kits, feature It is, including GP5 recombinant proteins prepared by claim 6 the method.
9. a kind of PRRSV GP5 indirect ELISA antibody detection methods, which is characterized in that dilute claim 6 with antigen coat liquid GP5 recombinant proteins prepared by the method, peridium concentration are 10 μ g/mL, and 37 DEG C/2h+4 DEG C overnight；5% 37 DEG C of skimmed milk is closed 1h；It is added 1:100 times of diluted serum to be checked concurrently set PRRSV negative serums and positive serum, 37 DEG C of reaction 1h；With 1: 15000 times of diluted HRP-SPA are secondary antibody, and 37 DEG C of effect 45min carry out routine ELISA detections, meter by chromogenic substrate of TMB Calculate S/P values, i.e. S/P=(sample measure that hole OD450nm values-negative control hole be averaged OD450nm values)/(Positive control wells are average OD450nm values-negative control hole is averaged OD450nm values)；It is judged to the positive, S/P as S/P >=0.383<It is feminine gender when 0.347, It is judged to when between 0.347 and 0.383 suspicious.
CN201810147635.2A 2018-02-13 2018-02-13 Porcine reproductive and respiratory syndrome virus GP5 gene modified recombinant protein and application thereof Active CN108559754B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810147635.2A CN108559754B (en) 2018-02-13 2018-02-13 Porcine reproductive and respiratory syndrome virus GP5 gene modified recombinant protein and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810147635.2A CN108559754B (en) 2018-02-13 2018-02-13 Porcine reproductive and respiratory syndrome virus GP5 gene modified recombinant protein and application thereof

Publications (2)

Publication Number Publication Date
CN108559754A true CN108559754A (en) 2018-09-21
CN108559754B CN108559754B (en) 2021-08-17

Family

ID=63531159

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810147635.2A Active CN108559754B (en) 2018-02-13 2018-02-13 Porcine reproductive and respiratory syndrome virus GP5 gene modified recombinant protein and application thereof

Country Status (1)

Country Link
CN (1) CN108559754B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110376388A (en) * 2019-08-16 2019-10-25 南京农业大学 A kind of haemophilus parasuis antibody detection method and its kit
CN110894243A (en) * 2019-12-16 2020-03-20 中国农业大学 Porcine reproductive and respiratory syndrome virus chimeric antigen and colloidal gold immunochromatographic test strip for detecting porcine reproductive and respiratory syndrome virus antibody
CN114134180A (en) * 2021-11-26 2022-03-04 山东滨州沃华生物工程有限公司 Construction method of recombinant baculovirus expressing porcine reproductive and respiratory syndrome (GP) 5 protein

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105400745A (en) * 2015-12-04 2016-03-16 南京农业大学 Porcine reproductive and respiratory syndrome virus (PRRSV) genetic engineering strain, inactivated vaccine thereof, and preparation method of inactivated vaccine

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105400745A (en) * 2015-12-04 2016-03-16 南京农业大学 Porcine reproductive and respiratory syndrome virus (PRRSV) genetic engineering strain, inactivated vaccine thereof, and preparation method of inactivated vaccine

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110376388A (en) * 2019-08-16 2019-10-25 南京农业大学 A kind of haemophilus parasuis antibody detection method and its kit
CN110376388B (en) * 2019-08-16 2021-10-19 南京农业大学 Haemophilus parasuis antibody detection method and kit thereof
CN110894243A (en) * 2019-12-16 2020-03-20 中国农业大学 Porcine reproductive and respiratory syndrome virus chimeric antigen and colloidal gold immunochromatographic test strip for detecting porcine reproductive and respiratory syndrome virus antibody
CN110894243B (en) * 2019-12-16 2021-07-13 中国农业大学 Porcine reproductive and respiratory syndrome virus chimeric antigen and colloidal gold immunochromatographic test strip for detecting porcine reproductive and respiratory syndrome virus antibody
CN114134180A (en) * 2021-11-26 2022-03-04 山东滨州沃华生物工程有限公司 Construction method of recombinant baculovirus expressing porcine reproductive and respiratory syndrome (GP) 5 protein

Also Published As

Publication number Publication date
CN108559754B (en) 2021-08-17

Similar Documents

Publication Publication Date Title
Chirnside et al. Development and evaluation of an ELISA using recombinant fusion protein to detect the presence of host antibody to equine arteritis virus
CN108559754A (en) A kind of recombinant protein of porcine reproductive and respiratory syndrome virus GP5 genetic modifications and its application
WO2021227514A1 (en) Inert carrier indirect agglutination test detection system and application thereof
CN109187993A (en) A kind of foot and mouth disease A-type virus sIgA antibody ELISA detection kit and its application
WO2012163263A1 (en) Reagents and methods for prrsv detection
CN108918869B (en) Application of fiber2 protein and recombinant protein thereof in detecting serum type 4 avian adenovirus antibody
CN110873792A (en) African swine fever virus antibody detection kit
CN114736290B (en) Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application
CN107312088B (en) Porcine epidemic diarrhea virus specificity SIgA ELISA detection kit and application thereof
CN106279408B (en) Monoclonal antibody and antibody combination for resisting foot-and-mouth disease type O virus and application of monoclonal antibody and antibody combination in detection of virus antigen and antibody
US20230375548A1 (en) Indirect enzyme-linked immunosorbent assay detection kit based on p30 protein and p22 protein of african swine fever virus
CN109239341A (en) A kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test and its application
CN105296435B (en) The monoclonal antibody specific and application of hybridoma cell strain and its O-shaped (O/GX/09-7) virus of the resistant to foot and mouth disease of secretion
CN107011417A (en) Recombinant protein, encoding gene and application thereof, and detection kit and detection method for porcine epidemic diarrhea virus antibody
Go et al. Development of a fluorescent-microsphere immunoassay for detection of antibodies specific to equine arteritis virus and comparison with the virus neutralization test
CN113512098B (en) Indirect ELISA (enzyme-Linked immuno sorbent assay) method for identifying swine fever virus and bovine viral diarrhea virus serum antibodies and application thereof
CN113698474B (en) African swine fever polyclonal antibody and African swine fever antigen detection test strip
US20190240311A1 (en) Pestivirus marker vaccine
Zhang et al. Development of a potential diagnostic monoclonal antibody against capsid spike protein VP27 of the novel goose astrovirus
KR101080071B1 (en) Rift valley fever competition ELISA using monoclonal antibodies against recombinant N protein
TWI490229B (en) Specific monoclonal antibody cw813 against classical swine fever virus glycoprotein erns and its application to an indirect sandwich elisa
CN113355291A (en) Monoclonal antibody of mycoplasma filiformis subspecies P0071 protein and application thereof
CN116790509B (en) Monoclonal hybridoma cell strain secreting anti-porcine pseudorabies virus gB protein antibody and application thereof
CN114106158B (en) Nanometer antibody targeting porcine pseudorabies virus gD protein, preparation method and application
Xie et al. Dynamics of serological and mucosal antibody responses against african swine fever viruses in experimentally infected pigs

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant