CN108546749B - Mixed hot start DNA polymerase composition, PCR amplification kit and application thereof - Google Patents

Abstract

The invention discloses a mixed hot start DNA polymerase composition, a PCR amplification kit and application thereof, wherein Taq DNA polymerase, an anti-Taq antibody and a mutant KOD DNA polymerase are used, wherein the anti-Taq antibody can be specifically combined with the Taq DNA polymerase, and the 147 th histidine of the mutant KOD DNA polymerase is mutated into lysine compared with the wild KOD DNA polymerase. Experimental results show that the mixed hot-start DNA polymerase composition has the characteristics of low mismatching rate when used for PCR amplification, high-efficiency amplification and high fidelity, has good heat resistance when used for amplification, and has a good amplification effect on long DNA fragments, templates with low template amount or templates with high GC content.

Description

Mixed hot start DNA polymerase composition, PCR amplification kit and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a mixed hot start DNA polymerase composition, a PCR amplification kit and application thereof.

Background

PCR amplification (polymerase chain reaction) is a molecular biology technique for amplifying specific DNA fragments, which can be regarded as specific DNA replication in vitro. The principle is that DNA is denatured into single strand at 95 deg.C in vitro, and primer and single strand are combined according to base complementary pairing principle at low temperature (usually about 60 deg.C). Then, the temperature is adjusted to the optimum reaction temperature (about 72 ℃) for the DNA polymerase, and the DNA polymerase synthesizes a complementary strand along the direction from phosphate to pentose (5 '-3').

DNA polymerase (DNA polymerase) is an enzyme that plays a key role in replicating DNA. The DNA polymerase is an enzyme that mainly uses DNA as a replication template and replicates DNA from the 5 'end to the 3' end. Most of the current DNA polymerases are obtained by purifying fermentation products or by subjecting enzyme proteins to antibody or chemical modification to achieve hot start. Measurement of DNA polymeraseOne common criterion for fidelity is mismatch rate, with lower mismatch rates giving better fidelity. The mismatch rate of the amplification of a sample with a common DNA polymerase is generally 10^-5Base/cycle number. For experiments with very strict mismatch rate requirements, such as gene screening, sequencing, mutation detection, etc., common DNA polymerases are far from meeting the requirements. Although the new KOD DNA polymerase can reduce the mismatch rate to some extent, the mismatch rate still needs to be further reduced, and the polymerization capability of KOD DNA polymerase is generally poor, and it is difficult to amplify target DNA with longer fragments. In addition, the traditional DNA polymerase has poor amplification effect on amplification templates with the template amount of less than 1pg and amplification templates with high GC content, and does not meet the detection requirements of higher sensitivity and accuracy.

Disclosure of Invention

Based on this, it is necessary to provide a DNA polymerase having a good amplification effect on a target DNA of a long fragment or an amplification template having a low template amount and a high GC content.

In addition, it is necessary to provide a PCR amplification kit and application thereof.

A mixed hot start DNA polymerase composition comprises Taq DNA polymerase, an anti-Taq antibody and a mutant KOD DNA polymerase, wherein the anti-Taq antibody can be specifically combined with the Taq DNA polymerase, and the mutant KOD DNA polymerase is obtained by mutating histidine at the 147 th position of wild type KOD DNA polymerase into lysine.

In one embodiment, the mutant KOD DNA polymerase comprises:

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1; or the like, or, alternatively,

(b) and (b) a protein derived from (a) having the mutant KOD DNA polymerase activity, which is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence represented by SEQ ID No. 1.

In one embodiment, the enzyme activity ratio of the Taq DNA polymerase to the mutant KOD DNA polymerase is 1: 10U to 320U.

In one embodiment, the enzyme activity ratio of the Taq DNA polymerase to the mutant KOD DNA polymerase is 1: 80U-160U.

A PCR amplification kit comprising the mixed hot start DNA polymerase composition of any of the above.

In one embodiment, the kit further comprises a GC amplification buffer solution, wherein the GC amplification buffer solution contains 40 mmol/L-60 mmol/L Tris-HCl, 50 mmol/L-150 mmol/L KCl, and 2 mmol/L-8 mmol/L MgCl ₂20 to 30mmol/L of (NH)₄)₂SO₄Dimethyl sulfoxide with the volume fraction of 1-3 percent, Tween20 with the volume fraction of 0.001-0.01 percent, Triton-x-100 with the volume fraction of 0.001-0.01 percent and BSA with the mass fraction of 0.5-5 mg/mL.

In one embodiment, the kit further comprises a PCR buffer solution and a PCR enhancer, wherein the PCR buffer solution contains 10 mmol/L-30 mmol/L Tris-HCl, 0.5 mmol/L-5 mmol/L MgCl ₂50 to 80mmol/L of (NH)₄)₂SO₄And KCl of 40 mmol/L-60 mmol/L, and the PCR enhancer is betaine.

The application of the PCR amplification kit in DNA amplification comprises the following steps:

mixing a DNA amplification template, a PCR buffer solution and a mixed hot start DNA polymerase composition to obtain an amplification system;

and (3) placing the amplification system in a PCR instrument for PCR amplification.

In one embodiment, the DNA amplification template has a GC content of 65% or more.

In one embodiment, the DNA amplification template content in the amplification system is 1pg or less.

Experimental results show that the mixed type hot-start DNA polymerase composition is formed by combining Taq DNA polymerase, the anti-Taq antibody and the mutant KOD DNA polymerase, has low mismatching rate when used for PCR amplification, has the dual characteristics of high-efficiency amplification and high fidelity, and unexpectedly has certain synergistic effect when the Taq DNA polymerase, the anti-Taq antibody and the mutant KOD DNA polymerase are used for amplification, so that the mixed type hot-start DNA polymerase composition has good heat resistance, can be prepared at room temperature when an amplification reaction system is configured, does not need to be finished on ice, and is simple and convenient to operate. And the method has better amplification effect on a longer DNA fragment, a template with low template quantity or a template with high GC content, and can be used for gene screening, sequencing, mutation detection and the like.

Drawings

FIG. 1 is a SDS-PAGE pattern of a purification process of the mutant KOD DNA polymerase prepared in example 1 and each protein sample after the purification;

FIG. 2 is an SDS-PAGE pattern of protein samples before and after the induction of Taq DNA polymerase prepared in example 1;

FIG. 3 is an SDS-PAGE pattern of protein samples of the Taq DNA polymerase purification procedure prepared in example 1;

FIG. 4 is an SDS-PAGE graph of protein samples at various concentrations after purification of Taq DNA polymerase prepared in example 1;

FIG. 5 is an agarose electrophoresis picture of the PCR product of example 3 under different PCR reaction conditions;

FIG. 6 is a comparison of the results of gel electrophoresis of amplified products of Gp32 by Taq DNA polymerase and mutant KOD DNA polymerase at different enzyme activity ratios in example 4;

FIG. 7 is a comparison of gel electrophoresis results of amplified products of DAN fragments at different extension times in the first test example;

FIG. 8 is a graph showing a comparison of gel electrophoresis results of products obtained after amplification of Trichoderma reesei HKMT gene by the mixed type hot start DNA polymerase composition and the control polymerase before and after heat treatment in test example II;

FIG. 9 is a comparison of the results of gel electrophoresis of the products of the mixed hot start DNA polymerase composition used in the third test example for amplifying the target genes of different sizes;

FIG. 10 is a graph showing the comparison of the gel electrophoresis results of the mixed type hot-start DNA polymerase composition and the control polymerase in the fourth test example on the amplified products of different concentrations of the template DNA;

FIG. 11 is a graph showing the comparison of the gel electrophoresis results of the products of the mixed type hot-start DNA polymerase composition and the control polymerase in the fifth test example after amplification of the template DNA with different GC contents;

FIG. 12 is a graph comparing the results of polymerase fidelity of the mixed hot start DNA polymerase composition and the control in the sixth test example.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The hybrid hot start DNA polymerase composition according to an embodiment includes Taq DNA polymerase, an anti-Taq antibody capable of specifically binding to the Taq DNA polymerase, and a mutant KOD DNA polymerase obtained by mutating histidine (H) at position 147 of wild-type KOD DNA polymerase to lysine (K).

Incidentally, Taq DNA polymerase, anti-Taq antibody and mutant KOD DNA polymerase may be preliminarily mixed and present in the form of a mixed composition. Alternatively, Taq DNA polymerase, anti-Taq antibody and mutant KOD DNA polymerase may be stored separately and added to the reaction system as needed when used.

In one embodiment, the mutant KOD DNA polymerase comprises: (a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1; or (b) a protein derived from (a) having the mutant KOD DNA polymerase activity, which has one or more amino acids substituted, deleted or added to the amino acid sequence shown in SEQ ID No. 1. The mutant KOD DNA polymerase is further optimized for wild-type Taq DNA polymerase, wherein the amino acids at positions 407 to 766 and 852 to 1388 are deleted to reduce unnecessary spliceosomes, and histidine (H) at position 147 is mutated to lysine (K). The expression fragment is small, only one site is mutated, the mutated site is few, and the preparation is easy.

It will be appreciated that, since there are many codons encoding the same amino acid, the coding sequence of the polypeptide is characterized by polymorphism and variation. Therefore, proteins having the mutant KOD DNA polymerase activity of the present application with substitution, deletion or addition of one or several amino acids in the amino acid sequence shown in SEQ ID No.1, or without significant functional difference, are also included in the scope of the present invention.

The mutant KOD DNA polymerase can further reduce the mismatch rate of amplification. The mismatching rate can be reduced by 50 percent compared with the wild KOD DNA polymerase, and the amplification sensitivity is obviously improved under the condition of very low relative base number. And unexpected discovery shows that the mixed hot start DNA polymerase composition formed by the mutant KOD DNA polymerase, Taq DNA polymerase and anti-Taq antibody has better amplification effect on long DNA fragments, templates with low template amount or templates with high GC content, which indicates that the mutant KOD DNA polymerase, the Taq DNA polymerase and the anti-Taq antibody have certain synergistic effect when used for amplification.

Specifically, Taq DNA polymerase is a highly thermostable DNA polymerase derived from thermophilic bacteria Thermus aquaticus, has excellent characteristics of high temperature resistance, high specificity and the like, and is widely used in PCR amplification. However, Taq DNA polymerase has a temperature-raising process (e.g., 95 ℃) before the first cycle of PCR denaturation, during which there is some non-specific pairing between primer and template, if Taq enzyme is active, non-specific amplification is easily generated, and since the amount of template in the early stage of the cycle is very small, the generated non-specific band will be amplified by the following exponential amplification, which will seriously interfere with the amplification of the target fragment, and even result in that the specific band cannot be amplified. The mixed hot start DNA polymerase composition of the embodiment introduces the anti-Taq antibody, the anti-Taq antibody is an antibody corresponding to Taq DNA polymerase and can be specifically combined with the Taq DNA polymerase, and the activity of the anti-Taq antibody and the activity of the Taq DNA polymerase are inhibited before high-temperature heating, so that non-specific amplification is not caused. After high temperature denaturation, the Taq DNA polymerase is separated from the anti-Taq antibody, and the catalytic activity of the Taq DNA polymerase is recovered, so that the primer specifically combined is extended, and the sensitivity and the specificity of the PCR reaction are greatly improved.

In one embodiment, when the mixed hot start DNA polymerase composition is used, the concentration of Taq DNA polymerase and anti-Taq antibody is 1-100: 1-100, for example 3: 2.

In one embodiment, the Taq DNA polymerase comprises: (a) a protein consisting of an amino acid sequence shown in SEQ ID No. 2; or (b) a protein which is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No.2 and has the activity of the Taq DNA polymerase and is derived from the protein (a). The Taq DNA polymerase having the above amino acid sequence is a high fidelity Taq DNA polymerase (HiFi Taq DNA polymerase), and further reduces the mismatch rate during amplification. Accordingly, anti-Taq antibody is an antibody against high fidelity Taq DNA polymerase.

Similarly, since there are many codons encoding the same amino acid, the coding sequence of the polypeptide has polymorphism and variation. Therefore, proteins having the Taq DNA polymerase activity of the present application with one or more amino acids substituted, deleted or added in the amino acid sequence shown in SEQ ID No.2, or without significant functional differences, are also included in the scope of the present invention.

In one embodiment, when the mixed hot start DNA polymerase composition is used, the enzyme activity ratio of Taq DNA polymerase to mutant KOD DNA polymerase is 1: 10U to 320U. The enzyme activity ratio in the range is best, the amplification effect is best, the obtained band is clear, and the number of miscellaneous bands is small.

Further, when used, the enzyme activity ratio of the Taq DNA polymerase to the mutant KOD DNA polymerase is 1: 80U-160U. The enzyme activity ratio in the range is better, the amplification effect is better, the obtained band is clear, and the number of the impurity bands is less.

The mixed hot start DNA polymerase composition comprises Taq DNA polymerase, an anti-Taq antibody and a mutant KOD DNA polymerase. The mixed type hot start DNA polymerase composition has at least the following beneficial effects: (1) the mixed type hot start DNA polymerase composition has good heat resistance, so that the mixed type hot start DNA polymerase composition can be prepared at room temperature when an amplification reaction system is prepared, and is not required to be finished on ice, and the operation is simple and convenient. (2) The mismatch rate of amplification is further reduced, and the sensitivity of amplification is obviously improved under the condition of low relative base number. (3) And the mutant KOD DNA polymerase only needs to mutate one site, and the mutant KOD DNA polymerase has few mutated sites and is easy to prepare. (4) The hot start method of antibody combination overcomes the defects that the chemical modification and physical barrier methods need to prolong the pre-denaturation time and need several PCR cycles to fully release the activity of DNA polymerase, and has the advantages of minimal damage to the enzyme and more convenient use. (5) The method has better amplification effect on long DNA fragments, templates with low template amount or templates with high GC content.

In addition, the present application also provides a PCR amplification kit of an embodiment, which contains the mixed hot start DNA polymerase composition of one of the above.

The characteristics of the mixed-type hot start DNA polymerase composition can be described above and will not be described herein.

Of course, the PCR amplification kit may also include a packing box, a packing bottle, etc.

In the kit, Taq DNA polymerase, anti-Taq antibody and mutant KOD DNA polymerase may be pre-mixed and present as a mixed enzyme. Alternatively, Taq DNA polymerase, anti-Taq antibody and mutant KOD DNA polymerase may be stored separately and added to the reaction system as needed when used.

In this embodiment, Taq DNA polymerase, anti-Taq antibody and mutant KOD DNA polymerase may be stored separately and added to the reaction system as needed when used.

In one embodiment, the PCR amplification kit further comprises a GC amplification buffer solution, wherein the GC amplification buffer solution contains 40mmol/L to 60mmol/L Tris-HCl, 50mmol/L to 150mmol/L KCl, and 2mmol/L to 8mmol/L MgCl ₂20 to 30mmol/L of (NH)₄)₂SO₄Dimethyl sulfoxide (DMSO) with the volume fraction of 1-3%, Tween20 with the volume fraction of 0.001-0.01%, Triton-x-100 with the volume fraction of 0.001-0.01% and BSA with the mass fraction of 0.5-5 mg/mL.

Further, the GC amplification buffer contained 50mmol/L Tris-HCl (pH8.8), 100mmol/L KCl, and 5mmol/LMgCl of₂25mmol/L of (NH)₄)₂SO₄Dimethyl sulfoxide (DMSO) with a volume fraction of 2%, Tween20 with a volume fraction of 0.005%, Triton-x-100 with a volume fraction of 0.002% and BSA with a mass fraction of 1 mg/mL.

The GC amplification buffer solution with the formula is matched with the mixed type hot start DNA polymerase composition, and can amplify the amplification template with the GC content of more than 50 percent, even the amplification template with the GC content of more than 80 percent. The GC content is the ratio of guanine to cytosine among 4 bases in DNA.

In one embodiment, the PCR amplification kit further comprises a PCR buffer. The PCR buffer solution contains 10 mmol/L-30 mmol/L Tris-HCl and 0.5 mmol/L-5 mmol/L MgCl ₂50 to 80mmol/L of (NH)₄)₂SO₄And KCl with the concentration of 40 mmol/L-60 mmol/L.

Further, the PCR buffer contained 25mmol/L Tris-HCl (pH8.0), 2mmol/L MgCl₂60mmol/L of (NH)₄)₂SO₄And KCl of 50 mmol/L.

The PCR buffer solution of the formula provides a proper acid-base environment and a proper salt ion environment for reaction, and is matched with the mixed hot start DNA polymerase composition to realize high-efficiency and high-sensitivity amplification.

In one embodiment, the PCR amplification kit further comprises a PCR enhancer, and the PCR enhancer is betaine. PCR enhancers can enhance PCR polymerization ability as well as specificity.

In one embodiment, the PCR amplification kit further comprises dNTPs and the like.

The PCR amplification kit comprises a mixed hot start DNA polymerase composition, and is matched with a carefully prepared PCR buffer solution, a PCR enhancer and the like, and can be used for gene screening, sequencing, mutation detection and the like.

The application of any one of the PCR amplification kits in DNA amplification comprises the following steps:

s110, mixing the DNA amplification template, the PCR buffer solution and the mixed type hot start DNA polymerase composition to obtain an amplification system.

And S120, placing the amplification system in a PCR instrument for PCR amplification.

Specifically, referring to the general PCR amplification procedure, a mixed type hot start DNA polymerase composition is added to the reaction system, thereby amplifying the DNA sample.

Specifically, the DNA amplification template may be derived from at least one of human genomic DNA, bacteriophage DNA, and filamentous fungus Trichoderma reesei DNA. When the Taq DNA polymerase, the anti-Taq antibody and the mutant KOD DNA polymerase are used for amplification, a certain synergistic effect can occur, and high-sensitivity amplification can be realized on human genome DNA, phage DNA and filamentous fungus Trichoderma reesei DNA.

In one embodiment, the GC content of the DNA amplification template is 50% or more. For example, the GC content in the DNA amplification template is 50 to 90%. The GC content is the ratio of 4 bases, guanine and cytosine, in the DNA amplification template.

Further, the GC content in the DNA amplification template was 65% or more. For example, the GC content in the DNA amplification template is 65% to 85%.

When the Taq DNA polymerase, the anti-Taq antibody and the mutant KOD DNA polymerase are used for amplification, a certain synergistic effect can occur, and high-sensitivity amplification can be realized on a DNA template with high GC content.

In one embodiment, the DNA amplification template content in the amplification system is 1pg or less, for example, 10fg to 1 pg.

When the Taq DNA polymerase, the anti-Taq antibody and the mutant KOD DNA polymerase are used for amplification, a certain synergistic effect can occur, and high-sensitivity amplification can be realized on DNA samples with low template content.

In conclusion, the mixed type hot-start DNA polymerase composition formed by combining the Taq DNA polymerase, the anti-Taq antibody and the mutant KOD DNA polymerase has the characteristics of low mismatching rate during PCR amplification and high amplification efficiency and high fidelity, and unexpectedly, a certain synergistic effect possibly occurs when the Taq DNA polymerase, the anti-Taq antibody and the mutant KOD DNA polymerase are used for amplification, so that the mixed type hot-start DNA polymerase composition has good heat resistance, and can be prepared at room temperature without being finished on ice when an amplification reaction system is prepared, and the operation is simple and convenient. And the method has better amplification effect on a longer DNA fragment, a template with low template quantity or a template with high GC content, and can be used for gene screening, sequencing, mutation detection and the like.

The following is a detailed description of the embodiments.

In the following examples, unless otherwise specified, the experimental procedures without specifying the specific conditions are usually carried out according to conventional conditions, for example, the conditions described in the molecular cloning's Experimental guidelines [ M ] (Beijing: scientific Press, 1992) by Sammbruke, EF Friech, T Mannich, et al (translated by Kindong goose, Rimeng maple, et al) or the procedures recommended by the manufacturers of the kits. All procedures adopt the standard procedures in the field, and the adopted reagents or carriers and the like are all conventional reagents or conventional carriers.

In the figure, Taq plus represents Taq DNA polymerase, Pfu-fusion represents Pfu DNA polymerase, and KD plus represents KOD DNA polymerase. KTaq MIX DNApolymerase (KTq MIX) denotes the mixed type hot start DNA polymerase composition herein.

EXAMPLE 1 preparation of mutant KOD DNA polymerase

A target gene expression sequence was designed based on the amino acid sequence shown in SEQ ID No.1, and the gene synthesis was entrusted to the Gene synthesizer. This example entrusts Suzhou Hongyo corporation to synthesize and sequence to verify that a gene expression fragment with a mutation at a specific site was obtained. The target gene expression sequence is transformed into BL21(DE3) according to a method recommended by a kit for induced expression and purification, so that the target protein with the purity of more than 90 percent is obtained, and the size of the protein is about 90 KD. SDS-PAGE patterns of the purification process and each protein sample after purification are shown in FIG. 1, in which the labeled "sample" indicates the lane of electrophoresis of the protein sample collected after induction, "flow-through" indicates the sample flowing through the purification column, and B1-B5, C1-C5, and D1 indicate the samples collected during the purification process by washing with buffers containing imidazole at different concentrations. A1, a5 represent the collected purified samples. It can be seen that the mutant KOD DNA polymerase was successfully expressed after BL21 induction, and the dialyzed sample had high purity and few impurities.

Preparation of Taq DNA polymerase

A target gene expression sequence was designed based on the amino acid sequence shown in SEQ ID No.2, and the gene synthesis was entrusted to the Gene synthesizer. This example entrusts Suzhou Hongye corporation to synthesize. The target gene expression sequence is transformed into BL21(DE3) according to a method recommended by a kit for induced expression and purification, so that the target protein with the purity of more than 90 percent is obtained, and the size of the protein is about 100 KD. SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) images of protein samples before and after induction, a purification process and after purification are respectively shown in figures 2-4, and it can be seen that after BL21 is induced, Taq DNA polymerase is successfully expressed, and the dialyzed sample has high purity and few impurities.

anti-Taq antibodies corresponding to Taq DNA polymerase were purchased from sigma.

The mutant KOD DNA polymerase, Taq DNA polymerase and anti-Taq antibody were stored separately for use.

EXAMPLE 2 use of PCR amplification kit

Using 25. mu.L as an example, the solution preparation was carried out in accordance with the PCR amplification system described in Table 1 below.

Table 1: recommended PCR amplification system

The invention recommends the use of the self-contained 2 XPCR Enhancer in the kit, which is beneficial to amplifying the micro template DNA. The use of GC buffer is recommended for amplification of the template if the GC content exceeds 50%.

The recommended PCR reaction conditions are shown in Table 2 below:

table 2: PCR reaction conditions

Note that: and selecting a proper number of cycles and a proper annealing temperature to avoid specific amplification bands.

Example 3 detection of different PCR reaction conditions

The following amplification primers were designed using a DNA fragment (PET-28a) of 2.9Kb in length as a template,

amplification primers for the 2.9Kb fragment:

PET-28a-F: ATCCGGATATAGTTCCTCCT (shown as SEQ ID No. 3)

PET-28a-R: CAGTATACACTCCGCTATGC (shown as SEQ ID No. 4)

MgC1 in PCR buffer was varied in gradient with all other reaction conditions₂(NH) concentration (0 mmol/L-5 mmol/L)₄)₂SO₄(15 mmol/L-65 mmol/L), KCl (5 mmol/L-55 mmol/L) and pH (6.8-8.8) thereof, performing a multi-group PCR reaction, and characterizing the catalytic activity of KTaq MIX DNA Polymerase (mixed type hot start DNA Polymerase composition) in the PCR reaction by agarose electrophoresis of the PCR product. The brighter the PCR product band, the higher the efficiency of the PCR reaction, i.e., the higher the reactivity of KTaq MIX DNA Polymerase, and the gel electrophoresis pattern is shown in FIG. 5.

As can be seen from the electrophoresis chart of the PCR results of each group, the optimum pH value is 8(25mmol/L Tris-HCl), MgCl₂The optimum value is 2mmol/L, (NH)₄)₂SO₄The optimal value is 60mmol/L, and the optimal value of KCl is 50 mmol/L.

Example 4 detection of different enzyme Activity ratios

The enzyme activity units Taq: KODm of Taq DNA polymerase and KOD DNA polymerase were mixed at a ratio of 1U:10U/1U:20U/1U:40U/1U:80U/1U:160U/1U:320U, respectively, and the ratio converted to volume (. mu.L) was 1:6/1:12/1:24/1:48/1:96/1:192, respectively. mu.L of the PCR system and the conditions recommended in example 2 were used to amplify Gp 32.

Primer of Gp32 fragment:

gp32-F: CGGGATCCATGTTTAAACGTAAAAGCA (shown as SEQ ID No. 5)

Gp32-R: CCCTCGAGCAGATCATTCAGCAGATCG (shown as SEQ ID No. 6)

The results of gel electrophoresis are shown in FIG. 6, and the brighter the PCR product band, the higher the efficiency of the PCR reaction. It can be seen that the ratio of enzyme activity between Taq DNA polymerase and mutant KOD DNA polymerase (Taq: KODm) is 1: amplification can be realized in 10U-320U, and the better enzyme activity ratio (Taq: KODm) of Taq DNA polymerase and mutant KOD DNA polymerase is 1: 80U-160U. Whereas mutant KOD DNA polymerase (KODm) alone had little amplification of Gp 32. As a result, the amplification was best when the volume ratio of KODm to Ptaq was 1:96 (the enzyme activity ratio of Taq DNA polymerase to mutant KOD DNA polymerase was 1: 160U).

EXAMPLE 5PCR amplification kit

The kit comprises Taq DNA polymerase, anti-Taq antibody and mutant KOD DNA polymerase, PCR buffer, PCR enhancer, GC amplification buffer and dNTP in example 1.

According to the optimized conditions of examples 2-4, the prepared PCR buffer solution contains 25mmol/L Tris-HCl (pH8.0) and 2mmol/L MgCl₂60mmol/L of (NH)₄)₂SO₄And KCl of 50 mmol/L. The PCR enhancer is betaine. The enzyme activity units of Taq DNA polymerase and KOD DNA polymerase are 1U: 160U.

In addition, the anti-Taq antibody was added at the time of use in such a manner that the concentration of Taq DNA polymerase and anti-Taq antibody was 3: 2.

And adding GC buffer when the GC content of the amplified template is more than 50%. The GC amplification buffer contained 50mmol/L Tris-HCl (pH8.8), 100mmol/L KCl, 5mmol/L MgCl₂25mmol/L of (NH)₄)₂SO₄Dimethyl sulfoxide (DMSO) with a volume fraction of 2%, Tween20 with a volume fraction of 0.005%, Triton-x-100 with a volume fraction of 0.002% and BSA with a mass fraction of 1 mg/mL.

The dNTPs contain dATP, dGTP, dTTP, dCTP.

Performance evaluation of the PCR amplification kit of example 5

First, evaluation of amplification Rate

When amplifying fragments of 1kb to 10kb using lambda DNA as a template, the annealing time was set to 5sec, the extension time was set to 10sec and 30sec, and the amount of template lambda DNA added was 1 ng/50. mu.L. PCR amplification conditions: 98 ℃ 10sec.55 ℃ 5sec.72 ℃ 10or 30sec (30 cycles).

Primers for the 1Kb fragment:

GGGCGGCGAC CTCGCGGGTT (shown as SEQ ID No. 7)

AGATAAGGGTGTTGCGCTGC (shown as SEQ ID No. 8)

Primers for the 2Kb fragment:

GGGCGGCGAC CTCGCGGGTT (shown as SEQ ID No. 9)

2-R: ATTTCTGCACCATTCCGGCG (shown as SEQ ID No. 10)

Primers for the 4Kb fragment:

GGGCGGCGAC CTCGCGGGTT (shown as SEQ ID No. 11)

4-R: TCGCCTGACGGGATGCGACG (shown as SEQ ID No. 12)

Primers for the 6Kb fragment:

GGGCGGCGAC CTCGCGGGTT (shown as SEQ ID No. 13)

TCCTCATAACGGAACGTGCC (shown as SEQ ID No. 14)

Primers for the 8Kb fragment:

8-F: GGGCGGCGAC CTCGCGGGTT (shown as SEQ ID No. 15)

8-R: GATGAAGCAACGCGGTTAAT (shown as SEQ ID No. 16)

Primers for the 10Kb fragment:

GGGCGGCGAC CTCGCGGGTT (shown as SEQ ID No. 17)

10-R: TTATTCACCACAAACTCATA (shown as SEQ ID No. 18)

mu.L of the amplification product was subjected to 1% gel electrophoresis, and the results are shown in FIG. 7 below. The result shows that the amplification effect of 30sec extension is good, the band is clear, and the amplification rate of the mixed type hot start DNA Polymerase composition (KTaq MIX DNA Polymerase) can reach at least 30sec/Kb, and the amplification efficiency is high. The DNA template with 8Kb and 10Kb large fragments can still be well amplified.

Second, evaluation of thermal stability

The HKMT gene of Trichoderma reesei was amplified according to the PCR system and conditions recommended in example 2 using the following polymerases:

the company A/B/C commercial enzyme;

KTaq MIX DNA Polymerase (mixed hot start DNA Polymerase composition) formed with Taq DNA Polymerase, anti-Taq antibody and mutant KOD DNA Polymerase in the proportions recommended in example 5 of the present application; and

a mixed enzyme of Taq DNA polymerase and a commercially available KOD DNA polymerase without mutation (compared to a mixed hot start DNA polymerase composition: histidine at position 147 of KOD DNA polymerase is not mutated, and an anti-Taq antibody is not added).

Then, each group of polymerases is put at 37 ℃ and baked for 6 days, and the same gene Trichoderma reesei HKMT gene is amplified under the same conditions according to the PCR system and conditions. Primers for trichoderma reesei HKMT gene:

HKMT-F: CTTGCACACGCATTGCAAGAGG (shown as SEQ ID No. 19)

HKMT-R: GTTCTTATCACCATTCTTCCTCC (shown as SEQ ID No. 20)

The gel electrophoresis pattern of the amplified product is shown in FIG. 8, where 1 represents before baking and 2 represents after baking. The amplification products of the pre-baking KTaq MIX DNA Polymerase (mixed hot start DNA Polymerase composition) were comparable to the commercial enzymes of company A/B/C. However, after baking for 6 days at 37 ℃, the mixed hot start DNA polymerase composition still has a good amplification effect, which indicates that the mixed hot start DNA polymerase composition has good thermal stability, the polymerase can be prepared at room temperature, and the operation is simple and convenient without being finished on ice.

Evaluation of polymerization Capacity

Human genome DNA is used as a template, and different primers are used for amplifying different gene segments of A/B/C/D.

The A gene is NADPH gene

NADPH-F: GGCCGCTGGGCGTCCACGCC (shown as SEQ ID No. 21)

NADPH-R: CAAGTGCAAGCAGCCTTAGG (shown as SEQ ID No. 22)

The B gene is MUC4 gene MUC 4-F: GAATTCTTCCCTGAGACTTT (shown as SEQ ID No. 23)

MUC 4-R: AGGAGAGGTGCTTGTGGAAT (shown as SEQ ID No. 24)

The C gene is OBSCN gene

OBSCN-F: ACAGTGTCCGCCTGTCCTTT (shown as SEQ ID No. 25)

OBSCN-R: TACATGAATGATTATAGCA (shown as SEQ ID No. 26)

The D gene is the MUC16 gene

MUC 16-F: AGGTAAGTGGGACTGGGCTG (shown as SEQ ID No. 27)

MUC 16-R: GGGTGGATTACCTGAGGTCA (shown as SEQ ID No. 28)

The sizes of the target genes A/B/C/D are respectively 4.5Kb, 5Kb, 7.5Kb and 9.0 Kb. Amplification was performed according to the PCR system and conditions recommended in example 2. Template DNA was used at three different concentrations: 50ng, 5ng and 0.5 ng. mu.L of the amplification product was subjected to 1% gel electrophoresis, and the results are shown in FIG. 9 below. The results showed that gene fragments of different sizes could be amplified, and that the band could be amplified even at the lower template concentration of 0.5 ng.

Fourth, evaluation of sensitivity

Amplifying a GPR98 gene (6.0 Kb in size) fragment by using human genome DNA as a template,

primer for GPR98 gene:

GPR 98-F: ATGGGTCCTATTGGAGCAGA (shown as SEQ ID No. 29)

GPR 98-R: AGGTCAGGAGATCGAGACCA (shown as SEQ ID No. 30)

Amplification was performed according to the PCR system and conditions recommended in example 2. The template DNA was prepared at seven different concentrations: 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10 fg.

Meanwhile, other three commercial high-fidelity enzymes (Pfu-fusion, Taq plus and KD plus) are simultaneously amplified for comparison. mu.L of the amplification product was subjected to 1% gel electrophoresis, and the results are shown in FIG. 10 below. The results show that the KTaq MIX DNApolymerase (KTq MIX) can amplify a band under the condition that the template concentration is 100fg, but the other three high fidelity enzymes can not amplify the band. Indicating that KTaq MIX DNA Polymerase has ultrahigh sensitivity.

Fifthly, evaluation of amplification effect of high GC content template

Human genome DNA is taken as a template, and the GC contents of the template DNA are respectively as follows: 47%, 58%, 60%, 64%, 67%, 79%, 84%. The primers for the different genes are used to amplify the fragments,

primers amplifying 47% GC content:

GC-1-F: GTCTCTCTGAGTATCATCTT (shown as SEQ ID No. 31)

GC-1-R: CATGGGAAGAGGCAAACAGT (shown as SEQ ID No. 32)

Primers amplifying 58% GC content:

GTCTCTCTGAGTATCATCTT (shown as SEQ ID No. 33) is GC-2-F

GC-2-R: TAAATAAAATAAAAAAGGAG (shown as SEQ ID No. 34)

Primers amplifying 60% GC content:

GC-3-F: GTCTCTCTGAGTATCATCTT (shown as SEQ ID No. 35)

GC-3-R: CCTGCAATCCCAGCACTTTG (shown as SEQ ID No. 36)

Primers amplifying 64% GC content:

GTCTCTCTGAGTATCATCTT (shown as SEQ ID No. 37) is GC-4-F

GC-4-R: AAACCACCATGGCACATATA (shown as SEQ ID No. 38)

Primers amplifying 67% GC content:

GC-5-F: GTCTCTCTGAGTATCATCTT (shown as SEQ ID No. 39)

GC-5-R: ACTGCATGTTTTCACTCATA (shown as SEQ ID No. 40)

Primers amplifying 79% GC content:

GTCTCTCTGAGTATCATCTT (shown as SEQ ID No. 41)

GC-6-R: CAACCCAAATGTCCATCAGT (shown as SEQ ID No. 42)

Primers amplifying 84% GC content:

GTCTCTCTGAGTATCATCTT (shown as SEQ ID No. 43)

GC-7-R: TGCCCAAAGGAATATAAATC (shown as SEQ ID No. 44)

Amplification was performed according to the PCR system and conditions recommended in example 2, and simultaneously amplified with three other commercially available high fidelity enzymes (Pfu-fusion, KD plus, Taq plus) for comparison. During amplification, GC amplification buffer was added. mu.L of the amplification product was subjected to 1% gel electrophoresis, and the results are shown in FIG. 11 below.

The results show that the KTaq MIX DNA Polymerase (KTq MIX) can also amplify a band under the condition that the GC content of the template is 84%, and the other three high fidelity enzymes can not amplify the band. Indicating that KTaq MIX DNA Polymerase (mixed hot start DNA Polymerase composition) is able to amplify difficult templates.

Sixth, evaluation of Fidelity

A gene fragment of 1Kb in size was amplified using lambda DNA as a template.

Primers for the 1Kb fragment:

GGGCGGCGAC CTCGCGGGTT (shown as SEQ ID No. 7)

AGATAAGGGTGTTGCGCTGC (shown as SEQ ID No. 8)

The amplification was carried out according to the PCR system and conditions recommended in example 2, using the following polymerases:

taq DNA polymerase (Taq);

company a high fidelity enzyme KOD DNA polymerase (KOD);

the company A high fidelity enzyme Pfu DNA polymerase (Pfu);

KTaq MIX DNA Polymerase (KTaq MIX, mixed hot start DNA Polymerase composition) was formed with Taq DNA Polymerase, anti-Taq antibody and mutant KOD DNA Polymerase in the proportions recommended in example 5 of the present application.

Cutting the gel to recover the target fragment, performing double enzyme digestion by using corresponding enzyme, performing double enzyme digestion on the vector PUC19, and purifying and recovering the target fragment and the vector. The fragments having the same cohesive ends were ligated and transformed into JM109, and plated on ampicillin plates containing Xgal and IPTG, and after culturing for 16h, the growth of the plates was observed and counted, according to the formula

The fidelity was calculated as f ═ ln (f)/d × (bp),

wherein. White colloids/Total colloids (White clones/Total clones),

d is the number of template doublings.

The statistical results are shown in FIG. 12 below, with the results shown: KTaq MIX DNA Polymerase (KTq MIX, Mixed type Hot Start DNA polymerization) of the present applicationEnzyme composition) can reach 1.01 multiplied by 10^-6The fidelity is 50 times higher than that of common Taq enzyme and 2-4 times higher than that of high fidelity enzyme KOD DNA polymerase and Pfu DNA polymerase on other markets.

The above-mentioned embodiments only express one or several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shenzhen ai Weidi Biotech limited

<120> mixed type hot start DNA polymerase composition, PCR amplification kit and application thereof

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 774

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ile Leu Asp Thr Asp Tyr Ile Thr Glu Asp Gly Lys Pro Val Ile

1 5 10 15

Arg Ile Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg

20 25 30

Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile

35 40 45

Glu Glu Val Lys Lys Ile Thr Ala Glu Arg His Gly Thr Val Val Thr

50 55 60

Val Lys Arg Val Glu Lys Val Gln Lys Lys Phe Leu Gly Arg Pro Val

65 70 75 80

Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile

85 90 95

Arg Asp Lys Ile Arg Glu His Pro Ala Val Ile Asp Ile Tyr Glu Tyr

100 105 110

Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Val Pro

115 120 125

Met Glu Gly Asp Glu Glu Leu Lys Met Leu Ala Phe Asp Ile Glu Thr

130 135 140

Leu Tyr Lys Glu Gly Glu Glu Phe Ala Glu Gly Pro Ile Leu Met Ile

145 150 155 160

Ser Tyr Ala Asp Glu Glu Gly Ala Arg Val Ile Thr Trp Lys Asn Val

165 170 175

Asp Leu Pro Tyr Val Asp Val Val Ser Thr Glu Arg Glu Met Ile Lys

180 185 190

Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr

195 200 205

Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu

210 215 220

Lys Leu Gly Ile Asn Phe Ala Leu Gly Arg Asp Gly Ser Glu Pro Lys

225 230 235 240

Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile

245 250 255

His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr

260 265 270

Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Gln Pro Lys Glu

275 280 285

Lys Val Tyr Ala Glu Glu Ile Thr Thr Ala Trp Glu Thr Gly Glu Asn

290 295 300

Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr

305 310 315 320

Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ala Gln Leu Ser Arg Leu

325 330 335

Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu

340 345 350

Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala

355 360 365

Pro Asn Lys Pro Asp Glu Lys Glu Leu Ala Arg Arg Arg Gln Ser Tyr

370 375 380

Glu Gly Gly Tyr Val Lys Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile

385 390 395 400

Val Tyr Leu Asp Phe Arg Ser Leu Tyr Pro Ser Ile Ile Ile Thr His

405 410 415

Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp

420 425 430

Val Ala Pro Gln Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe

435 440 445

Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys

450 455 460

Lys Lys Met Lys Ala Thr Ile Asp Pro Ile Glu Arg Lys Leu Leu Asp

465 470 475 480

Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly Tyr

485 490 495

Tyr Gly Tyr Ala Arg Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser

500 505 510

Val Thr Ala Trp Gly Arg Glu Tyr Ile Thr Met Thr Ile Lys Glu Ile

515 520 525

Glu Glu Lys Tyr Gly Phe Lys Val Ile Tyr Ser Asp Thr Asp Gly Phe

530 535 540

Phe Ala Thr Ile Pro Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala

545 550 555 560

Met Glu Phe Leu Lys Tyr Ile Asn Ala Lys Leu Pro Gly Ala Leu Glu

565 570 575

Leu Glu Tyr Glu Gly Phe Tyr Glu Arg Gly Phe Phe Val Thr Lys Lys

580 585 590

Lys Tyr Ala Val Ile Asp Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu

595 600 605

Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala

610 615 620

Arg Val Leu Glu Ala Leu Leu Lys Asp Gly Asp Val Glu Lys Ala Val

625 630 635 640

Arg Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro

645 650 655

Pro Glu Lys Leu Val Ile His Glu Gln Ile Thr Arg Asp Leu Lys Asp

660 665 670

Tyr Lys Ala Thr Gly Pro His Val Ala Val Ala Lys Arg Leu Ala Ala

675 680 685

Arg Gly Val Lys Ile Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu

690 695 700

Lys Gly Ser Gly Arg Ile Gly Asp Arg Ala Ile Pro Phe Asp Glu Phe

705 710 715 720

Asp Pro Thr Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln

725 730 735

Val Leu Pro Ala Val Glu Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys

740 745 750

Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Ser Ala Trp

755 760 765

Leu Lys Pro Lys Gly Thr

770

<210> 2

<211> 832

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu

1 5 10 15

Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly

20 25 30

Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala

35 40 45

Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile Val

50 55 60

Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly

65 70 75 80

Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu

85 90 95

Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg Leu Glu

100 105 110

Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys

115 120 125

Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp

130 135 140

Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Ala Leu His Pro Glu Gly

145 150 155 160

Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg Pro

165 170 175

Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn

180 185 190

Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu

195 200 205

Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp Arg Leu

210 215 220

Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys

225 230 235 240

Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val

245 250 255

Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe

260 265 270

Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu

275 280 285

Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu Gly

290 295 300

Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp

305 310 315 320

Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro

325 330 335

Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu

340 345 350

Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro

355 360 365

Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn

370 375 380

Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu

385 390 395 400

Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu

405 410 415

Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu

420 425 430

Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly

435 440 445

Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala

450 455 460

Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His

465 470 475 480

Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp

485 490 495

Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys Arg

500 505 510

Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile

515 520 525

Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser Thr

530 535 540

Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu

545 550 555 560

His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser

565 570 575

Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln

580 585 590

Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala

595 600 605

Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly

610 615 620

Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His Thr

625 630 635 640

Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro

645 650 655

Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly

660 665 670

Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu

675 680 685

Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg

690 695 700

Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val

705 710 715 720

Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg

725 730 735

Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro

740 745 750

Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu

755 760 765

Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His

770 775 780

Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala

785 790 795 800

Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro

805 810 815

Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu

820 825 830

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atccggatat agttcctcct 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cagtatacac tccgctatgc 20

<210> 5

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgggatccat gtttaaacgt aaaagca 27

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccctcgagca gatcattcag cagatcg 27

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gggcggcgac ctcgcgggtt 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agataagggt gttgcgctgc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gggcggcgac ctcgcgggtt 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atttctgcac cattccggcg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gggcggcgac ctcgcgggtt 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tcgcctgacg ggatgcgacg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gggcggcgac ctcgcgggtt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcctcataac ggaacgtgcc 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gggcggcgac ctcgcgggtt 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gatgaagcaa cgcggttaat 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gggcggcgac ctcgcgggtt 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ttattcacca caaactcata 20

<210> 19

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cttgcacacg cattgcaaga gg 22

<210> 20

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gttcttatca ccattcttcc tcc 23

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ggccgctggg cgtccacgcc 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caagtgcaag cagccttagg 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gaattcttcc ctgagacttt 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

aggagaggtg cttgtggaat 20

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

acagtgtccg cctgtccttt 20

<210> 26

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tacatgaatg attatagca 19

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

aggtaagtgg gactgggctg 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

gggtggatta cctgaggtca 20

Claims (7)

1. A mixed hot start DNA polymerase composition, which consists of Taq DNA polymerase, an anti-Taq antibody and a mutant KOD DNA polymerase, wherein the anti-Taq antibody can be specifically combined with the Taq DNA polymerase, and the mutant KOD DNA polymerase is obtained by mutating histidine at position 147 of wild type KOD DNA polymerase into lysine; the concentration ratio of the Taq DNA polymerase to the anti-Taq antibody is 3: 2; the mutant KOD DNA polymerase is a protein consisting of an amino acid sequence shown in SEQ ID No. 1; the enzyme activity ratio of the TaqDNA polymerase to the mutant KOD DNA polymerase is 1U: (80U-160U).

2. A PCR amplification kit comprising the mixed hot start DNA polymerase composition of claim 1.

3. The PCR amplification kit of claim 2, further comprising a GC amplification buffer solution, wherein the GC amplification buffer solution comprises 40 to 60mmol/L Tris-HCl, 50 to 150mmol/L KCl, and 2 to 8mmol/L MgCl₂20 to 30mmol/L of (NH)₄)₂SO₄Dimethyl sulfoxide with the volume fraction of 1-3 percent, Tween20 with the volume fraction of 0.001-0.01 percent, Triton-x-100 with the volume fraction of 0.001-0.01 percent and BSA with the mass fraction of 0.5-5 mg/mL.

4. The PCR amplification kit of claim 2, further comprising a PCR buffer solution and a PCR enhancer, wherein the PCR buffer solution contains 10 to 30mmol/L Tris-HCl, 0.5 to 5mmol/L MgCl₂50 to 80mmol/L of (NH)₄)₂SO₄And KCl of 40 mmol/L-60 mmol/L, and the PCR enhancer is betaine.

5. The use of the PCR amplification kit according to any one of claims 2 to 4 for amplifying DNA, comprising the steps of:

mixing the DNA amplification template, the primers and the PCR amplification kit to obtain an amplification system; and

and (3) placing the amplification system in a PCR instrument for PCR amplification.

6. The use of claim 5, wherein the GC content of the DNA amplification template is 65% or more.

7. The use according to claim 5, wherein the DNA amplification template is present in the amplification system in an amount of 1pg or less.

Images