CN108546749A - Mixed type thermal starting archaeal dna polymerase composition, PCR amplification kit and its application - Google Patents

Abstract

The invention discloses a kind of mixed type thermal starting archaeal dna polymerase composition, PCR amplification kit and its applications, Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases, wherein, anti- Taq antibody can be specifically bound with Taq archaeal dna polymerases, and saltant type KOD archaeal dna polymerases the 147th Histidine mutagenesis compared with wild type KOD archaeal dna polymerases is lysine.The experimental results showed that, above-mentioned mixed type thermal starting archaeal dna polymerase composition, mismatch rate is low when for PCR amplification, dual characteristics with efficient amplification and hi-fi, heat-resisting good when for expanding, the template of template or high GC content either to longer DNA fragmentation or low template quantity all has preferable expanding effect.

Description

Mixed type thermal starting archaeal dna polymerase composition, PCR amplification kit and its application

Technical field

The present invention relates to field of molecular biotechnology, more particularly to a kind of mixed type thermal starting archaeal dna polymerase composition, PCR amplification kit and its application.

Background technology

PCR amplification (PCR) is a kind of for amplifying the molecular biology skill for expanding specific DNA fragmentation Art, it is considered as the special DNA replication dna of in vitro.Its principle is to utilize DNA 95 DEG C of high temperature time variation meetings Celsius in vitro Become single-stranded, primer is combined with single-stranded by the principle of base pair complementarity when low temperature (often 60 DEG C or so).Temperature regulating is extremely again Archaeal dna polymerase optimal reactive temperature (72 DEG C or so), archaeal dna polymerase is mutual along the direction composition of phosphoric acid to pentose (5'-3') Mend chain.

Archaeal dna polymerase (DNA polymerase) is the enzyme to play a crucial role in repetition DNA.Archaeal dna polymerase is mainly It is to replicate template with DNA, the enzyme at 3 ' ends is copied to DNA is held by 5 '.Most of archaeal dna polymerase is purification of fermentation production at present Object obtains, or carries out antibody or chemical modification to zymoprotein to reach thermal starting.Weigh archaeal dna polymerase fidelity one is general Standard is mismatch rate, and mismatch rate more poor replication fidelity is better.The mismatch rate expanded to sample with common archaeal dna polymerase generally exists 10^-5Base/recurring number.Very strict experiment, such as genescreen, sequencing, abrupt climatic change are required for mismatch rate, commonly Archaeal dna polymerase far can not be met the requirements.Although the KOD archaeal dna polymerases newly gone out can reduce mismatch rate to a certain extent, However mismatch rate still needs to be further decreased, and the polymerizing power of KOD archaeal dna polymerases is generally poor, to the mesh compared with long segment Mark DNA is difficult to amplify.In addition, traditional archaeal dna polymerase for template quantity be 1pg amplification templates below and G/C content compared with Height amplification template, expanding effect is bad, does not meet more highly sensitive and accuracy detection demand.

Invention content

Based on this, it is necessary to provide a kind of amplification to compared with the target dna of long segment or low template quantity and high GC content Template all has the archaeal dna polymerase of preferable expanding effect.

In addition, there is a need to a kind of PCR amplification kit of offer and its application.

A kind of mixed type thermal starting archaeal dna polymerase composition, including Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases, wherein the anti-Taq antibody can be specifically bound with the Taq archaeal dna polymerases, the saltant type KOD archaeal dna polymerases are obtained by the 147th Histidine mutagenesis of wild type KOD archaeal dna polymerases for lysine.

In one embodiment, the saltant type KOD archaeal dna polymerases include：

(a) protein that amino acid sequence forms shown in SEQ ID No.1；Or,

(b) by replacing, missing or adding one or several amino acid in the amino acid sequence shown in SEQ ID No.1 And the protein derived from (a) with the saltant type KOD DNA polymerase activities.

In one embodiment, the enzyme activity ratio of the Taq archaeal dna polymerases and the saltant type KOD archaeal dna polymerases is 1：10U~320U.

In one embodiment, the enzyme activity ratio of the Taq archaeal dna polymerases and the saltant type KOD archaeal dna polymerases is 1：80U~160U.

A kind of PCR amplification kit, including mixed type thermal starting archaeal dna polymerase composition described in any one of the above embodiments.

In one embodiment, further include GC amplification buffers, in the GC amplification buffers containing 40mmol/L~ The MgCl of KCl, 2mmol/L of Tris-HCl, 50mmol/L of 60mmol/L~150mmol/L~8mmol/L₂、20mmol/L (the NH of~30mmol/L₄)₂SO₄, volume fraction be 1%~3% dimethyl sulfoxide (DMSO), volume fraction be 0.001%~0.01% Tween20, volume fraction be 0.001%~0.01% Triton-x-100 and mass fraction be 0.5mg/mL~5mg/mL BSA.

In one embodiment, further include PCR buffer solutions and PCR reinforcing agents, contain in the PCR buffer solutions The MgCl of Tris-HCl, 0.5mmol/L of 10mmol/L~30mmol/L~5mmol/L₂, 50mmol/L~80mmol/L (NH₄)₂SO₄And the KCl of 40mmol/L~60mmol/L, the PCR reinforcing agents are glycine betaine.

Application of the PCR amplification kit described in any one of the above embodiments in DNA amplification, includes the following steps：

DNA cloning template, PCR buffer solutions and mixed type thermal starting archaeal dna polymerase composition are mixed to get amplification body System；

The amplification system is placed in PCR instrument and carries out PCR amplification.

In the application of an embodiment, G/C content is 65% or more in the DNA cloning template.

In the application of an embodiment, the content of the DNA cloning template in the amplification system be 1pg with Under.

The experimental results showed that Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases are combined to be formed it is mixed Mould assembly thermal starting archaeal dna polymerase composition, it is low to be used for mismatch rate when PCR amplification, dual with efficient amplification and hi-fi Feature, and unexpectedly Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases are for possible when expanding Certain synergistic effect has occurred so that mixed type thermal starting archaeal dna polymerase composition is heat-resisting good, so that configuration amplified reaction When system, it can prepare at room temperature, it is easy to operate without completing on ice.And either to longer DNA fragmentation or low mould The template of plate amount or the template of high GC content all have preferable expanding effect, can be used in genescreen, sequencing, abrupt climatic change Deng.

Description of the drawings

Fig. 1 is the saltant type KOD archaeal dna polymerases purification process for preparing and each protein sample after purification in embodiment 1 SDS-PAGE schemes；

Fig. 2 is the SDS-PAGE figures of the front and back protein sample of Taq archaeal dna polymerases induction prepared in embodiment 1；

Fig. 3 is the SDS-PAGE figures of the protein sample of the Taq archaeal dna polymerase purification process prepared in embodiment 1；

Fig. 4 is the SDS-PAGE of the Taq archaeal dna polymerases that the prepare protein sample of each concentration after purification in embodiment 1 Figure；

Fig. 5 is the agarose electrophoresis figure of the PCR product under different PCR reaction conditions in embodiment 3；

Fig. 6 is the Taq archaeal dna polymerases and saltant type KOD archaeal dna polymerases of different enzyme activity ratios in embodiment 4 to Gp32 The Gel electrophoresis results comparison diagram of product after amplification；

Fig. 7 be in test case one under different extension of time to the Gel electrophoresis results of product of DAN fragment amplifications compare Figure；

Fig. 8 be in test case two mixed type thermal starting archaeal dna polymerase composition and control group polymerase before heat treatment after Respectively expand trichoderma reesei HKMT genes after product Gel electrophoresis results comparison diagram；

Fig. 9 is mixed type thermal starting archaeal dna polymerase composition in test case three for after expanding different size target gene The Gel electrophoresis results comparison diagram of product；

Figure 10 is for mixed type thermal starting archaeal dna polymerase composition in test case four with control group polymerase to various concentration The Gel electrophoresis results comparison diagram of product after template DNA amplification；

Figure 11 is for mixed type thermal starting archaeal dna polymerase composition in test case five from control group polymerase to different G/C contents Template DNA amplification after product Gel electrophoresis results comparison diagram；

Figure 12 is the result of mixed type thermal starting archaeal dna polymerase composition and control group polymerase fidelity in test case six Comparison diagram.

Specific implementation mode

In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, with reference to specific embodiment and Attached drawing is described in detail the specific implementation mode of the present invention.Elaborate in the following description many details in order to Fully understand the present invention.But the invention can be embodied in many other ways as described herein, art technology Personnel can do similar improvement without violating the connotation of the present invention, therefore the present invention is not by following public specific implementation Limitation.

The mixed type thermal starting archaeal dna polymerase composition of one embodiment, including Taq archaeal dna polymerases, anti-Taq antibody and Saltant type KOD archaeal dna polymerases, wherein anti-Taq antibody can be specifically bound with Taq archaeal dna polymerases, saltant type KOD DNA Polymerase sports lysine (K) by the 147th histidine (H) of wild type KOD archaeal dna polymerases and obtains.

It should be noted that Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases can preselect it is mixed It closes, exists in the form of blend compositions.Can also be Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD DNA polymerizations Enzyme can store respectively, be added in reaction system on demand again when in use.

In one embodiment, saltant type KOD archaeal dna polymerases include：(a) amino acid shown in SEQ ID No.1 The protein of sequence composition；Or, (b) by replacing, missing or adding one in the amino acid sequence shown in SEQ ID No.1 Or several amino acid and with saltant type KOD DNA polymerase activities the protein derived from (a).Saltant type KOD Archaeal dna polymerase advanced optimizes the Taq archaeal dna polymerases of wild type, by the 407th~766 amino acid and the 852nd~ 1388 amino acids lack, and reduce unnecessary spliceosome, and the 147th histidine (H) is sported lysine (K).Table It is small up to segment, and it is only mutated a site, the site of mutation is few, is easy to prepare.

It is appreciated that there are many codons due to the same amino acid of coding, the coded sequence of polypeptide has polymorphism And the characteristics of variation.Therefore one or several by replacing, missing or adding in the amino acid sequence shown in SEQ ID No.1 The protein of amino acid and saltant type KOD DNA polymerase activities with the application, or without apparent function difference, also wrap It includes within the scope of the invention.

Saltant type KOD archaeal dna polymerases, which can improve, reduces the mismatch rate of amplification.Its mismatch rate is poly- with wild type KOD DNA Synthase under conditions of opposite radix is very low, significantly improves the sensitivity of amplification compared to that can reduce 50%.And expect Less than discovery, the mixed type thermal starting that saltant type KOD archaeal dna polymerases and Taq archaeal dna polymerases, anti-Taq antibody are formed The template of template or high GC content of the archaeal dna polymerase composition either to longer DNA fragmentation or low template quantity has There is preferable expanding effect, illustrates that certain synergistic effect has occurred in three when for expanding.

Specifically, Taq archaeal dna polymerases are a kind of high temperature stables from Thermophilic Bacteria Thermus aquaticus Archaeal dna polymerase is widely used in good characteristics such as high temperature resistant, higher specificity in PCR amplification.But Taq Archaeal dna polymerase is before first cycle denaturation of PCR, and there are one the process (such as 95 DEG C) to heat up, during which primer and template meetings There are some non-specificity pairings, if at this moment Taq enzyme plays activity, be just easy to generate non-specific amplification, due to recycling just Phase template quantity is considerably less, and the non-specific band of generation passes through subsequent exponential amplification, will severe jamming target fragment expansion Increase, even resulting in specific band cannot expand.It is introduced in the mixed type thermal starting archaeal dna polymerase composition of present embodiment Anti- Taq antibody, anti-Taq antibody are the corresponding antibody of Taq archaeal dna polymerases, can be specifically bound with Taq archaeal dna polymerases, Before high-temperature heating, anti-Taq antibody is suppressed with Taq DNA polymerase activities, will not lead to non-specific amplification.It is high-temperature denatured Afterwards, anti-Taq antibody is detached with Taq archaeal dna polymerases, and Taq archaeal dna polymerases restore catalytic activity, make the primer of specific binding Extend, to substantially increase sensitivity and the specificity of PCR reactions.

In one embodiment, mixed type thermal starting archaeal dna polymerase composition in use, Taq archaeal dna polymerases with it is anti- A concentration of the 1~100 of Taq antibody:1~100, such as 3:2.

In one embodiment, Taq archaeal dna polymerases include：(a) the amino acid sequence group shown in SEQ ID No.2 At protein；Or, (b) one or several by replacing, missing or adding in the amino acid sequence shown in SEQ ID No.2 Amino acid and the protein derived from (a) with the Taq DNA polymerase activities.Taq with above-mentioned amino acid sequence Archaeal dna polymerase is the Taq archaeal dna polymerases (HiFi TaqDNA polymerase) of high-fidelity, further decreases mistake when amplification With rate.Correspondingly, anti-Taq antibody is the antibody of the Taq archaeal dna polymerases of anti-high-fidelity.

Similarly, due to encoding there are many codons of same amino acid, the coded sequence of polypeptide have polymorphism and The characteristics of variation.Therefore by replacing, missing or adding one or several ammonia in the amino acid sequence shown in SEQ ID No.2 The protein of base acid and the Taq DNA polymerase activities with the application, or without apparent function difference, it is also included within this hair In bright range.

In one embodiment, mixed type thermal starting archaeal dna polymerase composition in use, Taq archaeal dna polymerases with it is prominent The enzyme activity ratio of modification KOD archaeal dna polymerases is 1：10U~320U.Enzyme activity ratio within the scope of this, expanding effect is best, the item of acquisition Band is clear, and miscellaneous band is few.

Further, in use, the enzyme activity ratio of Taq archaeal dna polymerases and saltant type KOD archaeal dna polymerases is 1：80U~ 160U.Enzyme activity ratio within the scope of this, expanding effect is more preferable, and the band of acquisition is clear, and miscellaneous band is less.

Above-mentioned mixed type thermal starting archaeal dna polymerase composition, including Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases.The mixed type thermal starting archaeal dna polymerase composition at least has the advantages that：(1) mixed type heat opens The heat-resisting good of archaeal dna polymerase composition is moved, so that when configuration amplification reaction system, can be prepared at room temperature, without in ice Upper completion, it is easy to operate.(2) progress reduces the mismatch rate expanded and significantly improves amplification under conditions of opposite radix is very low Sensitivity.(3) and saltant type KOD archaeal dna polymerases only need one site of mutation, and the site of mutation is few, is easy to prepare.(4) resist Body in conjunction with hot start method overcome the methods of chemical modification and physical barrier caused by need extend the pre-degeneration time and need Want several PCR cycles could fully released dna polymerase activity the shortcomings that, minimum to the damage of enzyme, use is more easy.(5) The template of template or high GC content either to longer DNA fragmentation or low template quantity all has preferable expanding effect.

In addition, the application also provides the PCR amplification kit of an embodiment, containing above-mentioned in the PCR amplification kit One mixed type thermal starting archaeal dna polymerase composition.

The feature of mixed type thermal starting archaeal dna polymerase composition can be found in above description, and therefore not to repeat here.

Certainly, PCR amplification kit can also include packing box, Packaging Bottle etc..

In kit, Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases can preselect mixing, Exist in the form of mixed enzyme.It can also be Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases to divide It does not store, is added in reaction system on demand again when in use.

In present embodiment, Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases can store up respectively It deposits, is added in reaction system on demand again when in use.

In one embodiment, in PCR amplification kit further include GC amplification buffers, contain in the GC amplification buffers Have KCl, 2mmol/L~8mmol/L's of Tris-HCl, 50mmol/L~150mmol/L of 40mmol/L~60mmol/L MgCl₂, 20mmol/L~30mmol/L (NH₄)₂SO₄, volume fraction be 1%~3% dimethyl sulfoxide (DMSO) (DMSO), volume The Triton-x-100 and quality that Tween20 that score is 0.001%~0.01%, volume fraction are 0.001%~0.01% Score is the BSA of 0.5mg/mL~5mg/mL.

Further, the Tris-HCl (pH8.8) containing 50mmol/L in the GC amplification buffers, 100mmol/L The MgCl of KCl, 5mmol/L₂, 25mmol/L (NH₄)₂SO₄, dimethyl sulfoxide (DMSO) (DMSO) that volume fraction is 2%, volume point Count the Tween20 for 0.005%, the BSA that the Triton-x-100 that volume fraction is 0.002% and mass fraction are 1mg/mL.

The GC amplification buffers of above-mentioned formula coordinate with mixed type thermal starting archaeal dna polymerase composition, can expand GC and contain Amount, which is more than 50% amplification template, or even G/C content is more than 80% amplification template can also expand.G/C content refers to the 4 of DNA In kind base, the ratio shared by guanine and cytimidine.

In one embodiment, in PCR amplification kit further include PCR buffer solutions.Contain in PCR buffer solutions The MgCl of Tris-HCl, 0.5mmol/L of 10mmol/L~30mmol/L~5mmol/L₂, 50mmol/L~80mmol/L (NH₄)₂SO₄And the KCl of 40mmol/L~60mmol/L.

Further, in the PCR buffer solutions Tris-HCl (pH8.0) containing 25mmol/L, 2mmol/L MgCl₂、 (the NH of 60mmol/L₄)₂SO₄And the KCl of 50mmol/L.

The PCR buffer solutions of above-mentioned formula for reaction suitable acid or alkali environment and salt ion environment are provided, with mixed type Thermal starting archaeal dna polymerase composition coordinates, and realizes high efficiency, highly sensitive amplification.

In one embodiment, in PCR amplification kit further include PCR reinforcing agents, PCR reinforcing agents are glycine betaine.PCR Reinforcing agent can enhance PCR polymerizing powers and specificity.

Further include dNTP etc. in PCR amplification kit in one embodiment.

Above-mentioned PCR amplification kit includes mixed type thermal starting archaeal dna polymerase composition, then coordinates and prepare meticulously PCR buffer solutions and PCR reinforcing agents etc. can be used in genescreen, sequencing, abrupt climatic change etc..

Application of any of the above-described PCR amplification kit in DNA amplification, includes the following steps：

S110, DNA cloning template, PCR buffer solutions and mixed type thermal starting archaeal dna polymerase composition are mixed to get expansion Increasing system.

S120, it amplification system is placed in PCR instrument carries out PCR amplification.

Specifically, reference can be made to the step of regular-PCR expands, mixed type thermal starting archaeal dna polymerase composition is added and is reacted In system, to DNA amplification sample.

Specifically, DNA cloning template can derive from human gene group DNA, phage DNA and filamentous fungus T. reesei DNA At least one of.Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases when expanding for may have occurred Certain synergistic effect can realize high sensitivity for human gene group DNA, phage DNA and filamentous fungus T. reesei DNA Amplification.

In the application of an embodiment, the G/C content in DNA cloning template is 50% or more.Such as DNA cloning mould G/C content in plate is 50%~90% etc..G/C content refers to 4 kinds of bases in DNA cloning template, guanine and cytimidine Shared ratio.

Further, the G/C content in DNA cloning template is 65% or more.Such as the G/C content in DNA cloning template is 65%~85% etc..

Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases when expanding for may have occurred certain Synergistic effect can realize highly sensitive amplification for the DNA profiling of high GC content.

In the application of an embodiment, the content of the DNA cloning template in amplification system is 1pg hereinafter, for example 10fg~1pg etc..

Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases when expanding for may have occurred certain Synergistic effect can realize the very low DNA sample of template content highly sensitive amplification.

To sum up, Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases are combined and forms mixed type heat and opens Dynamic archaeal dna polymerase composition, mismatch rate is low when for PCR amplification, the dual characteristics with efficient amplification and hi-fi, and goes out It is contemplated that Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases when expanding for may have occurred certain Kind synergistic effect so that mixed type thermal starting archaeal dna polymerase composition is heat-resisting good, so that when configuration amplification reaction system, It can prepare at room temperature, it is easy to operate without completing on ice.And either to longer DNA fragmentation or low template quantity Template or the template of high GC content all have preferable expanding effect, can be used in genescreen, sequencing, abrupt climatic change etc..

It is specific embodiment part below.

In following embodiment, unless otherwise instructed, test method without specific conditions, usually according to normal condition, For example, see Pehanorm Brooker, EF not Ritchie, T Mannies A Disi etc. (Jin Dongyan, Li Mengfeng etc. are translated) written molecular cloning (the Beijing experiment guide [M]：Science Press, 1992) method that condition or kit manufacturer described in are recommended is real It is existing.All operations are all made of this field standard openating procedure, and used reagent or carrier etc. are conventional reagent or conventional load Body.

In figure, Taq plus indicate that common commercially available Taq archaeal dna polymerases, Pfu-fusion indicate common commercially available Pfu Archaeal dna polymerase, KD plus indicate common commercially available KOD archaeal dna polymerases.KTaq MIX DNAPolymerase(KTq MIX) Indicate the mixed type thermal starting archaeal dna polymerase composition in the application.

Embodiment 1 prepares saltant type KOD archaeal dna polymerases

According to amino acid sequence purpose of design expressed sequence shown in SEQ ID No.1, and entrust gene chemical synthesis public Department is synthesized.The present embodiment entrusts the synthesis of Suzhou Hong Xun companies, and sequence verification obtains the gene table of specific locus mutation Up to segment.Destination gene expression sequence is transformed into BL21 (DE3) according to the method that kit is recommended carry out induced expression with And purifying, 90% the above object albumen of purity is obtained, albumen size is about 90KD.Purification process and each albumen after purification The SDS-PAGE of sample schemes the track as shown in Figure 1, the protein sample collected after " sample " expression induction marked on figure, " flowing through " indicates to flow through the sample of purification column, and B1~B5, C1~C5 and D1 are indicated in purification process with the miaow containing various concentration The sample that the wash buffer of azoles is collected.A1, A5 indicate the sample for the purifying collected.It can be seen that after induction BL21, saltant type KOD archaeal dna polymerase successful expressions, purity height, the impurity of the sample after dialysis are few.

Prepare Taq archaeal dna polymerases

According to amino acid sequence purpose of design expressed sequence shown in SEQ ID No.2, and entrust gene chemical synthesis public Department is synthesized.The present embodiment entrusts the synthesis of Suzhou Hong Xun companies.The side that destination gene expression sequence is recommended according to kit Method, which is transformed into BL21 (DE3), carries out induced expression and purifying, obtains 90% the above object albumen of purity, albumen size is about For 100KD.Induction is front and back, the SDS-PAGE figures of purification process and each protein sample after purification respectively as shown in figs. 2 to 4, It can be seen that after inducing BL21, Taq archaeal dna polymerase successful expressions, purity height, the impurity of the sample after dialysis are few.

The corresponding anti-Taq antibody of Taq archaeal dna polymerases is purchased from sigma companies.

Saltant type KOD archaeal dna polymerases, Taq archaeal dna polymerases, anti-Taq antibody store respectively, spare.

The application of embodiment 2PCR amplification kits

By taking 25 μ L as an example, solution allocation is carried out by PCR amplification system described in following the following table 1.

Table 1：The PCR amplification system of recommendation

The present invention recommends the 2 × PCR Enhancer (PCR reinforcing agents) carried in kit, is conducive to expand micro Template DNA.If template G/C content suggests being expanded using GC buffer more than 50%.

Recommend PCR reaction conditions as shown in table 2 below：

Table 2：PCR reaction conditions

Pay attention to：Suitable recurring number and suitable annealing temperature are selected, avoids cannot get specific amplification band.

Embodiment 3 detects different PCR reaction conditions

With the DNA fragmentation (PET-28a) of a length 2.9Kb for template, following amplimer is designed,

The amplimer of 2.9Kb segments:

PET-28a-F:ATCCGGATATAGTTCCTCCT (as shown in SEQ ID No.3)

PET-28a-R:CAGTATACACTCCGCTATGC (as shown in SEQ ID No.4)

In the case where unifying other all reaction conditions, the MgC1 in graded PCR buffer solutions₂Concentration (0mmol/L~5mmol/L), (NH₄)₂SO₄Concentration (15mmol/L~65mmol/L), KCl concentration (5mmol/L~ 55mmol/L) and its pH value (6.8~8.8), multigroup PCR reactions are carried out, is characterized with the agarose electrophoresis figure of PCR product Catalytic activity of the KTaq MIX DNA Polymerase (mixed type thermal starting archaeal dna polymerase composition) in PCR reactions.Its In, PCR product band is brighter, so that it may which the efficiency to indicate this group of PCR reactions is higher, i.e. KTaq MIX DNA Polymerase Reactivity it is also higher, gel electrophoresis figure such as Fig. 5.

According to each group PCR results electrophoretogram it is found that when mixed type thermal starting archaeal dna polymerase composition activity highest, pH is most Good value is 8 (Tris-HCl of 25mmol/L), MgCl₂Optimum value is 2mmol/L, (NH₄)₂SO₄Optimum value is 60mmol/L, KCl Optimum value is 50mmol/L.

Embodiment 4 detects different enzyme activity ratios

Respectively according to Taq archaeal dna polymerases and saltant type KOD archaeal dna polymerases according to enzyme-activity unit Taq:KODm=1U: 10U/1U:20U/1U:40U/1U:80U/1U:160U/1U:The ratio of 320U mixes, and it is respectively 1 to be converted into the ratio between volume (μ L): 6/1:12/1:24/1:48/1:96/1:192.PCR system that 1 μ L recommend according to embodiment 2 and condition is taken to expand Gp32 Increase

The primer of Gp32 segments:

Gp32-F:CGGGATCCATGTTTAAACGTAAAAGCA (as shown in SEQ ID No.5)

Gp32-R:CCCTCGAGCAGATCATTCAGCAGATCG (as shown in SEQ ID No.6)

Gel electrophoresis results such as Fig. 6 shows that PCR product band is brighter, so that it may to indicate that the efficiency of this group of PCR reactions is got over It is high.It can be seen that in the enzyme activity ratio (Taq of Taq archaeal dna polymerases and saltant type KOD archaeal dna polymerases：KODm it is) 1：10U~ 320U can realize amplification, Taq archaeal dna polymerases and the preferable enzyme activity ratio (Taq of saltant type KOD archaeal dna polymerases：KODm) it is 1：80U~160U.And individually saltant type KOD archaeal dna polymerases (KODm) to Gp32 almost without amplification.To sum up KODm:Ptaq Volume ratio is 1:96 (the enzyme activity ratio of corresponding Taq archaeal dna polymerases and saltant type KOD archaeal dna polymerases is 1：Amplification 160U) It is best.

Embodiment 5PCR amplification kits

Kit includes Taq archaeal dna polymerases in embodiment 1, anti-Taq antibody and saltant type KOD archaeal dna polymerases, with And PCR buffer solutions, PCR reinforcing agents, GC amplification buffers and dNTP.

According to the optimal conditions of embodiment 2~4, the Tris-HCl containing 25mmol/L in the PCR buffer solutions of configuration (pH8.0), the MgCl of 2mmol/L₂, 60mmol/L (NH₄)₂SO₄And the KCl of 50mmol/L.PCR reinforcing agents are glycine betaine. According to Taq archaeal dna polymerases and saltant type KOD archaeal dna polymerases according to enzyme-activity unit Taq when use:KODm is 1U:160U.

In addition, according to Taq archaeal dna polymerases and a concentration of the 3 of anti-Taq antibody when using:2 are added anti-Taq antibody.

When amplification template G/C content is 50% or more addition GC buffer solutions.GC amplification buffers contain 50mmol/L's The MgCl of KCl, 5mmol/L of Tris-HCl (pH8.8), 100mmol/L₂, 25mmol/L (NH₄)₂SO₄, volume fraction be The Triton-x- that Tween20 that 2% dimethyl sulfoxide (DMSO) (DMSO), volume fraction are 0.005%, volume fraction are 0.002% 100 and mass fraction be 1mg/mL BSA.

Contain dATP, dGTP, dTTP, dCTP in dNTP.

Performance evaluation is carried out to the PCR amplification kit of embodiment 5

One, the evaluation of amplification rate

When expanding 1kb~10kb segments respectively using λ DNA as template, annealing time is set as 5sec., extension of time difference 10sec and 30sec is set, the addition of template λ DNA is 1ng/50 μ L.PCR amplification condition：98℃10sec.55℃5sec.72 ℃10or 30sec(30cycle)。

The primer of 1Kb segments：

1-F:GGGCGGCGAC CTCGCGGGTT (as shown in SEQ ID No.7)

1-R:AGATAAGGGTGTTGCGCTGC (as shown in SEQ ID No.8)

The primer of 2Kb segments：

2-F:GGGCGGCGAC CTCGCGGGTT (as shown in SEQ ID No.9)

2-R:ATTTCTGCACCATTCCGGCG (as shown in SEQ ID No.10)

The primer of 4Kb segments：

4-F:GGGCGGCGAC CTCGCGGGTT (as shown in SEQ ID No.11)

4-R:TCGCCTGACGGGATGCGACG (as shown in SEQ ID No.12)

The primer of 6Kb segments：

6-F:GGGCGGCGAC CTCGCGGGTT (as shown in SEQ ID No.13)

6-R:TCCTCATAACGGAACGTGCC (as shown in SEQ ID No.14)

The primer of 8Kb segments：

8-F:GGGCGGCGAC CTCGCGGGTT (as shown in SEQ ID No.15)

8-R:GATGAAGCAACGCGGTTAAT (as shown in SEQ ID No.16)

The primer of 10Kb segments：

10-F:GGGCGGCGAC CTCGCGGGTT (as shown in SEQ ID No.17)

10-R:TTATTCACCACAAACTCATA (as shown in SEQ ID No.18)

The amplified production of 2 μ L is taken to carry out 1% gel electrophoresis, as a result following Fig. 7.As a result the amplification for extending 30sec is shown Effect is good, and band understands, illustrates that mixed type thermal starting archaeal dna polymerase composition (KTaq MIX DNA Polymerase) expands Rate can at least reach 30sec/Kb, and amplification efficiency is high.The DNA profiling of 8Kb, 10Kb large fragment still can be good at Amplification.

Two, the evaluation of thermal stability

The PCR system and condition recommended according to embodiment 2 trichoderma reesei HKMT genes expand, polymerase used Have respectively：

Enzyme is commercialized in CompanyA/B/C；

Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases press the proportioning that the embodiment of the present application 5 is recommended The KTaq MIX DNA Polymerase (mixed type thermal starting archaeal dna polymerase composition) of formation；And

Taq archaeal dna polymerases with mixed enzyme that commercially available unmutated KOD archaeal dna polymerases are formed (compared with mixed type heat open Dynamic archaeal dna polymerase composition：The histidine that KOD archaeal dna polymerases are the 147th is unmutated, and anti-Taq antibody is not added).

Then each group polymerase is placed on 37 DEG C to toast 6 days, under the same conditions to the same gene trichoderma reesei HKMT Gene is expanded according to above-mentioned PCR system and condition.The primer of trichoderma reesei HKMT genes：

HKMT-F：CTTGCACACGCATTGCAAGAGG (as shown in SEQ ID No.19)

HKMT-R：GTTCTTATCACCATTCTTCCTCC (as shown in SEQ ID No.20)

The gel electrophoresis figure of amplified production is illustrated in fig. 8 shown below, before 1 represents baking, after 2 represent baking.Relative to Enzyme is commercialized in CompanyA/B/C, and (mixed type thermal starting archaeal dna polymerase combines KTaq MIX DNA Polymerase before toasting Object) amplified production it is similar.But after 37 DEG C are toasted 6 days, mixed type thermal starting archaeal dna polymerase composition still has preferably Expanding effect illustrates that the mixed type thermal starting archaeal dna polymerase composition of the application has good thermal stability, polymerase can be It prepares at room temperature, it is easy to operate without completing on ice.

Three, the evaluation of polymerizing power

Using human gene group DNA as template, respectively with different primer amplification A/B/C/D different genes segments.

A genes are NADPH genes

NADPH-F：GGCCGCTGGGCGTCCACGCC (as shown in SEQ ID No.21)

NADPH-R：CAAGTGCAAGCAGCCTTAGG (as shown in SEQ ID No.22)

1 B gene is MUC4 gene Ms UC4-F：GAATTCTTCCCTGAGACTTT (as shown in SEQ ID No.23)

MUC4-R：AGGAGAGGTGCTTGTGGAAT (as shown in SEQ ID No.24)

C genes are OBSCN genes

OBSCN-F：ACAGTGTCCGCCTGTCCTTT (as shown in SEQ ID No.25)

OBSCN-R：TACATGAATGATTATAGCA (as shown in SEQ ID No.26)

D genes are MUC16 genes

MUC16-F：AGGTAAGTGGGACTGGGCTG (as shown in SEQ ID No.27)

MUC16-R：GGGTGGATTACCTGAGGTCA (as shown in SEQ ID No.28)

The size of A/B/C/D target gene is respectively 4.5Kb, 5Kb, 7.5Kb, 9.0Kb.The PCR recommended according to embodiment 2 System and condition are expanded.Template DNA is respectively with three kinds of various concentrations：50ng、5ng、0.5ng.Take the amplified production of 2 μ L 1% gel electrophoresis is carried out, as a result following Fig. 9.The results show that the genetic fragment of different size segment can be amplified out, And band can also be amplified for the lower conditions of 0.5ng in template concentrations.

Four, the evaluation of sensitivity

Using human gene group DNA as template, GPR98 genes (size 6.0Kb) segment is expanded,

The primer of GPR98 genes：

GPR98-F：ATGGGTCCTATTGGAGCAGA (as shown in SEQ ID No.29)

GPR98-R：AGGTCAGGAGATCGAGACCA (as shown in SEQ ID No.30)

The PCR system and condition recommended according to embodiment 2 are expanded.Template DNA is respectively with seven kinds of various concentrations： 10ng、1ng、100pg、10pg、1pg、100fg、10fg。

The high fidelity enzyme (Pfu-fusion, Taq plus, KD plus) while amplification being commercialized simultaneously with other three kinds are done Comparison.The amplified production of 2 μ L is taken to carry out 1% gel electrophoresis, as a result following Figure 10.The results show that KTaq MIX DNAPolymerase (KTq MIX) can also amplify band in the condition that template concentrations are 100fg, and other three kinds height are protected True enzyme but expands not shaping band.Illustrate that KTaq MIX DNA Polymerase have the sensitivity of superelevation.

Five, to the evaluation of the expanding effect of high GC content template

Using human gene group DNA as template, the G/C content of template DNA is respectively：47%, 58%, 60%, 64%, 67%, 79%, 84%.With the primer of different genes come amplified fragments,

Expand the primer of 47%GC contents：

GC-1-F:GTCTCTCTGAGTATCATCTT (as shown in SEQ ID No.31)

GC-1-R:CATGGGAAGAGGCAAACAGT (as shown in SEQ ID No.32)

Expand the primer of 58%GC contents：

GC-2-F:GTCTCTCTGAGTATCATCTT (as shown in SEQ ID No.33)

GC-2-R:TAAATAAAATAAAAAAGGAG (as shown in SEQ ID No.34)

Expand the primer of 60%GC contents：

GC-3-F:GTCTCTCTGAGTATCATCTT (as shown in SEQ ID No.35)

GC-3-R:CCTGCAATCCCAGCACTTTG (such as SEQ ID No.36 show)

Expand the primer of 64%GC contents：

GC-4-F:GTCTCTCTGAGTATCATCTT (as shown in SEQ ID No.37)

GC-4-R:AAACCACCATGGCACATATA (as shown in SEQ ID No.38)

Expand the primer of 67%GC contents：

GC-5-F:GTCTCTCTGAGTATCATCTT (as shown in SEQ ID No.39)

GC-5-R:ACTGCATGTTTTCACTCATA (as shown in SEQ ID No.40)

Expand the primer of 79%GC contents：

GC-6-F:GTCTCTCTGAGTATCATCTT (as shown in SEQ ID No.41)

GC-6-R:CAACCCAAATGTCCATCAGT (as shown in SEQ ID No.42)

Expand the primer of 84%GC contents：

GC-7-F:GTCTCTCTGAGTATCATCTT (as shown in SEQ ID No.43)

GC-7-R:TGCCCAAAGGAATATAAATC (as shown in SEQ ID No.44)

The high-fidelity that the PCR system and condition recommended according to embodiment 2 are expanded, while being commercialized with other three kinds Enzyme (Pfu-fusion, KD plus, Taq plus) at the same amplification compare.GC amplification buffers are added when amplification.Take 2 μ L's Amplified production carries out 1% gel electrophoresis, as a result following Figure 11.

The results show that the condition that KTaq MIX DNA Polymerase (KTq MIX) are 84% in template G/C content also may be used To amplify band, and other three kinds of high fidelity enzymes expand not shaping band.Illustrate that KTaq MIX DNA Polymerase are (mixed Mould assembly thermal starting archaeal dna polymerase composition) difficult template can be expanded.

Six, the evaluation of fidelity

It is the genetic fragment of 1Kb by template amplification size of λ DNA.

The primer of 1Kb segments：

1-F:GGGCGGCGAC CTCGCGGGTT (as shown in SEQ ID No.7)

1-R:AGATAAGGGTGTTGCGCTGC (as shown in SEQ ID No.8)

The PCR system and condition recommended according to embodiment 2 are expanded, and polymerase used has respectively：

Taq archaeal dna polymerases (Taq)；

CompanyA high fidelity enzyme KOD archaeal dna polymerases (KOD)；

CompanyA high fidelity enzyme Pfu archaeal dna polymerases (Pfu)；

Taq archaeal dna polymerases, anti-Taq antibody and saltant type KOD archaeal dna polymerases press the proportioning that the embodiment of the present application 5 is recommended The KTaq MIX DNA Polymerase (KTaq Mix, mixed type thermal starting archaeal dna polymerase composition) of formation.

Its target fragment of first gel extraction, then double digestion is carried out with corresponding enzyme, while carrier PUC19 also being carried out double Its target fragment and carrier are recycled in digestion, purifying.It will connect, and converted into JM109 with the segment of same cohesive end, And coated plate after cultivating 16h, is observed its plated growth situation and is counted, press on the ammonia benzyl tablet containing Xgal and IPTG According to formula

F=-ln (F)/d × (bp) calculates its fidelity,

Wherein.F=White colonies/Total colonies (white colonies/always clone number),

D=number of template doublings (template multiplication number).

The following Figure 12 of statistical results chart, as a result shows：The application KTaq MIX DNA Polymerase (KTq MIX, Mixed type thermal starting archaeal dna polymerase composition) fidelity can reach 1.01 × 10^-6, fidelity is higher by 50 than general T aq enzymes Times, than other, high fidelity enzyme KOD archaeal dna polymerases and Pfu archaeal dna polymerases are higher by 2~4 times on the market.

One or more of embodiments of the invention above described embodiment only expresses, description are more specific and detailed Carefully, but it cannot be construed as a limitation to the scope of the present invention.It should be pointed out that for the common skill of this field For art personnel, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to this hair Bright protection domain.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.

Sequence table

<110>Ai Wei enlightening bio tech ltd of Shenzhen

<120>Mixed type thermal starting archaeal dna polymerase composition, PCR amplification kit and its application

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 774

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 1

Met Ile Leu Asp Thr Asp Tyr Ile Thr Glu Asp Gly Lys Pro Val Ile

1 5 10 15

Arg Ile Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg

20 25 30

Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile

35 40 45

Glu Glu Val Lys Lys Ile Thr Ala Glu Arg His Gly Thr Val Val Thr

50 55 60

Val Lys Arg Val Glu Lys Val Gln Lys Lys Phe Leu Gly Arg Pro Val

65 70 75 80

Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile

85 90 95

Arg Asp Lys Ile Arg Glu His Pro Ala Val Ile Asp Ile Tyr Glu Tyr

100 105 110

Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Val Pro

115 120 125

Met Glu Gly Asp Glu Glu Leu Lys Met Leu Ala Phe Asp Ile Glu Thr

130 135 140

Leu Tyr Lys Glu Gly Glu Glu Phe Ala Glu Gly Pro Ile Leu Met Ile

145 150 155 160

Ser Tyr Ala Asp Glu Glu Gly Ala Arg Val Ile Thr Trp Lys Asn Val

165 170 175

Asp Leu Pro Tyr Val Asp Val Val Ser Thr Glu Arg Glu Met Ile Lys

180 185 190

Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr

195 200 205

Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu

210 215 220

Lys Leu Gly Ile Asn Phe Ala Leu Gly Arg Asp Gly Ser Glu Pro Lys

225 230 235 240

Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile

245 250 255

His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr

260 265 270

Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Gln Pro Lys Glu

275 280 285

Lys Val Tyr Ala Glu Glu Ile Thr Thr Ala Trp Glu Thr Gly Glu Asn

290 295 300

Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr

305 310 315 320

Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ala Gln Leu Ser Arg Leu

325 330 335

Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu

340 345 350

Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala

355 360 365

Pro Asn Lys Pro Asp Glu Lys Glu Leu Ala Arg Arg Arg Gln Ser Tyr

370 375 380

Glu Gly Gly Tyr Val Lys Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile

385 390 395 400

Val Tyr Leu Asp Phe Arg Ser Leu Tyr Pro Ser Ile Ile Ile Thr His

405 410 415

Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp

420 425 430

Val Ala Pro Gln Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe

435 440 445

Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys

450 455 460

Lys Lys Met Lys Ala Thr Ile Asp Pro Ile Glu Arg Lys Leu Leu Asp

465 470 475 480

Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly Tyr

485 490 495

Tyr Gly Tyr Ala Arg Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser

500 505 510

Val Thr Ala Trp Gly Arg Glu Tyr Ile Thr Met Thr Ile Lys Glu Ile

515 520 525

Glu Glu Lys Tyr Gly Phe Lys Val Ile Tyr Ser Asp Thr Asp Gly Phe

530 535 540

Phe Ala Thr Ile Pro Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala

545 550 555 560

Met Glu Phe Leu Lys Tyr Ile Asn Ala Lys Leu Pro Gly Ala Leu Glu

565 570 575

Leu Glu Tyr Glu Gly Phe Tyr Glu Arg Gly Phe Phe Val Thr Lys Lys

580 585 590

Lys Tyr Ala Val Ile Asp Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu

595 600 605

Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala

610 615 620

Arg Val Leu Glu Ala Leu Leu Lys Asp Gly Asp Val Glu Lys Ala Val

625 630 635 640

Arg Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro

645 650 655

Pro Glu Lys Leu Val Ile His Glu Gln Ile Thr Arg Asp Leu Lys Asp

660 665 670

Tyr Lys Ala Thr Gly Pro His Val Ala Val Ala Lys Arg Leu Ala Ala

675 680 685

Arg Gly Val Lys Ile Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu

690 695 700

Lys Gly Ser Gly Arg Ile Gly Asp Arg Ala Ile Pro Phe Asp Glu Phe

705 710 715 720

Asp Pro Thr Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln

725 730 735

Val Leu Pro Ala Val Glu Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys

740 745 750

Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Ser Ala Trp

755 760 765

Leu Lys Pro Lys Gly Thr

770

<210> 2

<211> 832

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 2

Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu

1 5 10 15

Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly

20 25 30

Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala

35 40 45

Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile Val

50 55 60

Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly

65 70 75 80

Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu

85 90 95

Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg Leu Glu

100 105 110

Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys

115 120 125

Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp

130 135 140

Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Ala Leu His Pro Glu Gly

145 150 155 160

Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg Pro

165 170 175

Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn

180 185 190

Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu

195 200 205

Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp Arg Leu

210 215 220

Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys

225 230 235 240

Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val

245 250 255

Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe

260 265 270

Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu

275 280 285

Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu Gly

290 295 300

Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp

305 310 315 320

Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro

325 330 335

Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu

340 345 350

Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro

355 360 365

Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn

370 375 380

Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu

385 390 395 400

Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu

405 410 415

Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu

420 425 430

Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly

435 440 445

Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala

450 455 460

Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His

465 470 475 480

Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp

485 490 495

Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys Arg

500 505 510

Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile

515 520 525

Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser Thr

530 535 540

Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu

545 550 555 560

His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser

565 570 575

Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln

580 585 590

Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala

595 600 605

Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly

610 615 620

Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His Thr

625 630 635 640

Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro

645 650 655

Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly

660 665 670

Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu

675 680 685

Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg

690 695 700

Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val

705 710 715 720

Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg

725 730 735

Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro

740 745 750

Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu

755 760 765

Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His

770 775 780

Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala

785 790 795 800

Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro

805 810 815

Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu

820 825 830

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

atccggatat agttcctcct 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

cagtatacac tccgctatgc 20

<210> 5

<211> 27

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

cgggatccat gtttaaacgt aaaagca 27

<210> 6

<211> 27

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

ccctcgagca gatcattcag cagatcg 27

<210> 7

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

gggcggcgac ctcgcgggtt 20

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

agataagggt gttgcgctgc 20

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

gggcggcgac ctcgcgggtt 20

<210> 10

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

atttctgcac cattccggcg 20

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

gggcggcgac ctcgcgggtt 20

<210> 12

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

tcgcctgacg ggatgcgacg 20

<210> 13

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 13

gggcggcgac ctcgcgggtt 20

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 14

tcctcataac ggaacgtgcc 20

<210> 15

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 15

gggcggcgac ctcgcgggtt 20

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 16

gatgaagcaa cgcggttaat 20

<210> 17

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 17

gggcggcgac ctcgcgggtt 20

<210> 18

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 18

ttattcacca caaactcata 20

<210> 19

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 19

cttgcacacg cattgcaaga gg 22

<210> 20

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 20

gttcttatca ccattcttcc tcc 23

<210> 21

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 21

ggccgctggg cgtccacgcc 20

<210> 22

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 22

caagtgcaag cagccttagg 20

<210> 23

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 23

gaattcttcc ctgagacttt 20

<210> 24

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 24

aggagaggtg cttgtggaat 20

<210> 25

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 25

acagtgtccg cctgtccttt 20

<210> 26

<211> 19

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 26

tacatgaatg attatagca 19

<210> 27

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 27

aggtaagtgg gactgggctg 20

<210> 28

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 28

gggtggatta cctgaggtca 20

Claims (10)

1. a kind of mixed type thermal starting archaeal dna polymerase composition, which is characterized in that including Taq archaeal dna polymerases, anti-Taq antibody With saltant type KOD archaeal dna polymerases, wherein the anti-Taq antibody can be specifically bound with the Taq archaeal dna polymerases, institute Saltant type KOD archaeal dna polymerases are stated to be obtained for lysine by the 147th Histidine mutagenesis of wild type KOD archaeal dna polymerases.

2. mixed type thermal starting archaeal dna polymerase composition according to claim 1, which is characterized in that the saltant type KOD Archaeal dna polymerase includes：

(a) protein that amino acid sequence forms shown in SEQ ID No.1；Or,

(b) by replacing, missing or adding one or several amino acid and tool in the amino acid sequence shown in SEQ ID No.1 There is the protein derived from (a) of the saltant type KOD DNA polymerase activities.

3. mixed type thermal starting archaeal dna polymerase composition according to claim 1, which is characterized in that the Taq DNA are poly- The enzyme activity ratio of synthase and the saltant type KOD archaeal dna polymerases is 1：10U~320U.

4. mixed type thermal starting archaeal dna polymerase composition according to claim 1 or 2, which is characterized in that the Taq The enzyme activity ratio of archaeal dna polymerase and the saltant type KOD archaeal dna polymerases is 1：80U~160U.

5. a kind of PCR amplification kit, which is characterized in that including such as Claims 1 to 4 any one of them mixed type thermal starting Archaeal dna polymerase composition.

6. PCR amplification kit according to claim 5, which is characterized in that further include GC amplification buffers, the GC expands Increase buffer solution in Tris-HCl, 50mmol/L containing 40mmol/L~60mmol/L~150mmol/L KCl, 2mmol/L~ The MgCl of 8mmol/L₂, 20mmol/L~30mmol/L (NH₄)₂SO₄, volume fraction be 1%~3% dimethyl sulfoxide (DMSO), body The Triton-x-100 and matter that Tween20 that fraction is 0.001%~0.01%, volume fraction are 0.001%~0.01% Measure the BSA that score is 0.5mg/mL~5mg/mL.

7. PCR amplification kit according to claim 5, which is characterized in that further include PCR buffer solutions and PCR reinforcing agents, The MgCl of Tris-HCl, 0.5mmol/L containing 10mmol/L~30mmol/L~5mmol/L in the PCR buffer solutions₂、 (the NH of 50mmol/L~80mmol/L₄)₂SO₄And the KCl of 40mmol/L~60mmol/L, the PCR reinforcing agents are beet Alkali.

8. such as application of the claim 5~7 any one of them PCR amplification kit in DNA amplification, which is characterized in that packet Include following steps：

DNA cloning template, PCR buffer solutions and mixed type thermal starting archaeal dna polymerase composition are mixed to get amplification system；With And

The amplification system is placed in PCR instrument and carries out PCR amplification.

9. application according to claim 8, which is characterized in that G/C content is 65% or more in the DNA cloning template.

10. application according to claim 8, which is characterized in that the DNA cloning template in the amplification system contains Amount is 1pg or less.