CN108541825B - Preparation method of novel antibacterial fish feed - Google Patents
Preparation method of novel antibacterial fish feed Download PDFInfo
- Publication number
- CN108541825B CN108541825B CN201810488192.3A CN201810488192A CN108541825B CN 108541825 B CN108541825 B CN 108541825B CN 201810488192 A CN201810488192 A CN 201810488192A CN 108541825 B CN108541825 B CN 108541825B
- Authority
- CN
- China
- Prior art keywords
- identification
- plasmid
- fish feed
- recombinant protein
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/142—Amino acids; Derivatives thereof
- A23K20/147—Polymeric derivatives, e.g. peptides or proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Polymers & Plastics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Animal Husbandry (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Feed For Specific Animals (AREA)
Abstract
The invention discloses a preparation method of a novel antibacterial fish feed, which belongs to the technical field of bioengineering and comprises the steps of obtaining a target gene fragment, constructing a recombinant expression plasmid, preparing a recombinant protein and mixing the recombinant protein and the fish feed.
Description
Technical Field
The invention relates to a preparation method of fish feed, in particular to a preparation method of novel antibacterial fish feed, belonging to the technical field of bioengineering.
Background
At present, antibiotics are generally used as feed additives in fish feed in the market to reduce the death rate of the fish culture process, but a large amount of the antibiotics are remained in the bodies of the fish due to the large use of the antibiotics, so that the export market of the fish is influenced, the development of the fish culture industry is also influenced, the drug resistance of the fish is enhanced due to the abuse of the antibiotics, and the water quality is seriously polluted. Therefore, the fish feed is urgently needed in the market, can be combined with heterologous substances such as bacteria, viruses or toxins to play a role in preventing and treating fish diseases, is green and safe, has no pollution, no residue and no public nuisance, and can obviously relieve the problems existing in the existing fish culture process.
Striped siganus shark (Chilossyllium platiosum) is commonly called dog shark and dog shark, belongs to chondrocythyes (Chondrichthyes), Orectolytales (Orectolyformes), Orectoleidea (Orectoleidea) and siganus (Chilossyllium), is a small benthic jaw vertebrate, exists as early as 5.3 hundred million years, and is an ancestor of teleostomus. The striped spotted bamboo shark has the characteristics of having a common characteristic of cartilaginous fishes and teleostean fishes, namely a complex physiological system, an adaptive immune system and a pressurized circulation system, the striped spotted bamboo shark has a stronger immune system, and can generate an antibody only containing a heavy chain in vivo, which is called a single domain antibody.
Disclosure of Invention
The invention aims to solve the technical problems and provides a preparation method of a novel antibacterial fish feed which has the technical characteristics of environmental protection, safety, no pollution, no residue and no public nuisance, can prevent and treat fish diseases and the like,
a preparation method of a novel antibacterial fish feed comprises the following steps:
the method comprises the following steps: determining enzyme cutting sites and primers of a gene cp2-2, wherein the primers comprise an upstream primer 5'-CGAGCTCCGAGTGCCCAAAATCA-3' and a downstream primer 5'-ACTCGAGTCAGTCAAATCTTTTGC-3', extracting RNA from the spleen of the striped bamboo shark, and performing specific amplification by using the primers to obtain a cp2-2 target fragment;
step two: carrying out amplification culture on the cp2-2 target fragment obtained in the step one and a strain of a plasmid pET-32a, extracting plasmid DNA, carrying out double enzyme digestion on the plasmid DNA by SacI and XhoI respectively, purifying and recovering, and connecting the recovered cp2-2 target fragment with the vector fragment pET-32a to obtain a connection product;
step three: transforming 5 mu L of the ligation product obtained in the second step into 200 mu L of escherichia coli Rosseta competent cells, uniformly blowing, sequentially carrying out ice bath for 30min, heat shock for 90s at 42 ℃ and ice bath for 5min, then adding 1mL of LB liquid culture medium, shaking for 1h at 37 ℃, screening positive clones by Amp and CM resistant LB solid culture medium, and obtaining a recombinant expression plasmid pET-32a-cp2-2 after identification;
step four: carrying out recombinant protein induction expression on the recombinant expression plasmid pET-32a-cp2-2 obtained in the step two, and then purifying and identifying to obtain a cp2-2 recombinant protein;
step five: and (3) adding the cp2-2 recombinant protein obtained in the step four into a common fish feed, and uniformly stirring to obtain the novel antibacterial fish feed.
As an improvement, the identification method of the recombinant plasmid pET-32a-cp2-2 in the third step comprises plasmid PCR identification, double digestion identification and sequencing identification, wherein plasmid DNA is extracted from a bacterial solution, plasmid PCR and double digestion identification are respectively carried out on the extracted plasmid DNA by SacI and XhoI, and then a strain which is correct in both plasmid PCR and double digestion identification is selected for sequencing identification.
As an improvement, the induction expression of the recombinant protein in the fourth step is that IPTG is used for induction for 4h at the concentration of 1mM/L under the condition of 28 ℃.
As an improvement, the purification method in the fourth step is Ni column affinity chromatography hanging column purification.
Has the advantages that: has the advantages of green, safety, no pollution, no residue and no public nuisance; can prevent and treat fish diseases, reduce the loss of farmers and is beneficial to the development of fish breeding industry; can be produced in batch.
Drawings
FIG. 1 shows PCR amplification of the cp2-2 gene of the invention.
FIG. 2 is a PCR identification chart of the positive clone plasmid containing recombinant plasmid pET-32a-cp2-2 thallus according to the present invention.
FIG. 3 is a diagram showing the results of double digestion with SacI and XhoI.
FIG. 4 is a diagram showing the expression of the recombinant protein cp2-2 of the present invention.
FIG. 5 shows the purification and identification of recombinant cp2-2 protein of the present invention.
Detailed Description
Specific embodiments of the present invention will be further explained below with reference to the drawings attached to the specification, but the present invention is not limited to the following embodiments.
A preparation method of a novel antibacterial fish feed comprises the following steps:
the method comprises the following steps: determining enzyme cutting sites and primers of a gene cp2-2, wherein the primers comprise an upstream primer 5'-CGAGCTCCGAGTGCCCAAAATCA-3' and a downstream primer 5'-ACTCGAGTCAGTCAAATCTTTTGC-3', the sequence of the upstream primer is shown as (nucleotide and amino acid sequence table <400>2) SEQ ID NO. 2, the sequence of the downstream primer is shown as (nucleotide and amino acid sequence table <400>3)) SEQ ID NO. 3, extracting RNA from the spleen of striped bamboo shark, and performing specific amplification by using the upstream and downstream primers to obtain a cp2-2 target fragment;
wherein, extracting the spleen RNA of the striped bamboo shark: the kit mRNAISosolationskit is adopted to extract the spleen RNA of the striped bamboo shark, and the specific operation steps are as follows:
1) prepare 10 μ l system: included 4. mu.l of RNA/mRNA (striped bamboo shark spleen RNA), 2. mu.l of 5xqRTSupermix (premix), 4. mu.l of Nase-freeWater;
2) reverse transcription of RNA into cDNA:
the 10. mu.l system was sequentially placed at 25 ℃ for 10min, 42 ℃ for 30min, and 85 ℃ for 5min to reverse transcribe RNA into cDNA.
The specific amplification of the cp2-2 is PCR amplification, FIG. 1 shows a PCR amplification diagram of the cp2-2 gene, and in FIG. 1, M:2, 000Marker and 1: cp2-2PCR are performed, wherein the specific operation steps of PCR amplification are as follows:
1) preparation of a 50. mu.l system: including 5. mu.l of 10XBuffer (Buffer), 5. mu.l of dNTP (ACTG), 3. mu.l of Mg2+ (Buffer), 2. mu.l of P1 (upstream primer), 2. mu.l of P2 (downstream primer), 1. mu.l of Term, 1. mu.l of Taq (enzyme) and 31. mu.l of ddH2O (water);
2) sequentially placing the 50 μ l system at 95 deg.C for 10min, 95 deg.C for 30s, 58 deg.C for 30s, 72 deg.C for 60s, 72 deg.C for 10min, and 10 deg.C for preservation, and performing denaturation, annealing, and extension for 30 cycles;
step two: carrying out amplification culture on the cp2-2 target fragment and the strain of the plasmid pET-32a obtained in the step one, extracting plasmid DNA, carrying out double enzyme digestion on the plasmid DNA by SacI and XhoI respectively, purifying and recycling, and connecting the cp2-2 target fragment obtained by recycling with the vector fragment pET-32a to obtain a connection product;
wherein, the vector is subjected to double enzyme digestion: the bacterial strain of pET-32a is cultured in LB liquid culture medium containing Amp and CM overnight in a shaking table at 37 ℃, the obtained bacterial liquid is used for extracting plasmid DNA by an AxyPrep plasmid DNA small-quantity kit, and then is subjected to double enzyme digestion by SacI and XhoI, and the specific operation steps are as follows:
1) the preparation system comprises the following steps: comprises 300.8 ng/. mu.l of pET-32a (vector), 2. mu.l of SacI, 2. mu.l of XhoI, 5. mu.l of 10xBuffer, 6. mu.l of plasmid and 35. mu.lddH 2O;
2) the system was left at 37 ℃ for 3 h.
The enzyme digestion product is subjected to agarose gel electrophoresis, fragments on the gel are cut according to the size of a carrier, and purification and recovery operations are carried out according to the steps of an AxyPrepDNAGELExtionkit.
The method comprises the following steps of carrying out double enzyme digestion on a cp2-2 target fragment by using SacI and XhoI:
1) preparation of a 50. mu.l system: comprises 5 μ l of 10 × QCutBuffer, 2 μ l of Sac I, 2 μ l of Xhol I, and 41 μ l of cp 2-2;
2) the 50. mu.l of the system was left at 37 ℃ for 3 hours.
And (3) carrying out agarose gel electrophoresis on the enzyme digestion product, cutting fragments on the gel according to the size of a target gene, and carrying out purification and recovery operation according to the steps of an AxyPrepDNAGELExtionkit kit.
The method comprises the following steps of connecting a target gene with a vector:
1) prepare 10 μ l system: comprises 0.2 μ l of T4 ligase, 1 μ l of Buffer, 6.8 μ l of pET-32a (vector), 2 μ l of cp2-2 (target gene);
2) the 10. mu.l system was left at 22 ℃ for 3 hours to complete the ligation of the target gene and the vector.
Step three: transforming 5 mu L of the ligation product obtained in the second step into 200 mu L of escherichia coli Rosseta competent cells, uniformly blowing, carrying out ice bath for 30min, carrying out heat shock for 90s (metal bath) at 42 ℃ and ice bath for 5min in sequence, then adding 1mL of LB liquid culture medium into a super clean bench, shaking for 1h at 37 ℃, centrifuging for 5min at 5000rpm at room temperature, sucking 1.1mL of supernatant by using a pipette gun, discarding, carrying out heavy suspension, coating the residual 100ul of solution on an LB solid culture medium containing Amp and CM resistance, carrying out upright culture for 30min, then carrying out inverted culture for 8h, screening positive clones, and obtaining a recombinant expression plasmid pET-32a-cp2-2 after identification;
wherein, the screening and identification of the recombinant expression plasmid comprises the following operation steps:
1) randomly selecting a single colony growing on a transformation plate, inoculating the single colony to an LB liquid culture medium containing Amp and CM, after shaking culture at 37 ℃ overnight, extracting plasmids, respectively carrying out plasmid PCR and double-restriction enzyme identification by SacI and XhoI on the extracted plasmids, selecting strains with correct identification by two methods (plasmid PCR identification and double-restriction enzyme identification) for sequencing, naming the plasmid with correct sequencing as pET-32a-cp2-2, wherein the identification results are shown in figures 2 and 3, the plasmid PCR identification, the double-restriction enzyme identification and the sequencing results are correct, and a vector is successfully constructed, the figure 2 is a positive clone plasmid PCR identification picture containing recombinant plasmid pET-32a-cp2-2 thalli, and M in the figure 2: 15, 000Marker, 1: cp2-2 plasmid PCR, 2: cp2-2PCR positive control; FIG. 3 is a diagram showing the results of the double restriction assay of positive clones by SacI and XhoI, 4 in FIG. 3: and (5) carrying out double enzyme digestion inspection on the recombinant plasmid.
Step four: and (3) performing recombinant protein induction expression on the recombinant expression plasmid pET-32a-cp2-2 obtained in the step two, and then purifying and identifying to obtain the cp2-2 recombinant protein, wherein an expression diagram of the cp2-2 recombinant protein is shown in figure 4, wherein M: UnstainedProteinMWMarker, 5: precipitation and 6: supernatant, 7: stock solution, 8: the amino acid sequence of the recombinant protein cp2-2 is shown in SEQ ID NO:1 (nucleotide and amino acid sequence table <400>1 in the specification), and the induced expression conditions of the recombinant protein cp2-2 in host bacteria are as follows: under the condition of 28 ℃, inducing 4 by IPTG with the concentration of 1mM/L, purifying (affinity purification of the recombinant protein VP 4) by Ni2+ -NTA agarose gel, preparing related solution to purify the expressed recombinant protein, and carrying out ultrafiltration concentration on the collected purified recombinant protein solution, wherein the identification result is shown in figure 5, the affinity purification mode obtains the target protein with higher purity, and M in figure 5: UnstainedProteinMWMarker, 1: non-induced, 2: stock solution, 3: supernatant and 4: precipitation and 5: flow-through liquid, 6: eluent 1, 7: eluent 2, 8: eluent 3;
step five: and adding the cp2-2 recombinant protein obtained in the step four into common fish feed, and uniformly stirring to obtain the novel antibacterial fish feed, wherein the fish feed is common fish feed aiming at different fishes in the market, such as grass carp feed, black carp feed, big head fish feed and the like.
Animal experiments were performed on the cp2-2 recombinant protein: and (3) adding the cp2-2 recombinant protein obtained in the step four into pig feed, shrimp feed and rainbow trout feed for observation experiment:
1) for pigs: randomly dividing piglets in diarrhea state with similar growth conditions into two groups, one group is a control group, the other group is an experimental group, the experimental group eats feed added with the cp2-2 recombinant protein, the control group eats common feed without the recombinant protein, the control group is fed for 12 weeks, and the growth conditions of the pigs are observed.
The experimental results are as follows:
the pig in the control group dies, while the diarrhea cure rate of the pig in the experimental group is 100%, which proves that the protein has the bacteriostatic effect.
2) For shrimp: the 200-tailed juvenile shrimps with similar growth conditions are randomly divided into two groups, 100 tails of each plastic pool are used, one group is used as a control group, the other group is used as an experimental group, the experimental group eats feed added with the recombinant protein cp2-2, the control group eats common feed without the recombinant protein, the shrimp is fed for 12 weeks, and the growth conditions of the river shrimps are observed.
The experimental results are as follows:
the survival rate of the control group of the shrimp is 90 percent, and the survival rate of the experimental group of the shrimp is 97 percent, which proves that the protein has the bacteriostatic effect and can play the roles of reducing the death rate and reducing the diseases in aquaculture.
3) For rainbow trout: dividing 100 rainbow trout parr with similar growth status into two groups at random, wherein each plastic pool comprises 50 fish, one group is a control group, the other group is an experimental group, the experimental group eats feed added with the recombinant protein cp2-2, the control group eats common feed without the recombinant protein, the feed is fed for 12 weeks, and the three groups are repeated to observe the growth status of the rainbow trout.
The experimental results are as follows:
the survival rate of the rainbow trout in the control group is less than one third, while the survival rate of the rainbow trout in the experimental group is more than sixty percent, so that the death rate of the rainbow trout is obviously reduced.
Finally, it should be noted that the present invention is not limited to the above embodiments, and many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.
<110> Zhejiang university of science and engineering
<120> preparation method of novel antibacterial fish feed
<160> 3
<210> 1
<211> 330
<212> PRT
<213> Artificial sequence
<400> 1
Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr
5 10 15
Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala
20 25 30
Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu
35 40 45
Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn
50 55 60
Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly
65 70 75
Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr
80 85 90
Lys Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp
95 100 105
Ala Asn Leu Ala Gly Ser Gly Ser Gly His Met His His His His
110 115 120
His His Ser Ser Gly Leu Val Pro Arg Gly Ser Gly Met Lys Glu
125 130 135
Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp Ser Pro Asp
140 145 150
Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Asp Ile Gly Ser
155 160 165
Glu Phe Glu Leu Arg Val Pro Lys Ile Thr Ile Leu Lys Pro Ser
170 175 180
Pro Ala Glu Leu Arg Glu Lys Gly Lys Ala Thr Val Val Cys Leu
185 190 195
Val Thr Asp Phe Tyr Pro Asp Asn Ile Gln Ile His Trp Tyr Val
200 205 210
Asp Ser Lys Lys Glu Glu Ser Glu Thr Lys Ile Gln Ser Asp Pro
215 220 225
Glu Ser Val Ala Glu Glu Gly Gly Lys Ser Tyr Ser Val Ser Ser
230 235 240
Arg Ile Arg Phe Val Asp Glu Glu Trp Val Lys Met Lys Asn Val
245 250 255
Glu Cys Arg Val His His Tyr Ala Lys Gly Ser Asp Pro Thr Leu
260 265 270
Tyr Thr Ser Glu Phe Glu Val Asn Ala Glu Ile Cys Gly Met Ser
275 280 285
Lys Glu Ala Lys Val Gln Ser Met Gly Thr Ala Lys Leu Thr Tyr
290 295 300
Leu Met Met Phe Cys Lys Ser Ile Leu Tyr Ala Leu Phe Val Ser
305 310 315
Ile Ile Val Trp Lys Ser Lys Ile Ser Arg Ser Lys Arg Phe Asp
320 325 330
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence
<223> cp2-2 gene upstream primer
<400> 2
CGAGCTCCGAGTGCCCAAAATCA 23
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence
<223> cp2-2 gene downstream primer
<400> 3
ACTCGAGTCAGTCAAATCTTTTGC 24
Claims (3)
1. A preparation method of novel antibacterial fish feed is characterized by comprising the following steps:
the method comprises the following steps: determining enzyme cutting sites and primers of a gene cp2-2, wherein the primers comprise an upstream primer 5'-CGAGCTCCGAGTGCCCAAAATCA-3' and a downstream primer 5'-ACTCGAGTCAGTCAAATCTTTTGC-3', extracting RNA from the spleen of the striped bamboo shark, and performing specific amplification by using the primers to obtain a cp2-2 target fragment;
step two: carrying out amplification culture on the cp2-2 target fragment obtained in the step one and a strain of a plasmid pET-32a, extracting plasmid DNA, carrying out double enzyme digestion on the plasmid DNA by SacI and XhoI respectively, purifying and recovering, and connecting the recovered cp2-2 target fragment with the vector fragment pET-32a to obtain a connection product;
step three: transforming 5 mu L of the ligation product obtained in the second step into 200 mu L of escherichia coli Rosseta competent cells, uniformly blowing, sequentially carrying out ice bath for 30min, heat shock for 90s at 42 ℃ and ice bath for 5min, then adding 1mL of LB liquid culture medium, shaking for 1h at 37 ℃, screening positive clones by Amp and CM resistant LB solid culture medium, and obtaining a recombinant expression plasmid pET-32a-cp2-2 after identification; the identification method of the recombinant plasmid pET-32a-cp2-2 in the third step comprises plasmid PCR identification, double enzyme digestion identification and sequencing identification, wherein plasmid DNA is extracted from a selected bacterial solution, plasmid PCR and double enzyme digestion identification are respectively carried out on the extracted plasmid DNA by SacI and XhoI, and then a strain which is correct in both plasmid PCR and double enzyme digestion identification is selected for sequencing identification;
step four: carrying out recombinant protein induction expression on the recombinant expression plasmid pET-32a-cp2-2 obtained in the step two, and then purifying and identifying to obtain a cp2-2 recombinant protein;
step five: adding the cp2-2 recombinant protein obtained in the step four into a common fish feed, and uniformly stirring to obtain a novel antibacterial fish feed;
wherein, extracting the spleen RNA of the striped bamboo shark: the kit mRNAISosolationskit is adopted to extract the spleen RNA of the striped bamboo shark, and the specific operation steps are as follows:
1) prepare 10 μ l system: includes 4. mu.l of RNA/mRNA, 2. mu.l of 5xqRTSuperMix, 4. mu.l of Nase-freeWater;
2) reverse transcription of RNA into cDNA:
sequentially placing the 10 μ l system at 25 deg.C for 10min, 42 deg.C for 30min, and 85 deg.C for 5min to make RNA reverse-transcribe into cDNA;
the specific amplification of the cp2-2 is PCR amplification, and the specific operation steps of the PCR amplification are as follows:
1) preparation of a 50. mu.l system: including 5. mu.l of 10XBuffer, 5. mu.l of dNTP (ACTG), 3. mu.l of Mg2+, 2. mu.l of P1, 2. mu.l of P2, 1. mu.l of Term, 1. mu.l of Taq and 31. mu.l of ddH 2O;
2) sequentially placing the 50 μ l system at 95 deg.C for 10min, 95 deg.C for 30s, 58 deg.C for 30s, 72 deg.C for 60s, 72 deg.C for 10min, and 10 deg.C for storage, and performing denaturation, annealing, and extension for 30 cycles.
2. The method for preparing a novel antibacterial fish feed as claimed in claim 1, wherein the conditions for inducing and expressing the recombinant protein in step four are that IPTG is used for inducing at a concentration of 1mM/L for 4h at 28 ℃.
3. The method for preparing a novel antibacterial fish feed as claimed in claim 1 or 2, wherein the purification method in the fourth step is Ni column affinity chromatography hanging column purification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810488192.3A CN108541825B (en) | 2018-05-21 | 2018-05-21 | Preparation method of novel antibacterial fish feed |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810488192.3A CN108541825B (en) | 2018-05-21 | 2018-05-21 | Preparation method of novel antibacterial fish feed |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108541825A CN108541825A (en) | 2018-09-18 |
| CN108541825B true CN108541825B (en) | 2021-07-06 |
Family
ID=63495355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810488192.3A Expired - Fee Related CN108541825B (en) | 2018-05-21 | 2018-05-21 | Preparation method of novel antibacterial fish feed |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108541825B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0261187A1 (en) * | 1986-04-03 | 1988-03-30 | Schering Aktiengesellschaft | PROCESS FOR THE PRODUCTION OF 17a$g(a)-HYDROXY-D-HOMO-1,4-PREGNADIENE-3,20-DION |
| CN101920009A (en) * | 2010-03-06 | 2010-12-22 | 河北医科大学 | Vaccine for preventing and curing tumor |
| CN101993888A (en) * | 2009-08-25 | 2011-03-30 | 中国医学科学院北京协和医院 | Method for producing and recombining main allergic protein Hum j 3 of Humulus scandens by induced secretion expression |
| CN104530215A (en) * | 2014-12-24 | 2015-04-22 | 西北工业大学 | Antibacterial peptide VIP (vasoactive intestinal peptide)-like peptide and preparation method thereof |
-
2018
- 2018-05-21 CN CN201810488192.3A patent/CN108541825B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0261187A1 (en) * | 1986-04-03 | 1988-03-30 | Schering Aktiengesellschaft | PROCESS FOR THE PRODUCTION OF 17a$g(a)-HYDROXY-D-HOMO-1,4-PREGNADIENE-3,20-DION |
| CN101993888A (en) * | 2009-08-25 | 2011-03-30 | 中国医学科学院北京协和医院 | Method for producing and recombining main allergic protein Hum j 3 of Humulus scandens by induced secretion expression |
| CN101920009A (en) * | 2010-03-06 | 2010-12-22 | 河北医科大学 | Vaccine for preventing and curing tumor |
| CN104530215A (en) * | 2014-12-24 | 2015-04-22 | 西北工业大学 | Antibacterial peptide VIP (vasoactive intestinal peptide)-like peptide and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 鲨肝肽在家蚕中的表达及其口服吸收的初步研究;郭昱等;《中国新药杂志》;20011231;第1卷;说明书第8-21段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108541825A (en) | 2018-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7230156B2 (en) | Method for preparing a sterile transgenic carp | |
| CN114015676B (en) | Construction method of cellulase adapting to traditional Chinese medicine feed additive | |
| CN101182360B (en) | Fusion protein having antibiotic function and uses thereof | |
| CN106591328A (en) | Preparation method and application of grouper nervous necrosis virus capsid protein | |
| CN110982822A (en) | Procambarus clarkii anti-lipopolysaccharide factor gALF1 gene, gALF1 protein coded by same and application thereof | |
| CN108396030B (en) | Lifobinopenaeus antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof | |
| CN110592057A (en) | Chimeric lyase ILTphg and polynucleotides encoding same | |
| CN108541825B (en) | Preparation method of novel antibacterial fish feed | |
| CN109997970B (en) | Acidic xylanase mutant with improved enzyme activity and heat resistance, and coding gene and application thereof | |
| CN107365372B (en) | L-type agglutinin of Litopenaeus vannamei, and coding gene and application thereof | |
| CN105671084B (en) | A kind of seawater left-eyed flounder germplasm construction method and application based on genome editor | |
| US20230233621A1 (en) | Novel probiotic bacteria and methods to control pathogens in aquatic animals | |
| CN114316012B (en) | Immune protein for resisting bacterial infection of koi and application | |
| CN110257409B (en) | Red swamp crayfish hatching enzyme gene and application thereof | |
| CN107602686A (en) | A kind of polypeptide resistant to gram-positive bacteria | |
| CN107857805B (en) | Litopenaeus vannamei fibrinogen LvFREP and coding gene and application thereof | |
| CN108841746B (en) | Bacillus thuringiensis for producing cellulase and inhibiting vibrio splendidus and using method | |
| CN108203697B (en) | Yeast engineering bacterium of fish natural killer cell enhancement factor and application thereof | |
| CN111955486A (en) | Method for preventing and controlling plant pests, nucleic acid pesticide, and preparation method and application thereof | |
| CN101164431A (en) | Feed additive with antibiotic function and application | |
| CN106749609B (en) | Chicken alpha interferon and preparation method thereof | |
| CN108998385B (en) | Bacillus licheniformis for producing cellulase and inhibiting pseudoalteromonas and use method | |
| CN116004640B (en) | Gene, protein and plasmid of trachinotus ovatus B cell lymphoma-2 and application thereof | |
| CN116144667B (en) | Egg-shaped pompano insulin-like growth factor binding protein 1 gene, protein and application | |
| CN109180794B (en) | Novel penaeus monodon ALFpm12 antibacterial peptide, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210706 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |