CN108531603A - A kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes - Google Patents
A kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes Download PDFInfo
- Publication number
- CN108531603A CN108531603A CN201810547315.6A CN201810547315A CN108531603A CN 108531603 A CN108531603 A CN 108531603A CN 201810547315 A CN201810547315 A CN 201810547315A CN 108531603 A CN108531603 A CN 108531603A
- Authority
- CN
- China
- Prior art keywords
- kit
- dsn
- primer pair
- dna
- braf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention proposes a kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes, belong to biomedical clinical Molecular Detection field, wild type DNA can be eliminated in BRAF V600E abrupt climatic changes, only leave the BRAF V600E DNA of mutation, to which jump signal amplifies during PCR, false negative result can be effectively reduced, improve detection accuracy.The primer pair includes sense primer and the downstream primer as shown in SEQ No.2 sequences as shown in SEQ No.1 sequences.The present invention can be applied to BRAF V600E (1799T>A) in detection in Gene Mutation in the amplification of jump signal.
Description
Technical field
The invention belongs to biomedical clinical Molecular Detection fields, more particularly to a kind of BRAF gene V600E that is used for be mutated
Primer pair, kit and its detection method of detection.
Background technology
BRAF is that a kind of guanine nucleotide binding protein RAS activates serine/threonine protein kitase, is adjusting mitogen
It plays a significant role in activated protein kinase (MAPK) signal path, is one of most important proto-oncogene.MAPK signal paths
Can normal regulating cell growth, division and differentiation, also can cause cancer because of the formation of RAF family member's oncogenic mutation bodies.
The generation of wherein BRAF V600 mutant significantly enhances the activity of BRAF, out of control so as to cause cancer cell division, and about 8%
Human tumor occur BRAF mutation.BRAF overwhelming majority mutant forms are BRAF V600E mutation, take place mostly in metastatic
In melanoma, colon cancer, lung cancer and thyroid cancer.From after first BRAF V600E targeted inhibition agent approval listing in 2011,
Effectively extend melanoma patients progression free survival phase and Overall survival.
Liquid biopsy blood testing technology once by《The science and technology comment of Massachusetts Polytechnics》It is chosen as " ten quantum jump skills in 2015
Art " nowadays becomes very powerful and exceedingly arrogant, is diagnosed to diseases such as cancers by blood or urine etc., advantage is to lead to again
Crossing Noninvasive sampling reduces the harm of biopsy, can effectively extend patient survival.Liquid biopsy at present predominantly detects object packet
The circulating tumor cell to dissociate in detection blood is included, Circulating tumor DNA (ctDNA) fragment recycles RNA and excretion body etc..Rely on
Cancer is surveyed in one pipe blood examination, this is the common dream of recent decades whole world medical field.Liquid Biopsy attempts with various technologies
Means capture related neoplasms information in blood, to evade the limitation that traditional approach needs operation, punctures sampling.
However, dissociating Tumour DNA using cycle to carry out early detection, the content of the Tumour DNA in ctDNA is considerably less,
The concentration of Tumour DNA is often less than detectable limit, and missing inspection easily occurs in conventional method, obtains false negative result.Therefore, how
The BRAF V600E DNA that mutation is only left in BRAF V600E abrupt climatic changes make its jump signal during PCR amplify, from
And it reduces false negative result, improve the technical issues of detection accuracy will be urgent need to resolve for this field.
Invention content
The present invention proposes a kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes, should
Method can eliminate wild type DNA in BRAF V600E abrupt climatic changes, only leave the BRAF V600E DNA of mutation, thus
Jump signal amplifies during PCR, can effectively reduce false negative result, improve detection accuracy.
In order to achieve the above object, the present invention provides a kind of primer pair for BRAF gene V600E abrupt climatic changes, packets
Include sense primer and the downstream primer as shown in SEQ No.2 sequences as shown in SEQ No.1 sequences.
Preferably, including the primer pair as shown in above-mentioned technical proposal.
Preferably, the kit includes the second kit containing the primer pair and contains and the primer pair
First kit of the probe being used cooperatively, wherein the probe is including the Sense probes as shown in SEQ No.3 sequences and such as
Antisense probe shown in SEQ No.4 sequences.
Preferably, first kit further includes at PCR reaction tubes, deionized water, DSN buffer solutions and unused DSN
The negative controls of reason.
Preferably, second kit further includes at PCR reaction tubes, DSN treated DNA samples and unused DSN
Negative DNA reference substances, Phusion HF buffer solutions, deionized water, dNTP and the polymerase of reason.
The present invention also provides a kind of kits using described in any of the above-described technical solution to carry out BRAF genes
The method of V600E abrupt climatic changes, includes the following steps：
Template DNA, Sense probes and antisense probe are added in the PCR pipe in the first kit and carry out PCR reactions, tool
Body, which is included at 98 DEG C, reacts 2min, after template DNA denaturation, cools the temperature to 67 DEG C, while the DSN of 1 unit is added
Buffer solution after reacting 20min at 67 DEG C after mixing, raises the temperature to 95 DEG C the reaction was continued that 20min makes DSN inactivate, obtains DSN
Buffer solution treated DNA sample；Meanwhile establishing the negative DNA reference substances for the DSN buffer solutions for being added without 1 unit；
By DSN buffer solutions treated DNA sample or feminine gender DNA reference substances, primer pair, Phusion HF buffer solutions, go
Polymerase chain reaction is carried out in the PCR pipe that ionized water, dNTP and polymerase are added in the second kit, respectively obtains polymerase chain
Product.
Preferably, when carrying out PCR reactions using first kit, following volumes is specifically added in each reactant, altogether
Count 10 μ l：
Preferably, when carrying out polymerase chain reaction using second kit, each reactant is specifically added with lower body
Product amounts to 25 μ l：
The condition of polymerase chain reaction is：98 DEG C of reaction 2min, then with 98 DEG C of 10sec, 58 DEG C 20sec and 72 DEG C
10sec is recycled 45 times, and 5min is finally reacted at 72 DEG C.
Preferably, further including being purified respectively to obtained Polymerase chain reaction products using PCR purification kits, so
The step of it is sequenced respectively using mulberry lattice sequence pair afterwards.
The primer pair and the kit that the present invention also provides a kind of as described in above-mentioned technical proposal are in BRAF gene
Application in being amplified to jump signal in V600E abrupt climatic changes.
Compared with prior art, the advantages and positive effects of the present invention are：
By devising targetedly primer pair in BRAF gene V600E mutation detection kits provided by the present invention
And the probe to match with the primer pair so that sample can effectively eliminate the DNA of wild type, only protect after being handled by DSN
The BRAF V600E DNA for staying mutation make it that can be amplified jump signal in PCR reactions, can greatly reduce vacation in this way
Negative findings increase the accuracy of detection, to thyroid cancer, colorectal cancer, lung cancer and metastasis melanin tumor patient
In the patient with BRAF V600E mutation carry out medication guide.
Description of the drawings
The DSN buffer solutions that Fig. 1 is provided by the embodiment of the present invention treated DNA sample and feminine gender DNA reference substances are being dashed forward
Test result when Frequency is 5%；
The DSN buffer solutions that Fig. 2 is provided by the embodiment of the present invention treated DNA sample and feminine gender DNA reference substances are being dashed forward
Test result when Frequency is 1%；
The DSN buffer solutions that Fig. 3 is provided by the embodiment of the present invention treated DNA sample and feminine gender DNA reference substances are being dashed forward
Test result when Frequency is 0.1%.
Specific implementation mode
It will be provided for the embodiments of the invention the primer pair for BRAF gene V600E abrupt climatic changes, kit below
And its technical solution of detection method is clearly and completely described, it is clear that described embodiment is only the present invention one
Divide embodiment, instead of all the embodiments.Based on the embodiments of the present invention, those of ordinary skill in the art are not making
The every other embodiment obtained under the premise of creative work, shall fall within the protection scope of the present invention.
Embodiment 1
Material explanation：
Template DNA:It is obtained since BRAF V600E DNA are extremely difficult from human body, used in the embodiment of the present invention
Template DNA is Catalog ID:HD238,BRAF V600E Reference Standard.
1, primer pair：
Sense primer：BRAF V600E PCR F:ACCATCCACAAAATGGATCCAG(SEQ No.1)
Downstream primer：BRAF V600E PCR R:ATTTCTTCATGAAGACCTCACAG(SEQ No.2)
2, probe：
Sense probes：BRAF V600E antisense_2probe:CCCACTCCATCGAGATTTCACTGTA (SEQ
No.3)
Antisense probe：BRAF V600E sense_2probe:TTTGGTCTAGCTACAGTGAAATCTCG(SEQ No.4)
3, kit：
First kit：At Sense probes, antisense probe, PCR reaction tubes, deionized water, DSN buffer solutions and unused DSN
The negative controls of reason；
Second kit：At sense primer, downstream primer, PCR reaction tubes, DSN treated DNA sample and unused DSN
Negative DNA reference substances, Phusion HF buffer solutions, deionized water, dNTP and the polymerase of reason.
Detection method：
The first kit is taken, template DNA is handled, system is as follows：
Specifically, template DNA, Sense probes and antisense probe are added to progress PCR reactions in PCR pipe, specially exist
2min is reacted at 98 DEG C allows template DNA to be denaturalized, and cools the temperature to 67 DEG C, and PCR pipes, which are still placed in PCR instrument, at this time does not take out, and adds
Enter the buffer solution of the DSN (DSN Evrogen, EA001) of 1 unit to increase temperature after reacting 20min at 67 DEG C after mixing
To 95 DEG C, the reaction was continued that 20min makes DSN inactivate, and obtains DSN buffer solutions treated DNA sample.
The unconventional PCR reactions of the step, Sense probes and antisense probe can be respectively incorporated on corresponding template DNA, lead to
It crosses formation and allows the targeting object that DSN is identified to be decomposed.Wherein, the addition of deionized water can be according to the addition of template DNA
It is adjusted, such as adds the template DNA of 1 μ l, 6 μ l deionized waters are just added in that, and final reaction system is allowed to be maintained at 10
μl。
Meanwhile establishing the negative DNA reference substances for the DSN for being added without 1 unit；
By DSN buffer solutions treated DNA sample, primer pair, Phusion HF buffer solutions, deionized water, dNTP and poly-
Polymerase chain reaction is carried out in the PCR pipe that synthase is added in the second kit, obtains Polymerase chain reaction products；Meanwhile DSN being buffered
Liquid treated DNA sample replaces with negative DNA reference substances, making obtain the Polymerase chain reaction products of negative DNA reference substances.The two
Reaction system is as follows：
The execution condition of polymerase chain reaction is：98 DEG C of reaction 2min, then with 98 DEG C of 10sec, 58 DEG C of 20sec and 72
DEG C 10sec is recycled 45 times, and 5min is finally reacted at 72 DEG C.
In the step, since the polymerase of purchase packs difference, it is divided into 1unit/ μ l and 10unit/ μ l, it is therefore desirable to root
The volume that water is adjusted according to the volume of the polymerase of addition makes final reaction system in 25 μ l.
Purification process：
Using QIAquick PCR purification kits (Qiagen, 28104) to obtained two Polymerase chain reaction products point
It is not purified, then it is carried out to survey when the frequency of mutation is 5%, 1% and 0.1% respectively using Sanger sequencings
Sequence, obtained result are as shown in Figs. 1-3.
Interpretation of result：
In conjunction with Fig. 1-3 Sanger sequencing results provided it is found that when the frequency of mutation is 5% and 1%, negative DNA controls
In frame in base or wild type, be A, but in DSN treated DNA samples, the DNA of wild type then disappeared
It removes, and the base signal being mutated is amplified, it can thus be seen that T.For the frequency of mutation be 0.1% sample in, in frame
Though base, which is the A of wild type, does not become T, in Fig. 3 or it can see that the red of a protrusion represents the peak value of T, and this
A peak value be can't see completely in negative control.Under normal conditions, Sanger is sequenced when the frequency of mutation is less than 10% just
It can't detect, and the micro mutation that high-flux sequence is can be found that is down to 0.1%, but be difficult whether distinguish be false positive.
So if sample is first passed through DSN processing, although the mutation peak value in Sanger sequencings is not high, high throughput is used again at this time
The method of sequencing detects, then can be easy to obtain, and false positive issue is not present.
Sequence table
<110>Qingdao Pu Zemaidi Bioisystech Co., Ltd
<120>A kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
accatccaca aaatggatcc ag 22
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
atttcttcat gaagacctca cag 23
<210> 3
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cccactccat cgagatttca ctgta 25
<210> 4
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
tttggtctag ctacagtgaa atctcg 26
Claims (10)
1. a kind of primer pair for BRAF gene V600E abrupt climatic changes, which is characterized in that including as shown in SEQ No.1 sequences
Sense primer and the downstream primer as shown in SEQ No.2 sequences.
2. a kind of kit for BRAF gene V600E abrupt climatic changes, which is characterized in that comprising as shown in claim 1
Primer pair.
3. kit according to claim 2, which is characterized in that the kit includes second containing the primer pair
Kit and the first kit containing the probe being used cooperatively with the primer pair, wherein the probe includes such as SEQ
Sense probes shown in No.3 sequences and the antisense probe as shown in SEQ No.4 sequences.
4. kit according to claim 3, which is characterized in that first kit further includes PCR reaction tubes, go from
The negative controls of sub- water, DSN buffer solutions and unused DSN processing.
5. kit according to claim 4, which is characterized in that second kit further includes PCR reaction tubes, DSN
DNA sample that treated and unused DSN processing negative DNA reference substances, Phusion HF buffer solutions, deionized water, dNTP and
Polymerase.
6. a kind of method carrying out BRAF gene V600E abrupt climatic changes using claim 2-5 any one of them kits,
It is characterized in that, includes the following steps：
Template DNA, Sense probes and antisense probe are added in the PCR pipe in the first kit and carry out PCR reactions, is specifically included
2min is reacted at 98 DEG C, after template DNA denaturation, cools the temperature to 67 DEG C, while the buffer solution of the DSN of 1 unit is added,
After reacting 20min at 67 DEG C after mixing, 95 DEG C are raised the temperature to the reaction was continued that 20min makes DSN inactivate, obtain DSN buffer solutions
DNA sample that treated；Meanwhile establishing the negative DNA reference substances for the DSN buffer solutions for being added without 1 unit；
By DSN buffer solutions treated DNA sample or feminine gender DNA reference substances, primer pair, Phusion HF buffer solutions, deionization
Polymerase chain reaction is carried out in the PCR pipe that water, dNTP and polymerase are added in the second kit, respectively obtains polymerase chain production
Object.
7. each anti-according to the method described in claim 6, it is characterized in that, when carrying out PCR reactions using first kit
It answers object that following volumes is specifically added, amounts to 10 μ l：
8. according to the method described in claim 6, it is characterized in that, carrying out polymerase chain reaction using second kit
When, following volumes is specifically added in each reactant, amounts to 25 μ l：
The condition of polymerase chain reaction is：98 DEG C of reaction 2min, are then followed with 98 DEG C of 10sec, 58 DEG C of 20sec and 72 DEG C of 10sec
Ring 45 times finally reacts 5min at 72 DEG C.
9. according to the method described in claim 6, it is characterized in that, further including being gathered to obtained using PCR purification kits
The step of synthase chain product is purified respectively, and then it is sequenced respectively using mulberry lattice sequence pair.
10. a kind of primer pair as described in claim 1 and claim 2-5 any one of them kits are in BRAF gene
Application in being amplified to jump signal in V600E abrupt climatic changes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810547315.6A CN108531603A (en) | 2018-05-31 | 2018-05-31 | A kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810547315.6A CN108531603A (en) | 2018-05-31 | 2018-05-31 | A kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108531603A true CN108531603A (en) | 2018-09-14 |
Family
ID=63473259
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810547315.6A Withdrawn CN108531603A (en) | 2018-05-31 | 2018-05-31 | A kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108531603A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571948A (en) * | 2013-10-09 | 2014-02-12 | 武汉康录生物技术有限公司 | Kit for detecting hotspot mutation of BRAF gene and detection method thereof |
| CN105400900A (en) * | 2015-12-29 | 2016-03-16 | 杭州迪安生物技术有限公司 | Kit for detecting BRAF gene V600E trace mutation through pyrosequencing technique and application of kit |
| CN105861726A (en) * | 2016-06-08 | 2016-08-17 | 广东凯普生物科技股份有限公司 | Braf gene mutation detection kit |
| WO2016210224A1 (en) * | 2015-06-24 | 2016-12-29 | Dana-Farber Cancer Institute, Inc. | Selective degradation of wild-type dna and enrichment of mutant alleles using nuclease |
| CN107893109A (en) * | 2017-11-08 | 2018-04-10 | 重庆邮电大学 | A kind of low abundance gene mutation enrichment method based on removal wild-type sequence |
-
2018
- 2018-05-31 CN CN201810547315.6A patent/CN108531603A/en not_active Withdrawn
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571948A (en) * | 2013-10-09 | 2014-02-12 | 武汉康录生物技术有限公司 | Kit for detecting hotspot mutation of BRAF gene and detection method thereof |
| WO2016210224A1 (en) * | 2015-06-24 | 2016-12-29 | Dana-Farber Cancer Institute, Inc. | Selective degradation of wild-type dna and enrichment of mutant alleles using nuclease |
| CN105400900A (en) * | 2015-12-29 | 2016-03-16 | 杭州迪安生物技术有限公司 | Kit for detecting BRAF gene V600E trace mutation through pyrosequencing technique and application of kit |
| CN105861726A (en) * | 2016-06-08 | 2016-08-17 | 广东凯普生物科技股份有限公司 | Braf gene mutation detection kit |
| CN107893109A (en) * | 2017-11-08 | 2018-04-10 | 重庆邮电大学 | A kind of low abundance gene mutation enrichment method based on removal wild-type sequence |
Non-Patent Citations (1)
| Title |
|---|
| SHOICHI MATSUKUMA等: "Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay", 《JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946739B (en) | EGFR genetic mutation detection kit and its application | |
| CN105506746A (en) | Method for constructing variable region sequencing library, and method for determining variable region nucleic acid sequence | |
| CN106065414A (en) | Noninvasive cancer of pancreas polygenes detection method and kit based on blood plasma cfDNA detection technique | |
| CN104031992B (en) | Mankind B-raf gene V600 mutation detection kit | |
| CN107723352A (en) | A kind of Circulating tumor DNA liver cancer drives gene high-flux detection method | |
| Hasegawa et al. | Highly sensitive fusion detection using plasma cell‐free RNA in non‐small‐cell lung cancers | |
| Maggi et al. | Development of a method to implement whole-genome bisulfite sequencing of cfDNA from cancer patients and a mouse tumor model | |
| CN107312770A (en) | A kind of construction method in tumour BRCA1/2 genetic mutations library detected for high-flux sequence and its application | |
| CN107513578A (en) | A kind of nucleic acid Mass Spectrometry detection method early sieved for lung cancer driving gene and tumor susceptibility gene | |
| CN104745719A (en) | Primer, probe and detection reagent kit for detecting RET fusion gene | |
| CN107557460A (en) | Method based on nucleic acid mass-spectrometric technique detection colorectal cancer driving gene and susceptible SNP | |
| CN105861726A (en) | Braf gene mutation detection kit | |
| CN108410982A (en) | A kind of kit based on 34 mutational sites of MALDI-TOF-MS detection lung cancer | |
| CN107557461A (en) | A kind of mass spectrographic detection method of nucleic acid early sieved for liver cancer susceptibility | |
| CN102952794A (en) | Preparation method of targeting gene DNA (deoxyribose nucleic acid) molecular probe | |
| CN109439747A (en) | One group of circRNA marker and its application for pulmonary cancer diagnosis | |
| CN103131779A (en) | Enzyme digestion enriched PCR method used in noninvasive detection of epidermal growth factor receptor T790M mutation | |
| CN105255869B (en) | Application of ABCC4 gene polymorphism site rs3742106 and detection primer and kit thereof | |
| CN110982898A (en) | MyD88 gene L265P mutation detection kit based on ARMS-PCR and detection method | |
| CN108531603A (en) | A kind of primer pair, kit and its detection method for BRAF gene V600E abrupt climatic changes | |
| CN106755551A (en) | A kind of EGFR/L858R is mutated liquid biopsy kit and its application | |
| CN109355390A (en) | For detecting kit and its application of colorectal cancer | |
| CN110656171A (en) | Application of small nucleolus ribonucleic acid SNORD33 as biomarker for preparing detection kit | |
| CN107502656A (en) | It is a kind of to detect CYP2C19 and UGT1A1 gene multisite mutation kits simultaneously | |
| CN107586851A (en) | A kind of KRAS, NRAS, BRAF gene mutation detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180914 |