CN108531588A - A kind of kit of detection C3orf21 gene fragment expression amounts - Google Patents
A kind of kit of detection C3orf21 gene fragment expression amounts Download PDFInfo
- Publication number
- CN108531588A CN108531588A CN201810315988.9A CN201810315988A CN108531588A CN 108531588 A CN108531588 A CN 108531588A CN 201810315988 A CN201810315988 A CN 201810315988A CN 108531588 A CN108531588 A CN 108531588A
- Authority
- CN
- China
- Prior art keywords
- c3orf21
- kit
- detection
- gene fragment
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention discloses a kind of kits of detection C3orf21 gene fragment expression amounts to judge the prognosis situation of non-small cell lung cancer in vitro by identifying the change of divergence of non-small cell lung cancer sample and C2orf21 expression quantity in sample by corresponding cancer or normal sample.
Description
Technical field
The present invention relates to biomedicine field, specially a kind of kit of detection C3orf21 gene fragment expression amounts.
Background technology
Lung cancer is one of most common malignant tumour in the world, has become China's urban population Death Cause for Malignant Tumors
1st.Non-small cell type lung cancer includes squamous cell carcinoma (squamous carcinoma), gland cancer and large cell carcinoma, non-small cell type cancerous symptom with it is small
Cell cancer symptom is compared, growth of cancer cells division it is slower, diffusion transfer relatively late, and data show non-small cell lung cancer about
Account for the 80% of all lung cancer, when about 75% Finding case has been in middle and advanced stage, and survival rate is very low within 5 years.Therefore how can be
Early detection non-small cell type cancer, and treated in time, the survival rate of cancer patient can be improved to the full extent.
The study found that the response expression of the transfer of non-small cell lung cancer, invasion and Notch signal paths has close pass
System, and Notch signal paths is promoted to generate stress, need Notch protein receptors to interact with corresponding ligand.
This interaction sites is xyloside xylosyltransferase by many chemical modifications, wherein most critical a modification enzyme
(XXYLT1).For this purpose, there is feasibility to carry out non-small cell lung cancer prediction by monitoring the state of modification enzyme.
Further study show that there are 2 SNP by the gene C 3orf21 of coding xyloside xylosyltransferase (XXYLT1)
Site, in conjunction with mutational site and clinical case sample analysis, the mutation of C3orf21 and the onset risk of non-small cell lung cancer are close
It is related.Show that C3orf21 gene mutations and the transfer of non-small cell lung cancer, prognosis are closely related by cell and case research.
Invention content
The object of the present invention is to provide a kind of kit of detection C3orf21 gene fragment expression amounts, which passes through
Identify the difference of non-small cell lung cancer sample and C3orf21 gene fragment expression amounts in sample by corresponding cancer or normal sample
Variation, judges the prognosis situation of non-small cell lung cancer in vitro.
In order to achieve the above-mentioned object of the invention, present invention employs following technical schemes：A kind of detection C3orf21 genetic fragments
The kit of expression quantity includes two SNP sites for being respectively labeled as the sites a and the sites b in C3orf21 genetic fragments, described
Kit detects C3orf21 gene fragment expression amounts by detecting sites a on C3orf21 genes and the sites b：
The kit is directed to the primer and correspondent probe in the sites a：homo rs2131877
Upstream：CTGGCCTTCAGGACCTAC
Downstream：CTGCCTGTAACCTCAAAGA
Probe：CGGAGAGGTTAAATG
The kit is directed to the primer and correspondent probe in the sites b：homo rs952481
Upstream：TAAATGGGAAGGAAATGGTT
Downstream：CGACTTAATTGATTGGGAGC
Probe：GCTAACCAGCCAGAGAG
Preferably, the method for the kit detection C3orf21 gene fragment expression amounts is that combination method is sequenced in basis PCR-.
Preferably, the kit is using library preparation and target enrichment kits examinations
Agent box is as basic kit.
Preferably, SEQ ID No1 in the C3orf21 gene fragment orders such as sequence table.
Compared with prior art, a kind of examination of detection C3orf21 gene fragment expression amounts of above-mentioned technical proposal is used
Agent box, has the advantages that：
The present invention provides a kind of kit of detection C3orf21 gene fragment expression amounts, passes through identification using the kit
The change of divergence of non-small cell lung cancer sample and C2orf21 expression quantity in sample by corresponding cancer or normal sample, sentences in vitro
The prognosis situation of disconnected non-small cell lung cancer is conducive to find and understand over the course for the treatment of shifting, in advance for non-small cell carcinoma early
Afterwards.
Description of the drawings
Fig. 1 is that restriction endonuclease analysis result and sequencing result analyze schematic diagram；
In figure：Enzyme:HindIII/BamHI；Expected Size:1200+5.4K；The goods of Marker Ladder
Number：SM0331, company are Thermo Fisher Scientific.
Fig. 2 is the expression schematic diagram that RT-qPCR verifies c3or21 genes after siRNA infection；
Reference numeral in figure：CK, MSTO-211H cell (infect) group without siRNA；SiRNA, negative control siRNA senses
Contaminate MSTO-211H groups of cells；SiRNA1, siRNA1 infect MSTO-211 groups of cells；It is thin that siRNA2, siRNA2 infect MSTO-211
Born of the same parents' group；SiRNA3, siRNA3 infect MSTO-211 groups of cells.
Fig. 3 is the expression schematic diagram of c3or21 genes after the authenticated expression plasmid infection of RT-qPCR；
Reference numeral in figure：CK, MSTO-211H cell (infect) group without plasmid；NCpc, negative control plasmids
PcDNA3.1 infects MSTO-211H groups of cells；Plasmid, c3or21 are overexpressed plasmid and infect MSTO-211H groups of cells.
Fig. 4 is that WB verifies siRNA and is overexpressed the expression (one) of c3orf21 albumen after plasmid infection；
Fig. 5 is that WB verifies siRNA and is overexpressed the expression (two) of c3orf21 albumen after plasmid infection；
Fig. 6 is cell CFSE flow cytometer showed figures after different disposal；
In figure：The upper left corner is %Divided, and the lower left corner is Division Index.
Fig. 7 is MTSO-211H apoptosis rate schematic diagrames；(note：Apoptosis rate %=early apoptosis rate %+ late apoptics
Rate %).
Reference numeral in figure：CK, MSTO-211H group；SiNC groups；SiRNA, c3orf21-siRNA group；PcDNA groups；Matter
Grain, c3orf21- are overexpressed plasmid group.
Fig. 8 is MTSO-211H Apoptosis flow cytometer showed figures；
Reference numeral in figure：Q2-1：Non-viable non-apoptotic cell；Q2-2：Non-viable apoptotic cell；Q2-3：Normal cell；Q2-4：In early days
Apoptotic cell.
Fig. 9 is RTCA result schematic diagrams；
Reference numeral in figure：A, MSTO-211H groups；B, siNC groups；C, c3orf21-siRNA groups；D, pcDNA3.1 groups；f、
C3orf21- is overexpressed plasmid group.
Specific implementation mode
With reference to specific embodiment and attached drawing, the present invention is described further.As described below is the preferred of the present invention
Embodiment can also be made several for those of ordinary skill in the art without departing from the principles of the invention
Variations and modifications, these also should be regarded as protection scope of the present invention.
Embodiment 1
1, DNA is extracted
1) a certain amount of tissue is taken, after grinding, adds TE 0.5ml, is transferred in homogenizer and is homogenized.
2) homogenate is transferred in 1.5ml centrifuge tubes
3) add 20%SDS 25ml, Proteinase K (2mg/ml) 25ml, mixing
4) 60 DEG C of water-bath 1-3hr
5) plus in isometric saturated phenol to above-mentioned sample treatment liquid, mildly, 3min is mixed well
6) 5000g 10min are centrifuged, are taken in upper strata aqueous phase to another 1.5ml centrifuge tubes
7) add isometric phenol/chloroform, gently mixing, centrifuge 5000g 10min, upper strata aqueous phase is taken to be centrifuged to another 1.5ml
Guan Zhong.If water phase is not clarified still, this step is repeated for several times
8) add isometric chloroform, gently mixing, centrifuge 5000g 10min, take upper strata aqueous phase to another centrifuge tube
9) absolute ethyl alcohol for adding 3M sodium acetates (pH5.2) and 2.5 times of volumes of 1/10 volume, is gently inverted mixing
10) after floccule appearance, 5000g 5min is centrifuged, supernatant is abandoned
11) precipitation washs centrifugation 5000g 3min with 75% ethyl alcohol, abandons supernatant
12) volatilize ethyl alcohol at room temperature, to be precipitated to add 50-100ul TE dissolvings after near-transparent overnight.
2, the measurement of DNA purity and DNA are quantified
It is control (Blank) with coordinative solvent, 2 μ l DNA solutions is taken to be detected in BioDrop, observation A260/A280,
A260/A230 ratios and continuous wavelength absorption peak, and DNA solution concentration is calculated, judge that DNA extracts quality：A260/A280>2.0
And<2.3, then it can meet needed for subsequent experimental.
3, PCR amplification
2ul DNA are added in PCR amplification reagent, the upstream and downstream 1ul primer mixed liquor are finally added, by following parameter
Amplification
1、95.0℃for 3min
2、95.0℃for 10s
3、54.4℃for 30s
4、72.0℃for 30s
5, GOTO2,40more times
6、72.0℃for 10min
7、4.0℃for forever
4, it is sequenced：
With above-mentioned pcr amplification product, library preparation and target enrichment kits are used
As basic sequencing reagent, each 1 equal portions of above-mentioned two probe are added in mixing, and C3orf21 two is detected using illumina sequenators
A SNP site.
Embodiment 2：SiRNA and over-express vector structure
1, NCBI retrieves c3orf21 gene orders；
2, full genome composition sequence is carried out according to the gene order that retrieval obtains；
3, target sequence is combined into pcDNA3,1 carrier by double digestion method；
4, restriction endonuclease analysis confirms expression vector establishment success；
Restriction enzyme result and sequencing result analysis chart as shown in Figure 1, it can be deduced that over-express vector is built into
Work(.
Embodiment 3：SiRNA and overexpression plasmid compliance test result
By c3orf21 gene expression amounts after QPCR and WB detection transfections human lung carcinoma cell MSTO-211H 48h change come
It verifies siRNA and is overexpressed the effect of plasmid.
1, the MSTO-211H cells in exponential phase that take growth conditions good, respectively pancreatin digestion, centrifugation, blood
It is counted under ball count plate, spreads 6cm wares, per 40 × 104, hole cell, cultivated in 37 DEG C, the saturated humidity incubator of 5%CO2
Overnight.
2, after overnight incubation, according to RNAiMAX specifications, siRNA and RNAiMAX are with 3ul：The ratio of 6ul carries out siRNA
Transfection；According to lipo3000 specifications, plasmid and lipo3000 are with 5ug：7, the ratio of 5ul carries out siRNA transfections；It is received after 48h
Collect sample and carries out QPCR and WB detections.
As a result it shows：
Fig. 2 RT-qPCR are the results show that NC groups are compared with siRNA1, siRNA2 with siRNA3 groups, target gene c3orf21
Expression reduce 85%, 88% and 77% respectively；
For Fig. 3 RT-qPCR the results show that NCpc groups are compared with plasmid group, the expression of target gene c3orf21 increases 132
Times.
The WB of Figure 4 and 5 the results show that NC groups are compared with siRNA groups, lower bright by destination protein XXYLT1 expression siRNA2 groups
It is aobvious；Plasmid group is compared with NCpc groups, destination protein XXYLT1 up-regulated expressions.
After siRNA and overexpression plasmid infect, gene expression dose and protein expression level reach expected results.It is (pre-
Phase result：After siRNA interference, c3orf21 gene levels and XXYLT1 protein levels are lowered；After being overexpressed plasmid infection,
C3orf21 gene levels and the up-regulation of XXYLT1 protein levels).
Embodiment 4：CFSE detects cell Proliferation
1, it transfects the siRNA of c3orf21 genes with human lung carcinoma cell MSTO-211H and is overexpressed plasmid：
The MSTO-211H cells in exponential phase that take growth conditions good, respectively pancreatin digestion, centrifugation, blood cell
It is counted under tally, spreads 1 piece of six orifice plate, per 30 × 104, hole cell, trained in 37 DEG C, the saturated humidity incubator of 5%CO2
It supports overnight.
The grouping of MSTO-211H cell experiments is as follows：
(1) MSTO-211H groups (CK)
(2) siNC groups
(3) c3orf21-siRNA groups
(4) pcDNA3,1 group
(5) c3orf21- is overexpressed plasmid group
After overnight incubation, according to RNAiMAX specifications, siRNA and RNAiMAX are with 1ul：The ratio of 3ul carries out siRNA and turns
Dye；According to lipo3000 specifications, plasmid and lipo3000 are with 2,5ug：The ratio of 3ul carries out plasmid transfection；It carries out afterwards for 24 hours
CFSE is dyed.
2, CFSE is dyed：
(1) pancreatin digests each group cell, and cell concentration is adjusted to about 107/ml with blank cultures；
(2) 10uM CFSE dyeing liquors are added, gently mixing, 15-30min is cultivated in 37 DEG C of incubators；
(3) supernatant is removed after centrifuging, and 2ml PBS solutions is added, then remove supernatant after centrifuging, is repeated once；
(4) six orifice plates are inoculated with 10 × 104/hole, are placed in 37 DEG C, cultivate 72h in the saturated humidity incubator of 5%CO2
3, flow cytometer detection：
(1) cell of effect 72h is cleaned with 1 × PBS removes the cell to fall off and remaining culture solution twice；
(2) it is added 0,25% pancreatin 500 μ L in plate, 37 DEG C, digest in 5%CO2 saturated humidity constant incubators
After 2-3min, lower cell, 800rpm are gently blown off, centrifugation 5min collects cell；
(3) it is cleaned once with 1 × PBS, cell is collected by centrifugation；It is repeated once；
(4) soft to be vortexed after using 500ul PBS that cell is resuspended, machine testing in streaming.
From the point of view of CFSE results as shown in FIG. 6, SINC and pcDNA groups have a degree of growth inhibition compared with CK,
Illustrate that transfection has certain influence to cell.Compared with SINC groups, SIRNA group decreased growths are apparent；Compared with pcDNA groups, mistake
Expression plasmid group grows no significant difference.
Embodiment 5：Flow cytometer detection Apoptosis
Detection each group is thin after the siRNA and overexpression plasmid 48h of human lung carcinoma cell MSTO-211H transfection c3orf21 genes
The apoptosis situation of born of the same parents.
Detection each group is thin after the siRNA and overexpression plasmid 48h of human lung carcinoma cell MSTO-211H transfection c3orf21 genes
The apoptosis situation of born of the same parents.
1, plasmid transfection
The MSTO-211H cells in exponential phase that take growth conditions good, respectively pancreatin digestion, centrifugation, blood cell
It is counted under tally, spreads 1 piece of six orifice plate, per 30 × 104, hole cell, trained in 37 DEG C, the saturated humidity incubator of 5%CO2
It supports overnight.
The grouping of MSTO-211H cell experiments is as follows：
(1) MSTO-211H groups (CK)
(2) siNC groups
(3) c3orf21-siRNA groups
(4) pcDNA3.1 groups
(5) c3orf21- is overexpressed plasmid group
After overnight incubation, according to RNAiMAX specifications, siRNA and RNAiMAX are with 1ul：The ratio of 3ul carries out siRNA and turns
Dye；According to lipo3000 specifications, plasmid and lipo3000 are with 2.5ug：The ratio of 3ul carries out plasmid transfection；It withers after 48h
Die detection.
2, flow cytometer detection apoptosis
(1) treated, and cell cleans with 1 × PBS collects the cell to fall off and remaining culture solution twice；
(2) it is added 0.25% pancreatin 1ml in plate, 37 DEG C, digest 2- in 5%CO2 saturated humidity constant incubators
After 3min, lower cell, 2000rpm are gently blown off, centrifugation 5min collects cell；
(3) it is cleaned once with 1 × PBS, cell is collected by centrifugation；
(4) cell is resuspended in 1 × Binding Buffer that 500ul is added in every solencyte；
(5) PI of the Annexin V-FITC and 10ul of 5ul are added in every solencyte；
(6) after soft vortex mixing, room temperature, which is protected from light, is incubated 5min；
(7) machine testing in streaming.
If the apoptosis result shown in Fig. 7 and Fig. 8 is it is found that compared with siNC groups, c3orf21-siRNA group apoptosis is reduced
7%；Compared with pcDNA3.1 groups, c3orf21- is overexpressed plasmid group apoptosis and increases by 4%；Statistical analysis is poor without conspicuousness
It is different.Illustrate that c3orf21 overexpressions have the tendency that promoting apoptosis.
Embodiment 6：RTCA detection experiments
RTCA detections are carried out after the siRNA and overexpression plasmid of human lung carcinoma cell MSTO-211H transfection c3orf21 genes
The migration situation of 72h each group cells.
The MSTO-211H cells in exponential phase that take growth conditions good, respectively pancreatin digestion, centrifugation, blood cell
It is counted under tally, spreads 1 piece of six orifice plate, per 30 × 104, hole cell, trained in 37 DEG C, the saturated humidity incubator of 5%CO2
It supports overnight.
The grouping of MSTO-211H cell experiments is as follows：
(1) MSTO-211H groups (CK)
(2) siNC groups
(3) c3orf21-siRNA groups
(4) pcDNA3.1 groups
(5) c3orf21- is overexpressed plasmid group
After overnight incubation, according to RNAiMAX specifications, siRNA and RNAiMAX are with 1ul：The ratio of 3ul carries out siRNA and turns
Dye；According to lipo3000 specifications, plasmid and lipo3000 are with 2.5ug：The ratio of 3ul carries out plasmid transfection；It carries out afterwards for 24 hours
RTCA is tested.
RTCA is tested
(1) assembly of CIM plates and base line measurement
A.CIM plates assemble：CIM upper chamber and lower room are taken out from packaging bag in super-clean bench, CIM fixtures are placed on ultra-clean
On platform, blue logo point is made to be located at the upper left side of fixture, lower room is smoothly put into the corresponding groove of fixture.
B. 165ul serum-containing media culture mediums are added in the Kong Zhongyong multiple tracks of lower room or single track pipettor, pay attention to liquid feeding
When not generate bubble, so that the culture medium of addition is formed the meniscus of protrusion in the hole of lower room.
C. by fixture together with lower room along being rotated by 90 ° counterclockwise, sensor face in upper chamber is placed on lower room, pays attention to making
The hole of upper chamber and lower room is aligned.Pay attention to when placement upper and lower room post Bluepoint hole it is corresponding, when placement, will avoid the production of bubble
It is raw.It after upper chamber is put on lower room, is pressed down on immediately with hand, can hear the sound for buckling be caught in twice.
D. 30ul serum free mediums are added in upper chamber, pats plate surrounding, keeps distribution of culture medium uniform.Device is set
In 37 DEG C, the CO2 incubators of CO2 a concentration of 5% balance 1h.
E. base line measurement：The device for balancing 1h is placed on RTCA DP Analyzer, starts step 1 and carries out baseline
Detection.
(2) cell suspension prepares
Six orifice plates are taken out from incubator, are digested, and after centrifugation, each experimental group is configured to the cell concentration that experiment needs
4×105cells/ml。
(3) CIM plates are added in cell
A. the CIM plates for having surveyed baseline are taken out from DP, the uniformly mixed serum-free cells of 100 μ l is added in upper chamber hole
Suspension, it is respectively 40k to make cell number in every hole.
B. 16CIM plates are placed in super-clean bench and are placed at room temperature for 30min.
C. 16CIM plates are put on the RTCA Station in incubator.
D. after system automatically scanning " Scan Plate ", start Step2, interval 15min is measured once, detected altogether
72hr。
Sequence table
<110>Zhejiang Prov. Tumor Hospital
<120>A kind of kit of detection C3orf21 gene fragment expression amounts
<130> CN-CN-2017-0953-1
<141> 2018-04-10
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2291
<212> RNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
msanschrms mnradngram mccncmcdsn ankcggcgcc ggggcaaggg ccgccggcgc 60
cgggacccga gggcccccgc ggcggcaccg cggcgccgcg gccgagcgca gggccccccg 120
aggcgggccc cagcgccggg ccaggcgcgc cgggcgcggc gccccacacg cgcccgcgcg 180
gccgcggcgc ggccgcgcgc ccacacccgg ccaggccggg agacccccag cgccaccaag 240
aggcgaagga ggcccgcgcc ggggccccgc cgcgccccgc cgcccgcgcg gagcagcgcg 300
gggcccgggc gccagccccc ggcgcgaagg ccaagagcgg agggcggcgg gccgggccgg 360
ggacaccacc gcgagagcac caaggcggag cacaagccgc gcgcaggcca aggcccgcgc 420
gcgcgcgcca cgcgcgcccg ccaagcgagg cgcacgaggg caacccaccg gagcgaggag 480
gccagccgcg aggggccaag ggccgcgcgg gagcccgccg cccgccgcgg ccaaggcaag 540
gcacccacga ggcggcgacg gaaagccccc cacgggaggc cagcagaagc accaggcggc 600
gggaaccaca caggacccac cccccggcgc cagcacagac agcccaaaga gaccgcagac 660
acagcggacc agaccgaaga agaccaacac cgggagggag gaagacagcc gccaggcgcc 720
acacggcaag cccgggagag cagccagaca ggcacacacg gcagccgcca gagaaccccc 780
agacccgggg ggggcccgcc ccccgagggg cgccgggcca acagcggggg aggcgaaccg 840
gaggccagcg ccagccccgc cacagccgcc gcggagccgg cgcagggcag cagcggccga 900
caagaccacc cgcggccacc cggggaccag gacccaccag acggcaggag caccccaagc 960
cccaggcgga cgaccggaac cggcagcggc accggggagg gaccaggcac aggacgccga 1020
ggccacaggg gagggccacg caagacacca cgggaacgca acaccccacc cggaggacag 1080
gcgccccccg ccgccccggg gccccagacg ggggaaggac agggccggga cagacccaag 1140
ggcaggcgac ccgcagagag acaccgcagg gaagccggaa agggcgagac cccgccgggc 1200
aggcacggcg aggccacccg ccaaggacgg ccggcacgcg ggcgggacca ccccagggag 1260
caggcgacac aaaggacacg cagccagggg cgggaagcaa gcacgaagag aaggaagggg 1320
agaaagggcc cccgcgcgcc cgaggaagga aaccagaccc ggccggacca aaaaaaaaaa 1380
gacagcccca cgagaaagac aaacagaacg cagcacccac gagccccaaa cgggaaggaa 1440
gccaaggaag accagcccag acaagcccaa acgaagccag cccacacaac cacccgggag 1500
gcgcgcacgc gcacccgagc cacgcacggg aggcaggacg cccgaggaag gaccaggacc 1560
aacggggccg caaagaaaac accaaagaga ccacagcgac cccagcacac cagaacccca 1620
gccaccacca aaccagccca gggaccagac caccagaaag caaacgcaca aagaacagag 1680
acggccacca cgaggacagc aggagaacgc gggaccagga agaccaccaa aaaggagccc 1740
aggccgggca cagcgcaagc cgaacccaac acgggagacc gaggcggggg acgagagccc 1800
ggaggcgaga cagccgggaa acacagggag gcccccacgc acaaaaaaaa aaagccaggg 1860
ggggcggcgg cccggcacgg gaggcgaagg ggagggggcg agccaggagc acgcacgagc 1920
ggacacacca cgcacccagc cggacgacag aggagacgcc accaaaaaaa aaaaaaaaaa 1980
ccaaaaagga acccagcaac ccaagggacc aggggcggaa gacagcacca gggcagaagc 2040
acagcgaaaa aaccccacaa ccacgagacc gagaccagca gaaaaaagcg cgcgaggggc 2100
cccgacgagg cgcagacgga aagccccagg ggccagacaa cacggggaca acgccccaga 2160
ggaggaagca aaaacacgag aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2220
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2280
aaaaaaaaaa a 2291
Claims (4)
1. a kind of kit of detection C3orf21 gene fragment expression amounts, marks including two respectively in C3orf21 genetic fragments
For the SNP site in the sites a and the sites b, the kit is detected by detecting sites a on C3orf21 genes and the sites b
C3orf21 gene fragment expression amounts, it is characterised in that：
The kit is directed to the primer and correspondent probe in the sites a：homo rs2131877
Upstream：CTGGCCTTCAGGACCTAC
Downstream：CTGCCTGTAACCTCAAAGA
Probe：CGGAGAGGTTAAATG
The kit is directed to the primer and correspondent probe in the sites b：homo rs952481
Upstream：TAAATGGGAAGGAAATGGTT
Downstream：CGACTTAATTGATTGGGAGC
Probe：GCTAACCAGCCAGAGAG.
2. a kind of kit of detection C3orf21 gene fragment expression amounts according to claim 1, the kit detection
The method of C3orf21 gene fragment expression amounts is that combination method is sequenced in basis PCR-.
3. a kind of kit of detection C3orf21 gene fragment expression amounts according to claim 1, the kit use
Library preparation and target enrichment kits kits are as basic kit.
4. a kind of kit of detection C3orf21 gene fragment expression amounts according to claim 1, the C3orf21 bases
Because of SEQ ID No1 in fragment sequence such as sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810315988.9A CN108531588A (en) | 2018-04-10 | 2018-04-10 | A kind of kit of detection C3orf21 gene fragment expression amounts |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810315988.9A CN108531588A (en) | 2018-04-10 | 2018-04-10 | A kind of kit of detection C3orf21 gene fragment expression amounts |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108531588A true CN108531588A (en) | 2018-09-14 |
Family
ID=63479829
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810315988.9A Pending CN108531588A (en) | 2018-04-10 | 2018-04-10 | A kind of kit of detection C3orf21 gene fragment expression amounts |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108531588A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755154A (en) * | 2016-05-09 | 2016-07-13 | 北京泱深生物信息技术有限公司 | Molecular marker differentiating metastatic squamous cell lung carcinoma from non-metastatic squamous cell lung carcinoma |
| CN106434978A (en) * | 2016-11-24 | 2017-02-22 | 深圳市核子基因科技有限公司 | Kit for detecting susceptibility to lung cancer and SNP (Single Nucleotide Polymorphism) marker thereof |
-
2018
- 2018-04-10 CN CN201810315988.9A patent/CN108531588A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755154A (en) * | 2016-05-09 | 2016-07-13 | 北京泱深生物信息技术有限公司 | Molecular marker differentiating metastatic squamous cell lung carcinoma from non-metastatic squamous cell lung carcinoma |
| CN106434978A (en) * | 2016-11-24 | 2017-02-22 | 深圳市核子基因科技有限公司 | Kit for detecting susceptibility to lung cancer and SNP (Single Nucleotide Polymorphism) marker thereof |
Non-Patent Citations (1)
| Title |
|---|
| ZHANG ET AL.: "Association between C3orf21, TP63 polymorphisms and environment and NSCLC in never-smoking Chinese population", 《GENE》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108588224A (en) | A kind of biomarker and its application for pheochromocytoma/Chromaffionoma early diagnosis and preoperative evaluation | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| Dou et al. | An eight-miRNA signature expression-based risk scoring system for prediction of survival in pancreatic adenocarcinoma | |
| CN106676183A (en) | ZFHX4 as biomarker for prognosis of esophagus cancer | |
| CN116334223B (en) | Application of detection reagent of alternative splicing functional site rs61746794 in preparation of colorectal cancer auxiliary diagnosis kit | |
| CN115786501B (en) | Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof | |
| CN116590401A (en) | Mutation marker locus of ECHS1 gene of mitochondrial disease and application thereof | |
| CN114002431B (en) | Application of TNNT1 in preparation of virus type hepatocellular carcinoma diagnosis kit and preparation or screening of anti-liver cancer drugs | |
| CN108531588A (en) | A kind of kit of detection C3orf21 gene fragment expression amounts | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN107312778B (en) | A kind of cancer diagnosing kit and treatment pharmaceutical composition | |
| Tang et al. | Identification of chimeric RNAs in human infant brains and their implications in neural differentiation | |
| Zhang et al. | Associations between CAMKK1 polymorphism rs7214723 and the prognosis of patients with lung cancer | |
| CN114592006A (en) | New application of MEMO1 gene | |
| CN112375810A (en) | Application of GnT-II gene down-regulated expression as liver cancer prognosis marker | |
| CN103397103A (en) | Method and kit for detecting SOCS family gene labeled single nucleotide polymorphism sites | |
| Xiao et al. | MicroRNA-21 depletion by CRISPR/Cas9 in CNE2 nasopharyngeal cells hinders proliferation and induces apoptosis by targeting the PI3K/AKT/MOTOR signaling pathway | |
| CN110684844A (en) | Application of p.P476S mutation of RBPJL gene as PD-1 antibody medication guide marker | |
| CN112029833A (en) | Rapid identification method of CTNNB1 gene mutation for tumor organoid culture condition selection | |
| CN111534859A (en) | Method for establishing liver cancer cell molecular library based on CircRNA group | |
| CN111304305A (en) | Kit and method for detecting EGFR gene methylation | |
| CN115820845B (en) | Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof | |
| CN117384856B (en) | Immortalized COPD human bronchial epithelial cell strain, construction method and application thereof | |
| CN117106912B (en) | Enhancer RNA functional site related to colorectal cancer high-risk group identification and early screening and application thereof | |
| CN108676881A (en) | Purposes of the reagent of specific recognition CHAF1A in preparing gastric cancer prognosis evaluation reagent kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180914 |