CN108504676B - pnCasSA-BEC plasmid and application thereof - Google Patents

Abstract

The invention provides a pnCasSA-BEC plasmid and application thereof. The pnCasSA-BEC plasmid has the sequence of SEQ ID NO: 1. the plasmid (1) can efficiently and rapidly edit bases in various staphylococcus aureus strains, wherein the base mutations and gene inactivation are included; (2) base editing can be achieved by a DNA replication mechanism without loss of the transforming CFU, and extremely high transformation efficiency is obtained. The technology has wide application prospects in the aspects of staphylococcus aureus infection treatment, drug target discovery, drug development, staphylococcus aureus physiological research and the like.

Description

pnCasSA-BEC plasmid and application thereof

Technical Field

The invention relates to a pnCasSA-BEC plasmid and application thereof.

Background

Staphylococcus aureus is an important human pathogen and can cause a variety of infectious diseases, both mild skin infections and life threatening serious infections such as toxic shock syndrome, necrotizing pneumonia, endocarditis, etc. The staphylococcus aureus has the super-strong infectivity mainly due to the delicate virulence regulation system, various secreted cytotoxins and multifunctional cell surface proteins such as aggregation factors, fibronectin binding protein, collagen binding protein and the like. The surface proteins directly act with human cells, so that staphylococcus aureus can escape host immune reaction, promote the formation of a biological film and bacterial colonization, and create a series of favorable conditions for the growth of staphylococcus aureus. In recent years, outbreaks of methicillin-resistant staphylococcus aureus (MRSA) and vancomycin-resistant staphylococcus aureus (VRSA) have presented a significant challenge in treating staphylococcus aureus infections. Therefore, there is an urgent need to develop new therapeutic approaches against drug-resistant staphylococcus aureus.

The efficient genome editing technology has great significance for researching gene functions, discovering novel drug targets and developing novel treatment means. Traditional genome editing techniques in staphylococcus aureus are mainly achieved by a stepwise double crossover process. Such methods are cumbersome steps, time consuming and labor intensive. The CRISPR/Cas9 genome editing technology (pCasSA) in staphylococcus aureus recently developed realizes genome editing in one step, and the editing steps in staphylococcus aureus are greatly reduced. However, this technique still requires the use of homologous repair templates and greatly reduces the post-editing bacterial survival rate, thus limiting its application to many clinical strains with inefficient transformation.

Recent inventions of the "base editor" provide new avenues for gene editing in staphylococcus aureus. It can directly realize base conversion on genome by catalytic reaction. To date, two base editors (cytosine and adenine editors) have been invented, consisting of an inactivated Cas9 (Cas 9D10A, H840A) protein or Cas9 nickase (Cas 9D 10A) and a deaminase, respectively. Cytosine deaminase can direct a Cas9/sgRNA complex to any site in the genome, converting cytosine to uracil to achieve base editing in the single-stranded DNA produced upon Cas9 nickase/sgRNA binding. The CRISPR/Cas9 genome editing method relies on homologous recombination repair mechanisms (in bacteria) and requires a donor repair template. In contrast to the CRISPR/Cas9 genome editing method that produces double strand breaks, the base editor directly catalyzes the conversion of cytosine to uracil by deamination reaction while cleaving the unedited strand and using DNA replication machinery to achieve the conversion of cytosine to thymine. Such methods do not lose the transforming CFU since they do not involve genomic double strand breaks.

The following projects were obtained from the national science fund, project number: 91753127, respectively; item name: researching a bacterial cell wall recovery regulation mechanism and biological functions; national science fund, project number: 31700123, respectively; item name: screening staphylococcus aureus for cell wall surface proteins affecting biofilm formation by using CRISPR/Cas 9; science commission of Shanghai city, item number: 17ZR 1449200; item name: the grasping technology development of the high-efficiency natural product synthetic gene cluster based on the novel genome editing technology CRISPR/Cas 9; and the research and development plan of science and technology department, project number: 2017YFA 0506800; item name: the messenger RNA adenine m6A methyltransferase complex machinery.

Disclosure of Invention

The invention aims to provide a pnCasSA-BEC plasmid and application thereof.

In order to achieve the above object, the present invention provides a pnCasSA-BEC plasmid characterized in that the sequence thereof is SEQ ID NO: 1.

the invention also provides a pnCasSA-BEC plasmid which is characterized by comprising a promoter expressed by the APOBEC1 protein and the Cas9 nickase protein gene, an APOBEC1 protein gene fragment, a connecting region of the APOBEC1 protein gene and the Cas9 nickase protein gene and a Cas9 nickase protein gene fragment.

Preferably, the pnCasSA-BEC plasmid also contains a temperature-sensitive plasmid replicon in staphylococcus aureus, a chloramphenicol resistance gene fragment in staphylococcus aureus, a kanamycin resistance gene fragment in escherichia coli, a plasmid replicon in escherichia coli, an enzyme cutting site, a promoter expressed by sgRNA and the sgRNA.

The invention also provides application of the pnCasSA-BEC plasmid in efficient base editing of staphylococcus aureus strains.

The invention also provides application of the pnCasSA-BEC plasmid in efficient gene inactivation in staphylococcus aureus strains.

The invention also provides application of the pnCasSA-BEC plasmid in efficient gene mutation of staphylococcus aureus strains.

The invention also provides the Escherichia coli DH5 alpha strain containing the pnCasSA-BEC plasmid, which is classified and named as follows: escherichia coli; latin literature name:Escherichia coli(ii) a The preservation unit: china center for type culture Collection; the preservation number is: CCTCC M2018031.

Compared with the prior art, the invention has the beneficial effects that:

the invention relates to a pnCasSA-BEC plasmid formed in staphylococcus aureus based on a base editing technology of combining engineered Cas9 nickase and cytidine deaminase and related application. The plasmid (1) can efficiently and rapidly perform base editing in various staphylococcus aureus strains, wherein the base editing comprises base mutation and gene inactivation; (2) base editing can be achieved by a DNA replication mechanism without loss of the transforming CFU, and extremely high transformation efficiency is obtained. The technology has wide application prospects in the aspects of staphylococcus aureus infection treatment, drug target discovery, drug development, staphylococcus aureus physiological research and the like.

The invention develops a high-efficiency and convenient base editing system pnCasSA-BEC in staphylococcus aureus by fusing Cas9 nickase and cytosine deaminase through engineering. The pnCasSA-BEC system allows efficient genome to be achieved without the use of repair templates or the sacrifice of transforming CFU. This system enables gene inactivation by editing the corresponding site (CAA, CAG, CGA, TGG) into a stop codon (TAA, TAG, TGA, TAA). In addition to the rapid and efficient inactivation of genes, the pnCasSA-BEC system is capable of editing other sites in the genome, such as the promoter region and the region encoding small RNAs. The future use of the pnCasSA-BEC system can significantly accelerate the fundamental scientific and applied research of Staphylococcus aureus, especially in strains with low transformation efficiency. The development of the pnCasSA-BEC system will lay the foundation for the development of base editing systems for other microorganisms.

Coli DH5 a strain containing the pnCasSA-BEC plasmid, under the taxonomic nomenclature: escherichia coli; latin literature name:Escherichia coli(ii) a The preservation unit: china Center for Type Culture Collection (CCTCC); address: eight Lopa in Wuchang region of Wuhan city, Hubei province; the preservation date is as follows: 2018.01.15, accession number: CCTCC M2018031.

Drawings

FIG. 1: editing a map of the plasmid pnCasSA-BEC; BsaI site: inserting the spacer fragment for Golden Gate Assembly technology; cap 1A promoter: a promoter for sgRNA expression; rpsL promoter: the promoter of APOBEC1 protein and Cas9 nickase protein gene expression; XTEN linker: a junction region of the APOBEC1 protein gene and the Cas9 nickase protein gene; repF: a temperature-sensitive plasmid replicon in staphylococcus aureus for plasmid elimination; cm: a chloramphenicol resistance gene fragment in staphylococcus aureus; KanR: kanamycin resistance gene fragment in escherichia coli; ColE 1: plasmid replicons in E.coli.

FIG. 2 is a drawing: schematic diagram of efficient base editing achieved by pnCasSA-BEC in Staphylococcus aureus; FIG. 2A. schematic representation of the principle of base mutation in Staphylococcus aureus using the pnCasSA-BEC system, and the features of this system. FIG. 2B is a schematic representation of deamination of cytosine deaminase. Sequencing results of base mutations in Staphylococcus aureus (Newman strain) using the pnCasSA-BEC system, C.in FIG. 2.

FIG. 3: pnCasSA-BEC plasmid gene inactivation hemolysis assay. FIG. 3A. Using pnCasSA-BEC in methicillin-resistant Staphylococcus aureus (Newman)agrAHemolysis assay after gene inactivation. B. use of pnCasSA-BEC in methicillin-resistant Staphylococcus aureus (USA 300) in FIG. 3agrAHemolysis assay after gene inactivation.

Detailed Description

The embodiments of the present invention will now be described in detail and fully with reference to the accompanying examples, which are provided for illustration of the embodiments of the present invention and are not to be construed as limiting the scope of the invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used are not indicated to the manufacturer, and are considered to be conventional products available through commercial purchase.

The above description is only exemplary of the invention and should not be taken as limiting the invention, as any modification, equivalent replacement, or improvement made within the spirit and principle of the invention should be included in the protection scope of the invention.

The sources of biomaterial used in each example were as follows:

pCasSA plasmid (Addgene, USA, Cat: 98211);

plasmid pUC57-APOBEC1 (purchased from Biotechnology (Shanghai) Co., Ltd., obtained by conventional methods, the plasmid pUC57-APOBEC1 was constructed by inserting the APOBEC1 gene fragment synthesized by the whole gene into the plasmid pUC57 by double digestion (XbaI and XmaI) and ligation, and the sequence was SEQ ID NO: 41, and the sequence of the APOBEC1 gene was described in Doi:10.1038/nature17946 and the plasmid pUC57 was described in B522201.

Staphylococcus aureus RN4220 strain (purchased from Wuhan vast Ling Biotech Co., Ltd., cat # L2956);

staphylococcus aureus Newman strain (purchased from Wuhan vast Ling Biotech Co., Ltd., Cat. No. L3963);

staphylococcus aureus USA300 strain (purchased from ATCC company of America, Cathaka: ATCCBA-1717);

competent E.coli strain DH5 alpha (purchased from Wuhan vast Ling Biotech Co., Ltd., cat. No.: CC 0014).

Coli DH5 a strain containing the pnCasSA-BEC plasmid, under the taxonomic nomenclature: escherichia coli; latin literature name:Escherichia coli(ii) a The preservation unit: china Center for Type Culture Collection (CCTCC); address: eight Lopa in Wuchang region of Wuhan city, Hubei province; the preservation date is as follows: 2018.01.15, accession number: CCTCC M2018031.

The TSB liquid medium used in each example was purchased from national drug group chemical agents limited, product number: 69110963. the TSB solid culture medium is prepared by adding agar powder (product number: A505255-0250) into TSB liquid culture medium. 1.5g of agar powder was added per 100mL of TSB liquid medium. LB liquid medium was purchased from bio-engineering (shanghai) gmbh, cat #: a507002-0250, LB solid medium purchased from Biotechnology engineering (Shanghai) GmbH, cat #: a507003-0250.

The first embodiment is as follows: construction of the pnCasSA-BEC plasmid:

the composition of the pnCasSA-BEC plasmid is shown in the attached figure 1, and the sequence is SEQ ID NO: 1. the specific construction method of the pnCasSA-BEC plasmid is as follows:

(1) to construct pnCasSA-BEC plasmid, a pnCasSA plasmid containing Cas9 nickase (Cas 9D 10A) gene was first constructed. The pCasSA plasmid was amplified as two DNA fragments using a primer containing a mutation (D10A) using the pCasSA plasmid as a template, and assembled by Gibson assembly to generate the pnCasSA plasmid.

The primer sequences for PCR amplification were:

amplifying nCas9 protein gene and temperature sensitive repF replicon 5' primer sequence (SEQ ID NO: 2):

5’-CATGGATAAGAAATACTCAATAGGCTTAGCTATCGGCACAAATAGCGTCGG-3’

amplifying nCas9 protein gene and temperature sensitive repF replicon 3' primer sequence (SEQ ID NO: 3):

5’-CGATTATGTCTTTTGCGCAGTC-3’

amplification of the 5' primer sequence of the DNA fragment of the rpsL gene promoter, chloramphenicol resistance gene, ColE1 replicon, and kanamycin resistance gene (SEQ ID NO: 4):

5’-CGCACCAGCGAAAACTGGT-3’

amplification of the 3' primer sequence of the DNA fragment of the rpsL gene promoter, chloramphenicol resistance gene, ColE1 replicon, and kanamycin resistance gene (SEQ ID NO: 5):

5’-CCGACGCTATTTGTGCCGATAGCTAAGCCTATTGAGTATTTCTTATCCATG-3’

the two DNA fragments were amplified using PrimerSTAR HS DNA Polymerase from Takara, Inc. in the following reaction scheme: 10 μ L of 5 XPrimestar Buffer, 4 μ L of dNTP mix (2.5 mM each), 3 μ L of 5 'Primer (10 μ M), 3 μ L of 3' Primer (10 μ M), 0.5 μ L of template DNA (100 ng/. mu.L), 0.5 μ L of Primestar HS DNA Polymerase, plus ddH2O to 50 μ L. After the system is prepared, Polymerase Chain Reaction (PCR) is carried out, and the following cycles are carried out: 30s at 98 ℃; then 30 cycles of 10s at 98 ℃, 30s at 55 ℃ and 4min at 72 ℃; finally, 10min at 72 ℃.

PCR products were separately recovered using SanPrep column type PCR product purification kit manufactured by Biotechnology engineering (Shanghai) Ltd. The specific steps for purification of PCR products were performed according to the kit instructions manual. The two DNA fragments were assembled into a pnCasSA plasmid by Gibson assembly. The reaction system is as follows: gibson Assembly Master Mix (NEB) 5. mu.L, 2.5. mu.L (100 ng/. mu.L) per DNA fragment. Then reacted at 50 ℃ for 1 hour.

The above 10. mu.L reaction product was transformed into competent E.coli strain DH 5. alpha. and plated on LB solid medium containing 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃ in an inverted incubator. The transformed strain grown on the medium was inoculated into 5mL of a new LB medium containing 50. mu.g/mL kanamycin, and after overnight shaking, plasmids were extracted using a SanPrep column type plasmid DNA miniprep kit from Biotechnology engineering (Shanghai) Ltd. The specific steps of plasmid extraction were performed according to the kit manual.

(2) PCR amplification with the pnCasSA plasmid as template gave: a DNA fragment of nCas9 nickase protein gene; DNA fragments of temperature-sensitive repF replicon, ColE1 replicon, chloramphenicol resistance gene, and kanamycin resistance gene; DNA fragments of the sgRNA and rpsL promoters. A DNA fragment of the APOBEC1 protein gene is obtained by PCR amplification from pUC57-APOBEC1 plasmid.

The primer sequences for PCR amplification were:

DNA fragment 5' primer sequence for amplification of nCas9 nickase protein gene (SEQ ID NO: 6):

5’-GTCGACCGAGACCATTGGTCTCAGATAAGAAATACTCAATAGGCTTAGCTATCGGC-3’

amplification of nCas9 nickase protein gene DNA fragment 3' primer sequence (SEQ ID NO: 7):

5’-CGCAGCACGATATAAAGTCACTGTACTA-3’

amplification of DNA fragment 5' primer sequences of temperature sensitive repF replicon, ColE1 replicon, chloramphenicol resistance gene, and kanamycin resistance gene (SEQ ID NO: 8):

5’-GCTAGTACAGTGACTTTATATCGTGCTG-3’

amplification of the 3' primer sequence of the DNA fragment of the temperature-sensitive repF replicon, the ColE1 replicon, the chloramphenicol resistance gene and the kanamycin resistance gene (SEQ ID NO: 9):

5’-AGTATTTCTTATCTGAGACCAATGGTCTCGGTCGACAACGCAGGAAAGAACATGT-3’

the 5' primer sequence of the DNA fragment for amplifying the APOBEC1 protein gene (SEQ ID NO: 10):

5’- CACATGTTCTTTCCTGCGTTGTCGACCGAGACCATTGGTCTCAATGAGTAGCGAAACCGGTCC-3’

the 3' primer sequence of the DNA fragment for amplifying the APOBEC1 protein gene (SEQ ID NO: 11):

5’-GCTAAGCCTATTGAGTATTTCTTATCACTTTCCGGGGTTGCGCTTTC-3’

DNA fragment 5' primer sequences for amplification of the sgRNA and rpsL promoters (SEQ ID NO: 12):

5’-TGCTCACATGTTCTTTCCTGCGTTGTCGACAGAGTTTGCAAAATATACAGGGGATTATATATAA -3’

amplification of the 3' primer sequences of the DNA fragments of the sgRNA and rpsL promoters (SEQ ID NO: 13):

5’-CACTGCAACCGGACCGGTTTCGCTACTCATGTGATATGTCCTCCTCTCTTCACTT -3’

the four DNA fragments were amplified using PrimerSTAR HS DNA Polymerase from Takara, in the following reaction scheme: 10 μ L of 5 XPrimestar Buffer, 4 μ L of dNTP mix (2.5 mM each), 3 μ L of 5 'Primer (10 μ M), 3 μ L of 3' Primer (10 μ M), 0.5 μ L of template DNA (100 ng/. mu.L), 0.5 μ L of Primestar HS DNA Polymerase, plus ddH2O to 50 μ L. After the system is prepared, Polymerase Chain Reaction (PCR) is carried out, and the following cycles are carried out: 30s at 98 ℃; then 30 cycles of 10s at 98 ℃, 30s at 55 ℃ and 4min at 72 ℃; finally, 10min at 72 ℃.

PCR products were separately recovered using SanPrep column type PCR product purification kit manufactured by Biotechnology engineering (Shanghai) Ltd. The specific steps for purification of PCR products were performed according to the kit instructions manual.

First, the DNA fragment of nCas9 nicase protein gene and the DNA fragments of temperature sensitive repF replicon, ColE1 replicon, chloramphenicol resistance gene and kanamycin resistance gene were assembled into pnCas plasmid using Gibson assembly. The pnCas plasmid was linearized using BsaI enzyme and ligated with the DNA fragment of the APOBEC1 protein gene using Gibson assembly to form the pnCasBEC plasmid. The pnCasBEC plasmid was linearized again with BsaI enzyme and then the DNA fragments of the sgRNA and rpsL promoters were ligated with Gibson assembly to form the pnCasSA-BEC plasmid. The reaction system is as follows: gibson Assembly Master Mix (NEB) 5. mu.L, 2.5. mu.L (100 ng/. mu.L) per DNA fragment. Then reacted at 50 ℃ for 1 hour.

The above 10. mu.L of the reaction product was transformed into a competent E.coli strain DH 5. alpha. and plated on LB solid medium containing 50. mu.g/ml kanamycin, and cultured overnight at 37 ℃ in an inverted incubator. The transformed strain grown on the medium was inoculated into 5mL of a new LB medium containing 50. mu.g/mL kanamycin, and after overnight shaking, plasmids were extracted using a SanPrep column type plasmid DNA miniprep kit from Biotechnology engineering (Shanghai) Ltd. The specific steps of plasmid extraction were carried out according to the kit manual, and the map of the resulting pnCasSA-BEC plasmid is shown in FIG. 1. Coli DH5 a strain containing the correct pnCasSA-BEC plasmid has been deposited by the inventors in the China Center for Type Culture Collection (CCTCC) with the following accession numbers: CCTCC M2018031.

The pnCasSA-BEC plasmid is characterized by being a shuttle plasmid and being capable of being replicated and passaged in Escherichia coli and staphylococcus aureus; the plasmid is kanamycin-resistant in escherichia coli and chloramphenicol-resistant in staphylococcus aureus and can be used for strain screening; the plasmid can stably express Cas9 nickase protein in staphylococcus aureus, and carry out genome base editing, thereby realizing the functions of gene inactivation and single base mutation; the repF replicon with temperature sensitivity in staphylococcus aureus can not replicate at 42 ℃, and can complete plasmid elimination in a strain; contains two BsaI sites and can be used to insert the spacer fragment.

Example two: the pnCasSA-BEC plasmid carries out base mutations in various Staphylococcus aureus strains:

the use of the pnCasSA-BEC plasmid allows the efficient base mutation of different genes in various Staphylococcus aureus (C → T). Selected in the experimentagrAAnd the cntA gene, base mutation experiments were performed in staphylococcus aureus RN4220, Newman and USA300 strains. FIG. 2A is a diagram showing the base mutation in Staphylococcus aureus using the pnCasSA-BEC system. FIG. 2B is a schematic representation of the deamination reaction of cytosine deaminase.

(1) A DNA fragment 20 bases ahead of an NGG (N is an arbitrary base) sequence (20 bases are called spacer, and NGG is not included) is selected on a target gene. The basic requirements of this step are: in order to insert the spacer fragment into the pnCasSA-BEC plasmid, primers were designed using the following templates:

5’- GAAANNNNNNNNNNNNNNNNNNNN-3’

3’-NNNNNNNNNNNNNNNNNNNNCAAA -5’

for example, the spacer sequence of the selected gene, cntA (SEQ ID NO: 14) in this experiment was: 5'-caagcaattaacgtatacga-3', the specific sequence is designed as follows:

5’- GAAAcaagcaattaacgtatacga -3’（SEQ ID NO：15）

3’-gttcgttaattgcatatgctCAAA -5’（SEQ ID NO：16）

the two primers were synthesized by Biotechnology engineering (Shanghai) Ltd, and a spacer was inserted into the plasmid pnCasSA-BEC obtained in example one according to the procedure of example five to obtain a plasmid pnCasSA-BEC-cntAsp. The obtained pnCasSA-BEC-cntAsp plasmid is used for subsequent experiments, and simultaneously the plasmid is sent to the company of Biotechnology engineering (Shanghai) GmbH for sequencing confirmation, and the sequence of a sequencing primer (SEQ ID NO: 13) is as follows:

5’-CACTGCAACCGGACCGGTTTCGCTACTCATGTGATATGTCCTCCTCTCTTCACTT -3’。

(2) the constructed pnCasSA-BEC-cntAsp plasmid was transferred into Staphylococcus aureus RN4220 strain according to the procedure of example seven. Single colonies were picked, inoculated into 3mL of TSB (tryptone soya broth) liquid medium, and shaken overnight in a shaker at 30 ℃. An Ezup column type bacterial genome DNA extraction kit produced by Biotechnology engineering (Shanghai) Ltd is used to extract genomic DNA from the strain. A fragment of the cntA gene (about 1 kb) was PCR-amplified using the genomic DNA as a template. The reaction system is as follows: mu.L of 5 XPrimeSTAR Buffer, 4. mu.L of dNTP mix (2.5 mM each), 3. mu.L of 5 'Primer (10. mu.M), 3. mu.L of 3' Primer (10. mu.M), 0.5. mu.L of genomic DNA (100 ng/. mu.l), 0.5. mu.L of PrimeSTAR HS DNA Polymerase, plus ddH2O to 50. mu.L. The PCR product successfully amplified in the above experiment was sent to Biotechnology engineering (Shanghai) Inc. for sequencing verification.

The PCR verification primer sequence of the cntA base mutation is as follows:

5' primer: 5'-TCAATTTAGAAAGAGGAAAAGCAA-3' (SEQ ID NO: 17)

3' primer: 5'-TGGAAACATGAGCGCAATAC-3' (SEQ ID NO: 18)

As a result of the experiment, it was found that all of the base C7 was successfully mutated in the selected 12 colonies.

(3) The plasmid pnCasSA-BEC-cntAsp was extracted from the RN4220 strain which was successful in base mutation using a SanPrep column type plasmid DNA miniprep kit from Biotechnology engineering (Shanghai) Ltd. For plasmid extraction, lysostaphin (final concentration of 100 ng/mL) from Biotechnology (Shanghai) GmbH was added to Buffer P1 in the kit to aid in lysis of the RN4220 bacteria. The other steps of plasmid extraction were performed according to the kit manual.

(4) The pnCasSA-BEC-cntAsp plasmid extracted from the RN4220 strain was transferred into the Staphylococcus aureus Newman and USA300 strains according to the procedure of example seven. The procedure for PCR verification and the use of primers were the same as for the RN4220 strain in step (2). As a result of the experiment, it was found that the base C7 was successfully mutated in all of the 12 selected monoclonal colonies. FIG. 2C shows the sequencing of base mutations in a Newman strain of Staphylococcus aureus using the pnCasSA-BEC system. In addition, the Cn mutation efficiency of different sites on the spacer is different, so that the Cn of different sites is designed to screen possible mutation position regions of the spacer. The specific experimental operation was carried out according to the procedure in (2).

The primer sequences of the spacers for screening the mutation of the base Cn at different positions are as follows:

5' primer sequence for screening C2 base mutation (SEQ ID NO: 19):

5’-GAAATCTGATATTAATATTAAAAC-3’

the 3' primer sequence (SEQ ID NO: 20) for screening for a C2 base mutation:

5’-AAACGTTTTAATATTAATATCAGA-3’

5' primer sequence for screening C3 base mutation (SEQ ID NO: 21):

5’-GAAAAGCAATACTACAGTAAAAAC-3’

the 3' primer sequence (SEQ ID NO: 22) for screening for a C3 base mutation:

5’-AAACGTTTTTACTGTAGTATTGCT-3’

5' primer sequence for screening C4 base mutation (SEQ ID NO: 23):

5’-GAAATGTCTACAAAGTTGCAGCGA-3’

the 3' primer sequence for screening for a C4 base mutation (SEQ ID NO: 24):

5’-AAACTCGCTGCAACTTTGTAGACA-3’

5' primer sequence for screening C5 base mutation (SEQ ID NO: 25):

5’-GAAAAGAACGAAAGGTACCATTGC-3’

the 3' primer sequence for screening for a C5 base mutation (SEQ ID NO: 26):

5’-AAACGCAATGGTACCTTTCGTTCT-3’

5' primer sequence for screening C6 base mutation (SEQ ID NO: 27):

5’-GAAAGGATTCAACGGTAATGTTAC -3’

the 3' primer sequence (SEQ ID NO: 28) for screening for a C6 base mutation:

5’-AAACGTAACATTACCGTTGAATCC-3’

5' primer sequence for screening C7 base mutation (SEQ ID NO: 29:

5’-GAAAATATATCGAACCGATCATAA-3’

the 3' primer sequence for screening for a C7 base mutation (SEQ ID NO: 30):

5’-AAACTTATGATCGGTTCGATATAT-3’

5' primer sequence for screening C8 base mutation (SEQ ID NO: 31):

5’-GAAAAATGTTACTGGTGATGATAC-3’

the 3' primer sequence for screening for a C8 base mutation (SEQ ID NO: 32):

5’-AAACGTATCATCACCAGTAACATT-3’

5' primer sequence for screening C9 base mutation (SEQ ID NO: 33):

5’-GAAAAGGTATAACGAATGTTAAAT-3’

the 3' primer sequence for screening for a C9 base mutation (SEQ ID NO: 34):

5’-AAACATTTAACATTCGTTATACCT -3’

5' primer sequence for screening C10 base mutation (SEQ ID NO: 35):

5’-GAAAGAAAATATACTAATTAAAAA-3’

the 3' primer sequence for screening for a C10 base mutation (SEQ ID NO: 36):

5’-AAACTTTTTAATTAGTATATTTTC-3’

5' primer sequence for screening C11 base mutation (SEQ ID NO: 37):

5’-GAAAGAAGAAGGTGCTAACAAAAG-3’

the 3' primer sequence (SEQ ID NO: 38) for screening for a C11 base mutation:

5’-AAACCTTTTGTTAGCACCTTCTTC-3’

5' primer sequence for screening C12 base mutation (SEQ ID NO: 39):

5’-GAAAGGAAAAATTGGCGGCCTTAT -3’

the 3' primer sequence for screening for a C12 base mutation (SEQ ID NO: 40):

5’-AAACATAAGGCCGCCAATTTTTCC-3’

the experimental result shows that the mutation efficiency of C4-C8 is the highest from the 5' of the spacer, wherein the mutation efficiency of C5-C7 is 100%, and the mutation efficiency of C4 and C8 is different along with the difference of bases in the spacer.

(5) For each strain of Staphylococcus aureus for which successful gene knock-out was confirmed, the plasmid in the strain was eliminated by the procedure of example four.

Example three: the pnCasSA-BEC plasmid achieved gene inactivation in various Staphylococcus aureus:

the use of the pnCasSA-BEC plasmid allows the genetic inactivation of different genes in various strains of Staphylococcus aureus. Selected in the experimentagrAAs an example, gene inactivation experiments were performed in the strains Staphylococcus aureus RN4220, Newman and USA 300. FIG. 3 shows a hemolysis experiment of gene inactivation in Staphylococcus aureus (MRSA strain) using the pnCasSA-BEC system.

(1) The spacer of the target gene is selected, and a primer is designed to construct a plasmid. Selected in the experimentagrAGlutamine Q (caa) at position 179 in the gene was mutated to a stop codon (taa). Thus, a gene can be obtainedagrAAn inactivated strain. The basic requirements for designing the spacer primers selected in this experiment are as follows: first, the requirement of (1) in the second embodiment is to be satisfied; next, after the mutation of the selected target Cn, a codon corresponding to the Cn base of the gene must be mutated to a stop codon. Selection of experimentsagrAFor example, the spacer primers are:

5’- GAAAAACCGTCAAATTGAATTTTA -3’（SEQ ID NO：42）

3’-TTGGCAGTTTAACTTAAAATCAAA -5’（SEQ ID NO：43）

the spacer was inserted into the pnCasSA-BEC plasmid according to the procedure of example five to obtain pnCasSA-BEC-agrAsp plasmid. The obtained pnCasSA-BEC-agrAThe sp plasmid was sent to Biotechnology engineering (Shanghai) Co., Ltd for sequencing confirmation, and the sequence of the sequencing primer (SEQ ID NO: 13) was:

5’-CACTGCAACCGGACCGGTTTCGCTACTCATGTGATATGTCCTCCTCTCTTCACTT -3’。。

(2) the constructed pnCasSA-BEC-agrAThe sp plasmid was transferred into the strain Staphylococcus aureus RN4220 according to the procedure of example seven. Selecting monoclonal bacteriaThe cells were then inoculated into 3ml of TSB (tryptone soya broth) liquid medium and shaken overnight in a shaker at 30 ℃. Extraction of pnCasSA-BEC-agrAsp plasmid. For plasmid extraction, lysostaphin (final concentration of 100 ng/mL) from Biotechnology (Shanghai) GmbH was added to Buffer P1 in the kit to aid in lysis of the RN4220 bacteria. The other steps of plasmid extraction were performed according to the kit manual.

(3) The pnCasSA-BEC-one extracted from the RN4220 strainagrAThe sp plasmid was transferred into the Newman and USA300 strain of Staphylococcus aureus by the procedure of example seven. Single colonies (12) were picked, inoculated into 3mL of TSB (tryptone soya broth) liquid medium, and shaken overnight in a shaker at 30 ℃. An Ezup column type bacterial genome DNA extraction kit produced by Biotechnology engineering (Shanghai) Ltd is used to extract genomic DNA from the strain. PCR amplification using the genomic DNA as a templateagrAGene (about 1 kbp) fragment. The reaction system is as follows: 10 μ L of 5 XPrimeSTAR Buffer, 4 μ L of dNTP mix (2.5 mM each), 3 μ L of 5 'Primer (10 μ M), 3 μ L of 3' Primer (10 μ M), 0.5 μ L of genomic DNA (100 ng/. mu.L), 0.5 μ L of PrimeSTAR HS DNA Polymerase, plus ddH2O to 50 μ L. The PCR product successfully amplified in the above experiment was sent to Biotechnology engineering (Shanghai) Inc. for sequencing verification.

agrAThe PCR verification primer sequence of the base mutation is as follows:

5' primer: 5'-GGTGAAGGTCGTGGTTTAGG-3' (SEQ ID NO: 44)

3' primer: 5'-GCCAGCTATACAGTGCATTTG-3' (SEQ ID NO: 45)

As a result of the experiment, all of the target base C7 of 12 colonies of all of the above-mentioned Staphylococcus aureus strains were successfully mutated.

(4) Of the Newman and USA300 strains of Staphylococcus aureusagrAThe gene is associated with the hemolytic ability of the bacterium. When in useagrAWhen the gene is out of function, the strain will be lostThe ability to remove hemolysis. According to the operation procedure of example eight, the 12 monoclonal colonies selected in step (3) were subjected to a hemolysis test, the results of which are completely consistent with the sequencing results, and all of the 12 colonies successfully mutated lose the hemolysis ability, and the test was performed by comparing the hemolysis ability of the wild type strain of the corresponding strain.

Example four: elimination of pnCasSA-BEC plasmid in Staphylococcus aureus:

a single clone was picked from Staphylococcus aureus containing the pnCasSA-BEC plasmid, inoculated into 3mL of TSB broth, and shaken overnight at 30 ℃. The next day, 3. mu.L of the inoculum was diluted 1:1000 into fresh TSB broth and shaken at 42 ℃ until the inoculum was cloudy. An appropriate amount of the inoculum was removed by inoculating loop, streaked on TSB solid medium, and cultured in an incubator at 37 ℃ overnight by inversion. Since the pnCasSA-BEC plasmid contains a temperature-sensitive repF replicon, the plasmid cannot replicate at 42 ℃ and is eliminated. Single colonies were picked from TSB solid medium, inoculated into 10. mu.L of TSB liquid medium, and streaked onto TSB solid medium containing 5. mu.g/mL chloramphenicol, respectively. Colonies which could grow on the TSB solid medium after overnight incubation in a 37 ℃ incubator, but could not grow on the TSB solid medium containing 5. mu.g/mL chloramphenicol, i.e., colonies in which the pnCasSA-BEC plasmid had been eliminated, were cultured and maintained.

Example five: the spacer fragment was inserted into the pnCasSA-BEC plasmid:

firstly, phosphorylating two designed and synthesized spacer primers, wherein a specific reaction system is as follows: mu.L of 10 XT 4 DNA ligase Buffer (NEB Co.), 1. mu.L of spacer 5 'primer (100. mu.M), 1. mu.L of spacer 3' primer (100. mu.M), 1. mu. L T4 polynucleotide kinase (Takara Co.), 42. mu.L of ddH 2O. The reaction was carried out at 37 ℃ for 1 hour.

After the completion of the above reaction, 0.5. mu.L of 5M NaCl was added to the reaction product, heated at 95 ℃ for 5min, and then slowly lowered to room temperature using a PCR apparatus to allow the phosphorylated two single-stranded primers to form a double-stranded DNA by base pairing. The resulting product was then diluted 10-fold with ddH 2O.

Inserting the double-stranded DNA fragment obtained in the above into BsaI site of the pnCasSA-BEC plasmid, and adopting a reaction system as follows: mu.L of 10 XT 4 DNA ligase Buffer, 1. mu.L of the double-stranded DNA fragment obtained above, 20 fmol of pnCasSA-BEC plasmid, 0.5. mu. L T4 DNA ligase, 0.5. mu.L of BsaI-HF, and finally ddH2O to a total volume of 10. mu.L. Both Buffer and enzyme used in this reaction were produced by NEB. The reaction was run in a PCR instrument with the following cycles: 2min at 37 ℃; 5min at 16 ℃ for 25 cycles; then 5min at 50 ℃ and 15min at 80 ℃.

The 10 u L reaction product transformed into competent Escherichia coli DH5 alpha strain, and plated on the containing 50 u g/mL kanamycin LB solid medium. After the transformation liquid is absorbed by the solid culture medium, the solid culture medium is placed in an incubator at 30 ℃ for overnight culture. The transformed strains grown on the culture medium are transferred and stored, and simultaneously the extracted plasmids are subjected to sequencing verification in the biological engineering (Shanghai) corporation.

Example six: preparation of Staphylococcus aureus electrotransferase competent cells

The strain of S.aureus was streaked on TSB solid medium and cultured in an inverted incubator at 30 ℃ overnight. A single colony grown on the medium was picked, inoculated into 3ml of a liquid medium of LTSB, and shaken overnight at 250rpm in a shaker at 30 ℃. The next day, 1mL of the suspension was inoculated into 100mL of fresh TSB medium and shaken on a shaker at 30 ℃. And when the OD600 of the bacterial liquid reaches 0.3-0.4, putting the bacterial liquid on ice for cooling for ten minutes. The pellet was harvested by centrifugation at 5000rpm for 5 minutes in a 4 ℃ centrifuge, the medium supernatant was discarded and the bottom pellet was resuspended in 20mL of 0.5M sucrose solution (sterilized). The pellet was resuspended in 10mL of 0.5M sucrose solution. After centrifugation again at the same speed, the supernatant was discarded and the bottom bacterial pellet was resuspended in 1mL of 0.5M sucrose solution. The resulting bacterial solution was dispensed into EP tubes, 50. mu.L of each tube. And (3) rapidly cooling the subpackaged bacterial liquid in liquid nitrogen, and then storing in a refrigerator at the temperature of-80 ℃.

Example seven: transferring the plasmid into staphylococcus aureus competent bacteria by electrotransformation

A tube of Staphylococcus aureus competent bacteria prepared in example six was taken, and after being left on ice for 5 minutes, 1. mu.g of plasmid was added. After mixing, the mixture was transferred to a 1mm electric rotor (Bio-Rad) and electrically shocked at room temperature in a GenePulser Xcell electric shock apparatus (Bio-Rad). The electric shock parameters are as follows: 21 kV/cm, 100. omega. and 25. mu.F. Immediately after electric shock, 1mL of TSB culture medium was added, mixed well and transferred to a clean EP tube, shaken in a shaker at 30 ℃ for 1.5 hours. mu.L of the broth was taken from the EP tube and spread evenly on TSB solid medium containing chloramphenicol (chloramphenicol concentration 5. mu.g/ml for the RN4220 strain; 10. mu.g/ml for Newman and USA300 strains). After the bacterial liquid is absorbed by the solid culture medium, the culture box is inverted and cultured overnight at the temperature of 30 ℃, and only bacteria successfully transferred into the plasmid can grow on the culture medium.

Example eight: hemolytic assay of Staphylococcus aureus strains on blood plates

Different staphylococcus aureus strains are cultured in a TSB liquid medium overnight, and 1 mu L of bacterial liquid (OD 600 is between 1.0 and 1.5) is spotted on a blood plate. After the bacterial liquid was absorbed by the blood plates, the cells were cultured in an inverted incubator at 30 ℃ overnight. The next day, the cells were placed in a refrigerator at 4 ℃ overnight, and the hemolyzed state of each strain on the blood plate was observed and recorded by photographing.

SEQUENCE LISTING

<110> Shanghai science and technology university

<120> pnCasSA-BEC plasmid and application thereof

<130> 2018.1.3

<160> 45

<170> PatentIn version 3.5

<210> 1

<211> 10972

<212> DNA

<213> artificial sequence (artificially synthesized sequence)

<400> 1

cttagagcgt aagcgaaagt agtagcgaca gctattaact ttcggttgca aagctctagg 60

atttttaatg gacgcagcgc atcacacgca aaaaggaaat tggaataaat gcgaaatttg 120

agatgttaat taaagacctt tttgaggtct ttttttctta gatttttggg gttatttagg 180

ggagaaaaca taggggggta ctacgacctc ccccctaggt gtccattgtc cattgtccaa 240

acaaataaat aaatattggg tttttaatgt taaaaggttg ttttttatgt taaagtgaaa 300

aaaacagatg ttgggaggta cagtgatggt tgtagataga aaagaagaga aaaaagttgc 360

tgttacttta agacttacaa cagaagaaaa tgagatatta aatagaatca aagaaaaata 420

taatattagc aaatcagatg caaccggtat tctaataaaa aaatatgcaa aggaggaata 480

cggtgcattt taaacaaaaa aagatagaca gcactggcat gctgcctatc tatgactaaa 540

ttttgttaaa tgtattagca ccgttattat atcatgagcg aaaatgtaat aaaagaaact 600

gaaaacaaga aaaattcaag aggacgtaat tggacatttg ttttatatcc agaatcagca 660

aaagccgagt ggttagagta tttaaaagag ttacacattc aatttgtagt gtctccatta 720

catgataggg atactgatac agaagatagg atgaaaaaag agcattatca tattctagtg 780

atgtatgagg gtaataaatc ttatgaacag ataaaaataa ttacagaaga attgaatgcg 840

actattccgc agattgcagg aagtgtgaaa ggtcttgtga gatatatgct tcacatggac 900

gatcctaata aatttaaata tcaaaaagaa gatatgatag tttatggcgg tgtagatgtt 960

gatgaattat taaagaaaac aacaacagat agatataaat taattaaaga aatgattgag 1020

tttattgatg aacaaggaat cgtagaattt aagagtttaa tggattatgc aatgaagttt 1080

aaatttgatg attggttccc gcttttatgt gataactcgg cgtatgttat tcaagaatat 1140

ataaaatcaa atcggtataa atctgaccga tagattttga atttaagagt gtcacaagac 1200

actctttttt cgcaccagcg aaaactggtt taagccgact gcgcaaaaga cataatcgat 1260

tcacaaaaaa taggcacacg aaaaacaagt taagggatgc agtttatgca tcccttaact 1320

tacttattaa ataatttata gctattgaaa agagataaga attgttcaaa gctaatattg 1380

tttaaatcgt caattcctgc atgttttaag gaattgttaa attgattttt tgtaaatatt 1440

ttcttgtatt ctttgttatc ttggttaccc gtcttcttaa tatgcgtaat tgcatctact 1500

ctaaatccat caatgccttt atcaaaccac cagttcatca tttcaaatac agcatctcta 1560

acttccggat taccccaatt caaatcaggt tgttttttac tgaataaatg gaaataatat 1620

tgctcagtat tagcatcata ttcccgcgcg ccaattgagc tcccctttct atgtatgttt 1680

tttactagtc atttaaaacg atacattaat aggtacgaaa aagcaacttt ttttgcgctt 1740

aaaaccagtc ataccaataa cttaagggta actagcctcg ccggcaatag ttacccttat 1800

tatcaagata agaaagaaaa ggatttttcg ctacgctcaa atcctttaaa aaaacacaaa 1860

agaccacatt ttttaatgtg gtcttttatt cttcaactaa agcacccatt agttcaacaa 1920

acgaaaattg gataaagtgg gatattttta aaatatatat ttatgttaca gtaatattga 1980

cttttaaaaa aggattgatt ctaatgaaga aagcagacaa gtaagcctcc taaattcact 2040

ttagataaaa atttaggagg catatcaaat gaaatttaat aaaattgatt tagacaattg 2100

gaagagaaaa gagatattta atcattattt gaaccaacaa acgactttta gtataaccac 2160

agaaattgat attagtgttt tataccgaaa cataaaacaa gaaggatata aattttaccc 2220

tgcatttatt ttcttagtga caagggtgat aaactcaaat acagctttta gaactggtta 2280

caatagcgac ggagagttag gttattggga taagttagag ccactttata caatttttga 2340

tggtgtatct aaaacattct ctggtatttg gactcctgta aagaatgact tcaaagagtt 2400

ttatgattta tacctttctg atgtagagaa atataatggt tcggggaaat tgtttcccaa 2460

aacacctata cctgaaaatg ctttttctct ttctattatt ccatggactt catttactgg 2520

gtttaactta aatatcaata ataatagtaa ttaccttcta cccattatta cagcaggaaa 2580

attcattaat aaaggtaatt caatatattt accgctatct ttacaggtac atcattctgt 2640

ttgtgatggt tatcatgcag gattgtttat gaactctatt caggaattgt cagataggcc 2700

taatgactgg cttttataat atgagataat gccgactgta ctttttacag tcggttttct 2760

aatgtcacta acctgccccg ttagttgaag aaggttttta tattacagct ccagatccat 2820

atccttcttt ttctgaaccg acttctcctt tttcgcttct ttattccaat tgctttattg 2880

acgttgagcc tcggaaccgg tacccaggaa acagctatga ccatgtaata cgactcacta 2940

tacggggata tcgtcggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg 3000

caaagtaaac tggatggctt tcttgccgcc aaggatctga tggcgcaggg gatcaagatc 3060

tgatcaagag acaggatgag gatcgtttcg catgattgaa caagatggat tgcacgcagg 3120

ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac agacaatcgg 3180

ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc tttttgtcaa 3240

gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc tatcgtggct 3300

ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga 3360

ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc 3420

cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac 3480

ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc 3540

cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc cagccgaact 3600

gttcgccagg ctcaaggcgc gcatgcccga cggcgaggat ctcgtcgtga cccatggcga 3660

tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtgg 3720

ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga 3780

agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga 3840

ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgagcgg gactctgggg 3900

ttcgagagct cgcttggact cctgttgata gatccagtaa tgacctcaga actccatctg 3960

gatttgttca gaacgctcgg ttgccgccgg gcgtttttta ttggtgagaa tccaagcact 4020

agtcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga 4080

aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac 4140

aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt 4200

tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc 4260

gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat 4320

cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag 4380

acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc 4440

cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc attgagaaag 4500

cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac 4560

aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg 4620

gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct 4680

atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc 4740

tcacatgttc tttcctgcgt tgtcgacaga gtttgcaaaa tatacagggg attatatata 4800

atggaaacga gaccattggt ctcagtttta gagctagaaa tagcaagtta aaataaggct 4860

agtccgttat caacttgaaa aagtggcacc gagtcggtgc tttttttgag atctgtccat 4920

acccatggtc tagaatgctc gagtcagaaa aatatacctg tatctttttt caaaagcaaa 4980

catgctttgg gtaaacatgt aggtattaac gtcaatgcga caatagtagc attgattaaa 5040

tgagaattag taagtgtttt acttactaaa ttttatttaa cctaaaaatg aaccacctgg 5100

atgtgtggga ttaaaaagtg aagagaggag gacatatcac atgagtagcg aaaccggtcc 5160

ggttgcagtg gatccgaccc tgcgccgtcg cattgaaccg cacgagtttg aagtgttctt 5220

tgatccgcgc gagctgcgca aagaaacttg cctgctgtac gagattaact ggggtggccg 5280

ccatagcatc tggcgccata ccagccagaa caccaataag cacgtggaag tgaattttat 5340

tgaaaaattt accaccgagc gctacttctg ccctaatacc cgctgcagca tcacctggtt 5400

tctgagctgg agcccgtgcg gcgaatgtag tcgcgccatt accgagttcc tgagccgcta 5460

tccgcatgtg accctgttca tctacatcgc ccgtctgtac catcacgccg atccgcgcaa 5520

tcgccaaggt ctgcgtgatc tgattagcag cggtgtgacc atccagatca tgaccgaaca 5580

agagagcggc tattgctggc gcaacttcgt gaactattct ccgagcaacg aagcccactg 5640

gccgcgttat ccgcatctgt gggtgcgcct gtatgtgctg gagctgtact gcatcatcct 5700

gggcctgccg ccttgcctga atattctgcg ccgtaaacag ccgcaactga cattcttcac 5760

catcgcactg cagagctgcc attatcagcg cctgccgccg cacattttat gggccaccgg 5820

tctgaaaagc ggtagtgaaa ctccgggcac aagcgaaagc gcaaccccgg aaagtgataa 5880

gaaatactca ataggcttag ctatcggcac aaatagcgtc ggatgggcgg tgatcactga 5940

tgaatataag gttccgtcta aaaagttcaa ggttctggga aatacagacc gccacagtat 6000

caaaaaaaat cttatagggg ctcttttatt tgacagtgga gagacagcgg aagcgactcg 6060

tctcaaacgg acagctcgta gaaggtatac acgtcggaag aatcgtattt gttatctaca 6120

ggagattttt tcaaatgaga tggcgaaagt agatgatagt ttctttcatc gacttgaaga 6180

gtcttttttg gtggaagaag acaagaagca tgaacgtcat cctatttttg gaaatatagt 6240

agatgaagtt gcttatcatg agaaatatcc aactatctat catctgcgaa aaaaattggt 6300

agattctact gataaagcgg atttgcgctt aatctatttg gccttagcgc atatgattaa 6360

gtttcgtggt cattttttga ttgagggaga tttaaatcct gataatagtg atgtggacaa 6420

actatttatc cagttggtac aaacctacaa tcaattattt gaagaaaacc ctattaacgc 6480

aagtggagta gatgctaaag cgattctttc tgcacgattg agtaaatcaa gacgattaga 6540

aaatctcatt gctcagctcc ccggtgagaa gaaaaatggc ttatttggga atctcattgc 6600

tttgtcattg ggtttgaccc ctaattttaa atcaaatttt gatttggcag aagatgctaa 6660

attacagctt tcaaaagata cttacgatga tgatttagat aatttattgg cgcaaattgg 6720

agatcaatat gctgatttgt ttttggcagc taagaattta tcagatgcta ttttactttc 6780

agatatccta agagtaaata ctgaaataac taaggctccc ctatcagctt caatgattaa 6840

acgctacgat gaacatcatc aagacttgac tcttttaaaa gctttagttc gacaacaact 6900

tccagaaaag tataaagaaa tcttttttga tcaatcaaaa aacggatatg caggttatat 6960

tgatggggga gctagccaag aagaatttta taaatttatc aaaccaattt tagaaaaaat 7020

ggatggtact gaggaattat tggtgaaact aaatcgtgaa gatttgctgc gcaagcaacg 7080

gacctttgac aacggctcta ttccccatca aattcacttg ggtgagctgc atgctatttt 7140

gagaagacaa gaagactttt atccattttt aaaagacaat cgtgagaaga ttgaaaaaat 7200

cttgactttt cgaattcctt attatgttgg tccattggcg cgtggcaata gtcgttttgc 7260

atggatgact cggaagtctg aagaaacaat taccccatgg aattttgaag aagttgtcga 7320

taaaggtgct tcagctcaat catttattga acgcatgaca aactttgata aaaatcttcc 7380

aaatgaaaaa gtactaccaa aacatagttt gctttatgag tattttacgg tttataacga 7440

attgacaaag gtcaaatatg ttactgaagg aatgcgaaaa ccagcatttc tttcaggtga 7500

acagaagaaa gccattgttg atttactctt caaaacaaat cgaaaagtaa ccgttaagca 7560

attaaaagaa gattatttca aaaaaataga atgttttgat agtgttgaaa tttcaggagt 7620

tgaagataga tttaatgctt cattaggtac ctaccatgat ttgctaaaaa ttattaaaga 7680

taaagatttt ttggataatg aagaaaatga agatatctta gaggatattg ttttaacatt 7740

gaccttattt gaagataggg agatgattga ggaaagactt aaaacatatg ctcacctctt 7800

tgatgataag gtgatgaaac agcttaaacg tcgccgttat actggttggg gacgtttgtc 7860

tcgaaaattg attaatggta ttagggataa gcaatctggc aaaacaatat tagatttttt 7920

gaaatcagat ggttttgcca atcgcaattt tatgcagctg atccatgatg atagtttgac 7980

atttaaagaa gacattcaaa aagcacaagt gtctggacaa ggcgatagtt tacatgaaca 8040

tattgcaaat ttagctggta gccctgctat taaaaaaggt attttacaga ctgtaaaagt 8100

tgttgatgaa ttggtcaaag taatggggcg gcataagcca gaaaatatcg ttattgaaat 8160

ggcacgtgaa aatcagacaa ctcaaaaggg ccagaaaaat tcgcgagagc gtatgaaacg 8220

aatcgaagaa ggtatcaaag aattaggaag tcagattctt aaagagcatc ctgttgaaaa 8280

tactcaattg caaaatgaaa agctctatct ctattatctc caaaatggaa gagacatgta 8340

tgtggaccaa gaattagata ttaatcgttt aagtgattat gatgtcgatc acattgttcc 8400

acaaagtttc cttaaagacg attcaataga caataaggtc ttaacgcgtt ctgataaaaa 8460

tcgtggtaaa tcggataacg ttccaagtga agaagtagtc aaaaagatga aaaactattg 8520

gagacaactt ctaaacgcca agttaatcac tcaacgtaag tttgataatt taacgaaagc 8580

tgaacgtgga ggtttgagtg aacttgataa agctggtttt atcaaacgcc aattggttga 8640

aactcgccaa atcactaagc atgtggcaca aattttggat agtcgcatga atactaaata 8700

cgatgaaaat gataaactta ttcgagaggt taaagtgatt accttaaaat ctaaattagt 8760

ttctgacttc cgaaaagatt tccaattcta taaagtacgt gagattaaca attaccatca 8820

tgcccatgat gcgtatctaa atgccgtcgt tggaactgct ttgattaaga aatatccaaa 8880

acttgaatcg gagtttgtct atggtgatta taaagtttat gatgttcgta aaatgattgc 8940

taagtctgag caagaaatag gcaaagcaac cgcaaaatat ttcttttact ctaatatcat 9000

gaacttcttc aaaacagaaa ttacacttgc aaatggagag attcgcaaac gccctctaat 9060

cgaaactaat ggggaaactg gagaaattgt ctgggataaa gggcgagatt ttgccacagt 9120

gcgcaaagta ttgtccatgc cccaagtcaa tattgtcaag aaaacagaag tacagacagg 9180

cggattctcc aaggagtcaa ttttaccaaa aagaaattcg gacaagctta ttgctcgtaa 9240

aaaagactgg gatccaaaaa aatatggtgg ttttgatagt ccaacggtag cttattcagt 9300

cctagtggtt gctaaggtgg aaaaagggaa atcgaagaag ttaaaatccg ttaaagagtt 9360

actagggatc acaattatgg aaagaagttc ctttgaaaaa aatccgattg actttttaga 9420

agctaaagga tataaggaag ttaaaaaaga cttaatcatt aaactaccta aatatagtct 9480

ttttgagtta gaaaacggtc gtaaacggat gctggctagt gccggagaat tacaaaaagg 9540

aaatgagctg gctctgccaa gcaaatatgt gaatttttta tatttagcta gtcattatga 9600

aaagttgaag ggtagtccag aagataacga acaaaaacaa ttgtttgtgg agcagcataa 9660

gcattattta gatgagatta ttgagcaaat cagtgaattt tctaagcgtg ttattttagc 9720

agatgccaat ttagataaag ttcttagtgc atataacaaa catagagaca aaccaatacg 9780

tgaacaagca gaaaatatta ttcatttatt tacgttgacg aatcttggag ctcccgctgc 9840

ttttaaatat tttgatacaa caattgatcg taaacgatat acgtctacaa aagaagtttt 9900

agatgccact cttatccatc aatccatcac tggtctttat gaaacacgca ttgatttgag 9960

tcagctagga ggtgactgat ggctggttgg cgtactgttg tggtaaatac ccatgggtat 10020

ggacagtttt cccgacgtct aagaaaccat tattatcatg acattaacct ataaaaatag 10080

gcgtatcacg aggccctttc gtctcgcgcg tttcggtgat gacggtgaaa acctctgaca 10140

catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc 10200

ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc tggcttaact atgcggcatc 10260

agagcagatt gtactgagag tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag 10320

gagaaaatac cgcatcaggc gccattcgcc attcaggctg cgcaactgtt gggaagggcg 10380

atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 10440

attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtgc 10500

caagcttgca tgcctgcaga acggattgtt gatgattacg aaaatattaa gagcacagac 10560

tattacacag aaaatcaaga attaaaaaaa cgtagagaga gtttgaaaga agtagtgaat 10620

acatggaaag aggggtatca cgaaaaaagt aaagaggtta ataaattaaa gcgagagaat 10680

gatagtttga atgagcagtt gaatgtatca gagaaatttc aagctagtac agtgacttta 10740

tatcgtgctg cgagggcgaa tttccctggg tttgagaaag ggtttaatag gcttaaagag 10800

aaattcttta atgattccaa atttgagcgt gtgggacagt ttatggatgt tgtacaggat 10860

aatgtccaga aggtcgatag aaagcgtgag aaacagcgta cagacgattt agagatgtag 10920

aggtactttt atgccgagaa aactttttgc gtgtgacagt ccttaaaata ta 10972

<210> 2

<211> 51

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 2

catggataag aaatactcaa taggcttagc tatcggcaca aatagcgtcg g 51

<210> 3

<211> 22

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 3

cgattatgtc ttttgcgcag tc 22

<210> 4

<211> 19

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 4

cgcaccagcg aaaactggt 19

<210> 5

<211> 51

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 5

ccgacgctat ttgtgccgat agctaagcct attgagtatt tcttatccat g 51

<210> 6

<211> 56

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 6

gtcgaccgag accattggtc tcagataaga aatactcaat aggcttagct atcggc 56

<210> 7

<211> 28

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 7

cgcagcacga tataaagtca ctgtacta 28

<210> 8

<211> 28

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 8

gctagtacag tgactttata tcgtgctg 28

<210> 9

<211> 55

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 9

agtatttctt atctgagacc aatggtctcg gtcgacaacg caggaaagaa catgt 55

<210> 10

<211> 63

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 10

cacatgttct ttcctgcgtt gtcgaccgag accattggtc tcaatgagta gcgaaaccgg 60

tcc 63

<210> 11

<211> 47

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 11

gctaagccta ttgagtattt cttatcactt tccggggttg cgctttc 47

<210> 12

<211> 64

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 12

tgctcacatg ttctttcctg cgttgtcgac agagtttgca aaatatacag gggattatat 60

ataa 64

<210> 13

<211> 55

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 13

cactgcaacc ggaccggttt cgctactcat gtgatatgtc ctcctctctt cactt 55

<210> 14

<211> 20

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 14

caagcaatta acgtatacga 20

<210> 15

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 15

gaaacaagca attaacgtat acga 24

<210> 16

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 16

gttcgttaat tgcatatgct caaa 24

<210> 17

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 17

tcaatttaga aagaggaaaa gcaa 24

<210> 18

<211> 20

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 18

tggaaacatg agcgcaatac 20

<210> 19

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 19

gaaatctgat attaatatta aaac 24

<210> 20

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 20

aaacgtttta atattaatat caga 24

<210> 21

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 21

gaaaagcaat actacagtaa aaac 24

<210> 22

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 22

aaacgttttt actgtagtat tgct 24

<210> 23

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 23

gaaatgtcta caaagttgca gcga 24

<210> 24

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 24

aaactcgctg caactttgta gaca 24

<210> 25

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 25

gaaaagaacg aaaggtacca ttgc 24

<210> 26

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 26

aaacgcaatg gtacctttcg ttct 24

<210> 27

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 27

gaaaggattc aacggtaatg ttac 24

<210> 28

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 28

aaacgtaaca ttaccgttga atcc 24

<210> 29

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 29

gaaaatatat cgaaccgatc ataa 24

<210> 30

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 30

aaacttatga tcggttcgat atat 24

<210> 31

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 31

gaaaaatgtt actggtgatg atac 24

<210> 32

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 32

aaacgtatca tcaccagtaa catt 24

<210> 33

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 33

gaaaaggtat aacgaatgtt aaat 24

<210> 34

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 34

aaacatttaa cattcgttat acct 24

<210> 35

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 35

gaaagaaaat atactaatta aaaa 24

<210> 36

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 36

aaacttttta attagtatat tttc 24

<210> 37

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 37

gaaagaagaa ggtgctaaca aaag 24

<210> 38

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 38

aaaccttttg ttagcacctt cttc 24

<210> 39

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 39

gaaaggaaaa attggcggcc ttat 24

<210> 40

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 40

aaacataagg ccgccaattt ttcc 24

<210> 41

<211> 3437

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 41

gaattcgagc tcggtacctc gcgaatgcat ctagaatgag tagcgaaacc ggtccggttg 60

cagtggatcc gaccctgcgc cgtcgcattg aaccgcacga gtttgaagtg ttctttgatc 120

cgcgcgagct gcgcaaagaa acttgcctgc tgtacgagat taactggggt ggccgccata 180

gcatctggcg ccataccagc cagaacacca ataagcacgt ggaagtgaat tttattgaaa 240

aatttaccac cgagcgctac ttctgcccta atacccgctg cagcatcacc tggtttctga 300

gctggagccc gtgcggcgaa tgtagtcgcg ccattaccga gttcctgagc cgctatccgc 360

atgtgaccct gttcatctac atcgcccgtc tgtaccatca cgccgatccg cgcaatcgcc 420

aaggtctgcg tgatctgatt agcagcggtg tgaccatcca gatcatgacc gaacaagaga 480

gcggctattg ctggcgcaac ttcgtgaact attctccgag caacgaagcc cactggccgc 540

gttatccgca tctgtgggtg cgcctgtatg tgctggagct gtactgcatc atcctgggcc 600

tgccgccttg cctgaatatt ctgcgccgta aacagccgca actgacattc ttcaccatcg 660

cactgcagag ctgccattat cagcgcctgc cgccgcacat tttatgggcc accggtctga 720

aaagcggtag tgaaactccg ggcacaagcg aaagcgcaac cccggaaagt cccgggcccg 780

tcgactgcag aggcctgcat gcaagcttgg cgtaatcatg gtcatagctg tttcctgtgt 840

gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag 900

cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt 960

tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 1020

gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 1080

ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 1140

caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 1200

aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa 1260

atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 1320

cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 1380

ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 1440

gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 1500

accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 1560

cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 1620

cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct 1680

gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 1740

aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 1800

aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 1860

actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 1920

taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 1980

gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 2040

tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 2100

ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 2160

accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 2220

agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 2280

acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 2340

tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 2400

cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 2460

tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 2520

ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt 2580

gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc 2640

tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 2700

ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 2760

gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 2820

cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 2880

gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 2940

ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga 3000

cattaaccta taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg 3060

acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 3120

atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct 3180

ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg cggtgtgaaa 3240

taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ccattcgcca ttcaggctgc 3300

gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaaag 3360

ggggatgtgc tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt 3420

gtaaaacgac ggccagt 3437

<210> 42

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 42

gaaaaaccgt caaattgaat ttta 24

<210> 43

<211> 24

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 43

ttggcagttt aacttaaaat caaa 24

<210> 44

<211> 20

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 44

ggtgaaggtc gtggtttagg 20

<210> 45

<211> 21

<212> DNA

<213> artificial sequence (Artificial Synthesis)

<400> 45

gccagctata cagtgcattt g 21

Claims (2)

1. The application of the pnCasSA-BEC plasmid in staphylococcus aureus base mutation is characterized by comprising the following steps:

(1) firstly, selecting a DNA fragment with 20 bases in front of a certain NGG sequence on a target gene cntA, and calling the fragment as a spacer fragment; the requirements of this step are: in order to insert the spacer fragment into the pnCasSA-BEC plasmid, primers were designed using the following templates:

5’-GAAANNNNNNNNNNNNNNNNNNNN-3’

3’-NNNNNNNNNNNNNNNNNNNNCAAA-5’；

inserting the spacer into the pnCasSA-BEC plasmid to obtain the pnCasSA-BEC-cntAsp plasmid;

(2) transferring the constructed pnCasSA-BEC-cntAsp plasmid into a staphylococcus aureus RN4220 strain, selecting a monoclonal colony, inoculating the monoclonal colony into a 3mL TSB liquid culture medium, shaking overnight in a shaker at 30 ℃, extracting genomic DNA from the strain by using an Ezup column type bacterial genomic DNA extraction kit, and carrying out PCR amplification on a cntA gene fragment by taking the genomic DNA as a template;

the PCR verification primer sequence of the cntA base mutation is as follows:

5' primer: 5'-TCAATTTAGAAAGAGGAAAAGCAA-3' (SEQ ID NO: 17);

3' primer: 5'-TGGAAACATGAGCGCAATAC-3' (SEQ ID NO: 18);

(3) extracting pnCasSA-BEC-cntAsp plasmid from RN4220 strain with successful base mutation by using SanPrep column type plasmid DNA small extraction kit of Shanghai part of bioengineering biology;

(4) the pnCasSA-BEC-cntAsp plasmid extracted from the RN4220 strain is transferred into the Newman and USA300 strains of staphylococcus aureus;

the pnCasSA-BEC plasmid contains a promoter expressed by an APOBEC1 protein and a Cas9 nickase protein gene, an APOBEC1 protein gene fragment, a connecting region of an APOBEC1 protein gene and a Cas9 nickase protein gene, a Cas9 nickase protein gene fragment, a temperature-sensitive plasmid replicon in staphylococcus aureus, a chloramphenicol resistance gene fragment in staphylococcus aureus, a kanamycin resistance gene fragment in escherichia coli, a plasmid replicon in escherichia coli, an enzyme digestion site, a promoter expressed by sgRNA and sgRNA;

the pnCasSA-BEC plasmid has the sequence shown in SEQ ID NO: 1.

2. coli DH5 a strain containing the pnCasSA-BEC plasmid according to claim 1, which has the taxonomic designation: escherichia coli; latin literature name:Escherichia coli(ii) a The preservation unit: china center for type culture Collection; the preservation number is: CCTCC M2018031.

Images