CN108498529A - Dnmt rna inhibitor and cGAMP pharmaceutical compositions for tumor prevention treatment - Google Patents
Dnmt rna inhibitor and cGAMP pharmaceutical compositions for tumor prevention treatment Download PDFInfo
- Publication number
- CN108498529A CN108498529A CN201810635340.XA CN201810635340A CN108498529A CN 108498529 A CN108498529 A CN 108498529A CN 201810635340 A CN201810635340 A CN 201810635340A CN 108498529 A CN108498529 A CN 108498529A
- Authority
- CN
- China
- Prior art keywords
- cgamp
- days
- zebularine
- dnmt rna
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7084—Compounds having two nucleosides or nucleotides, e.g. nicotinamide-adenine dinucleotide, flavine-adenine dinucleotide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention is provided to the dnmt rna inhibitor of tumor prevention treatment and cGAMP pharmaceutical compositions.Have the function of activation the invention discloses dnmt rna inhibitor and cGAMP Combined Treatments and adjust immunization, tumour growth can be significantly inhibited, extend the survival period of mice with tumor.Study on mechanism shows that dnmt rna inhibitor can activate the effect of STING and its related pathways, the expression of inducing interferon, to achieve the effect that inhibit tumour, extending life with cGAMP Combined Treatments.
Description
Technical field
The invention belongs to biomedicine technical fields, and in particular to the dnmt rna suppression for tumor prevention treatment
Preparation and cGAMP combined medicinal compositions.
Background technology
DNA methylation is one of epigenetic modification main means, is by dnmt rna (DNA
Methytransferase, DNMT) catalysis progress, abnormal generation, development and drug resistance of tumor with tumour and pre- aftereffect
Fruit is undesirable substantial connection.It is developed at present to have two class dnmt rna inhibitor（DNMTi）, also known as go first
Base chemical drug object：Including ucleosides and non-nucleoside dnmt rna inhibitor.Wherein U-18496 (azacitidine, 5-
Azacytidine, azacytidine) and its derivative 5- nitrogen -2 '-deoxycytidine (Decitabine, 5-aza-2 ' -
Deoxycytidine, Decitabine, Dac) it has been approved for treatment myelodysplastic syndrome
（Myelodysplastic syndromes, MDS）, acute myeloid leukemia（acute myeloid leukaemia； AML）,
Chronic myelomonocytic leukemia（chronic myelomonocytic leukaemia, CMML）.
Recently a large amount of research reports regulating and controlling effect of the dnmt rna inhibitor to immune system.DNMTi is participated in
The regulation and control of tumor associated antigen expression and antigen presentation mechanism, and lead to enhancing of the T cell to tumour recognition capability.DNMTi
Immune signal and a series of gene expressions for participating in immunoregulation of up-regulation, especially interferon can be induced in a variety of cancer cells
The expression of (Interferon, IFN) and its response pathway gene significantly increases.Interferon can enhance major histocompatibility antigen
The maturation of expression, enhancing Dendritic Cells with tumor associated antigen and antigen presentation, the cell toxicant of enhancing natural killer cells
Therefore effect, the cytotoxicity etc. for enhancing antibody dependent cellular play important work in the immune supervision of cancer cell
With.The research of inducing interferon signal pathway is made great progress in recent years, especially cytoplasmic DNA is in the approach
Effect, it was found that the cGAMP to play a crucial role in the expression of cytoplasmic DNA inducing interferon（cyclic GMP-AMP）And its it closes
At enzyme cGAS.CGAS is considered as the major receptors of DNA in cytoplasm, and cGAMP is generated using ATP and GTP catalysis.cGAMP
As second messenger molecule, by combining interferon gene stimulates the protein（STING）, activate the TANK- combinations kinases 1 in downstream
（TBK1）And promote Interferon regulatory factor-3（IRF3）Phosphorylation and dimerization and activation IKK（IκB Kinase）And promote
NF-κB（Nuclear Factor κB）Phosphorylation.IRF3 the and NF- κ B of phosphorylation enter nucleus inducing interferon and cell
Factor expression causes the immune response that DNA is mediated.
Recent mass data shows that cGAS-STING regulatory pathway and immunotherapy of tumors have close association, is to have very much
The therapeutic targets of foreground.When lacking STING, CD8-T cell can not be completed to prepare to the resistance of tumor associated antigen, and swollen
Tumor is grown faster.STING is activated, and can stimulate the immunocytes such as including Dendritic Cells, is changed tumor microenvironment and is induced
The generation of tumor specific T cells.The anti-tumor effect that the interferon that radiotherapy is induced relies on is STING dependences, and
CGAMP can enhance the effect of radiotherapy, and a kind of autophagy inhibition PROTEIN C D47 of expression high in tumour and tumor stem cell is anti-
The antitumor action of body is also what STING was relied on.It is radiated and tumour cell that CD47 antibody is killed can be by autophagocyte packet
It includes Dendritic Cells to be swallowed, the DNA in tumour source is transferred to CD8a+ Dendritic Cells using cGAS-STING accesses, so
CD8+ T cells are presented to by I type MHC albumen afterwards.Research finds that cGAMP processing can dendritic cell activated and enhancing tumour
Related antigen has the function of inhibiting tumour growth, enhancing mice with tumor survival to the presentation of CD8 T cells.
Under background above, we have developed dnmt rna inhibitor and cGAMP drugs for treating tumour
Composition and method, the popularization and application of the treatment means clinically will bring glad tidings for cancer patient.
Invention content
The present invention is provided to the dnmt rna inhibitor of tumor prevention treatment and cGAMP combined medicinal compositions.
The purpose is achieved through the following technical solutions：
Dnmt rna inhibitor and application of the cGAMP combination medicines in preparing tumor prevention medicine.
Described pharmaceutical composition contains a kind of dnmt rna inhibitor and cGAMP.
Dnmt rna inhibitor is 4- BrdUs（Zebularine）, U-18496（5-azacytidine）And
Its derivative 5- nitrogen -2 '-deoxycytidine（5-aza-2′-deoxycytidine）In one kind.
CGAMP is ring bird adenylate, i.e. 2 ', 3 '-Cyclic guanosine monophosphate-adenosine
monophosphate。
Described pharmaceutical composition：4- BrdU drug doses are 10-2000 mg/kg/days and cGAMP drug agent
Amount is 0.01-2.5 mg/kg/days.Preferably, described pharmaceutical composition：4- BrdU drug doses are 350 milligrams/thousand
Gram/day；Every 4 days of cGAMP injections are primary, drug dose be 0.5 mg/kg/time.
Described pharmaceutical composition：5- nitrogen -2 '-deoxycytidine drug dose is 0.005-2.5 mg/kg/days, and
CGAMP drug doses are 0.01-2.5 mg/kg/days.Preferably, described pharmaceutical composition：5- nitrogen -2 '-deoxycytidine medicine
Agent amount is 0.1 mg/kg/day；Every 4 days of cGAMP injections are primary, drug dose be 0.5 mg/kg/time.
It is described prepare treatment tumour drug can be used injection, tablet, freeze-dried powder, capsule, thin membrane coated tablet or
Other suitable dosage forms.
The remarkable advantage of the present invention：
Dnmt rna inhibitor DNMTi of the present invention and cGAMP combinations have the effect of apparent treatment tumour, real
Existing 1+1>2 effect, significantly suppresses the growth of tumor model mouse tumor, and improves the survival rate of mice with tumor.Meanwhile
The drug combination can be obviously improved the immunoregulation capability of tumour cell, promote the up-regulation that IFN β is expressed in tumour cell, from
And play the effect of killing tumor cell.
Description of the drawings
Fig. 1 B16F10 cells carry out the shadow that DNMTi expresses I type interferon IFN βs mRNA with cGAMP Combined Treatments
It rings.
Fig. 2 SGC-7901 cells carry out the influence that Zebularine expresses IFN β mRNA with cGAMP Combined Treatments.
Zebularine and influence of the cGAMP Combined Treatments to IFN β protein expression are carried out in Fig. 3 .SGC-7901 cells.
The influence to IFN β mRNA expression is used in combination with cGAMP for Fig. 4 non-nucleoside dnmt rna inhibitor.
Fig. 5 qRT-PCR detects influences of the Zebularine to the mRNA expression of STING in tumour cell.
Expression of Fig. 6 Western blot detections Zebularine to cGAS-SING pathway associated proteins, to determine it
Activation effect.
Fig. 7 melanoma mouse measure tumor size to determine that Zebularine and cGAMP joins after carrying out different disposal
It closes using the growth that can inhibit tumour.
Survivorship curve figure of Fig. 8 melanoma mouse after different disposal is to show that Zebularine combines with cGAMP
Use the influence to B16F10 mice with tumor survival rates.
Fig. 9 melanoma mouse carry out different disposal after measure tumor size with determine 5- nitrogen -2 '-deoxycytidine with
The growth that can inhibit tumour is used in combination in cGAMP.
Specific implementation mode
The influence that 1. DNMTi of embodiment expresses IFN β mRNA with cGAMP Combined Treatment B16F10 cells
Method is as follows：
B16F10 cells are through DMSO, 5 μM of 5- nitrogen -2 '-deoxycytidine（5'-Aza-2'deoxycytidine）Or 25 μM
After Zebularine is handled 4 days, by cell again bed board, in 37 DEG C, 5% CO2It is cultivated in cell incubator, waits for cell Proliferation extremely
After 80%, then add the cGAMP processing of final concentration of 500 nM, cell is collected after 4 hours, discard old culture medium, 1 ml is added
Cell is collected in 1.5 ml centrifuge tubes by Trizol solution；Add 200 μ l chloroforms, acutely concussion 25 seconds, are stored at room temperature 5 points
Clock, then 4 DEG C, 12,000g centrifuge 15 minutes；Supernatant is drawn, is added the isopropanol of same volume, after mixing, 4 DEG C stand 10 points
Clock is then centrifuged for 10 minutes；Supernatant is sucked, 75% absolute ethyl alcohol that 1 ml is newly prepared is added so that precipitation is suspended in anhydrous second
In alcohol；Then 4 DEG C, 7500g is centrifuged 5 minutes；Supernatant is sucked, precipitation is dried, is dissolved in water, you can obtain cell total rna；It presses
Reverse transcription is carried out according to the specification on PrimeScript RT reagent Kit with gDNA Eraser, to prepare cDNA.
Obtained cDNA realtime quantitative inspections（qPCR）Amplification, condition are as follows：CDNA templates 2 μ l, SYBR
5 μ l of green dyestuffs, interferon IFN β gene primer (TGGGTGGAATGAGACTATTGTTG and
CTCCCACGTCAATCTTTCCTC) each 0.2 μ l, totally 10 μ l, 95 DEG C 10 minutes；95 DEG C recycle for 30 seconds, 60 DEG C for 30 seconds
35 progress PCR amplifications of reaction, the expression of detection interferon IFN β mRNA, and calculated respectively according to ct values △ △ Ct methods
Relative expression quantity between sample.Using 6 software data processings of GraphPad Prism,P<0.05It is considered to have conspicuousness
Difference, wherein*P<0.05, **P<0.01, ***P<0.001。
As a result as follows：
As shown in Figure 1, in B16F10 cells, compared with the control, 5- nitrogen -2 '-deoxycytidine（5'-Aza-2'
deoxycytidine）Or after Zebularine handles 4 days respectively, 2-4 times of the mRNA up-regulated expressions of IFN β can be caused, it was demonstrated that this
Two demethylation drugs can activate the immune response that interferon mediates to a certain extent.It matches with expection, cGAMP can be carried
50 times of the expression of high IFN β mRNA, and cell after these drug-treateds is stimulated through cGAMP again, the expression of IFN β can be notable
Promote 500-1000 times, it was demonstrated that 5- nitrogen -2 '-deoxycytidine or Zebularine can significantly increase the interferon that cGAMP is induced
Expression, therefore, 5- nitrogen -2 '-deoxycytidine or Zebularinec and GAMP, which are used in combination, can significantly activate tumour cell interferon
The immune response of mediation.
The influence that 2. Zebularine of embodiment expresses IFN β mRNA with cGAMP Combined Treatment SGC-7901 cells
Method is as follows：
SGC-7901 cells are after 25 μM of Zebularine are handled 4 days, by cell again bed board, in 37 DEG C, 5% CO2Cell is trained
Case culture is supported, is handled 4 hours after cell Proliferation to 80%, then with the cGAMP of various concentration, cell is collected, according to above-mentioned analysis
Method extracts RNA, qPCR and detects IFN β mRNA expressions, and detection Zebularine is with cGAMP Combined Treatments to IFN β
The influence of mRNA expression.
As a result as follows：
In SGC-7901 cells, compared with the control, Zebularine and 10 nM cGAMP individually handle the mRNA tables to IFN β
The influence reached is not notable, and when Zebularine treated cells are again through 10 nM cGAMP stimulations, the expression of IFN β can be shown
It writes and promotes 10 times or more；As expected, 100 nM cGAMP are individually handled, and the expression of IFN β can promote 10 times, and work as
For Zebularine treated cells again through 100 nM cGAMP stimulations, the expression of IFN β can be obviously improved 800 times or more；It proves
Zebularine can significantly increase the interferon expression of cGAMP inductions, and therefore, Zebularine and cGAMP, which is used in combination, to be shown
The immune response that activation tumour cell interferon mediates is write, and shows dosage effect
3. Zebularine of embodiment and influence of the cGAMP Combined Treatment SGC-7901 cells to IFN β protein expression
Method is as follows：
SGC-7901 cells are after 25 μM of Zebularine are handled 4 days, by cell again bed board, in 37 DEG C, 5% CO2Cell
It is cultivated in incubator, is handled 4 hours after cell Proliferation to 80%, then with the cGAMP of 100 nM, collect cell, be added 80 ~ 100
μ l carry the cell pyrolysis liquid of 1 mM protease inhibitors (PMSF) and inhibitors of phosphatases, place lytic cell 10 on ice and divide
Clock；This cell pyrolysis liquid is transferred in clean centrifuge tube, 14,000g 4 DEG C centrifuge 10 minutes；It is total protein to take supernatant
Sample.The sample containing 40 μ g Tot Prots is taken, sample-loading buffer is added, boiling water boiling makes albuminous degeneration in 10 minutes, then carries out SDS-
PAGE gel electrophoresises detach.After electrophoresis, the protein band on gel is transferred on pvdf membrane.At ambient temperature, will
5% skimmed milk power of pvdf membrane or 5% BSA close 1-2 hours；Anti- IFN β antibody is diluted with confining liquid in suitable ratio, 4
DEG C shaking table is incubated overnight or 37 DEG C are incubated 2 hours.It takes out pvdf membrane within second day, is rinsed 3 times, every time 10 points with TBST buffer solutions
Clock, then with by 1:1000 ratios dilute the secondary antibody of corresponding fluorescent marker with TBST buffer solutions, are protected from light incubation at room temperature 2 hours.
Secondary antibody is abandoned, pvdf membrane is rinsed 3 times, every time 10 minutes with TBST buffer solutions；Film is swept with Dual band IR laser imager (Odyssey)
Colour developing, determines the expression of interferon IFN β.
As a result as follows：
As shown in figure 3, when SGC-7901 cells stimulate after Zebularine is handled 4 days through cGAMP, the protein expression of IFN β is aobvious
It writes and improves.Therefore, we can confirm that, the Combined Treatment of Zebularine and cGAMP can be activated significantly in tumour cell
Interferon expression.
The influence to IFN β mRNA expression is used in combination in 4. non-nucleoside DNMTis of embodiment and cGAMP
Method is as follows
Because above two demethylation drug is all the drug of ucleosides, therefore we also have chosen two different non-nucleosides
Class demethylation drug Hydralazine and EGCG are tested.SGC-7901 cells are through 25 μM of Zebularine, 25 μM
Hydralazine, after 50 μM of EGCG are handled 4 days, by cell again bed board, in 37 DEG C, 5% CO2It is cultivated in cell incubator,
It is handled 4 hours after cell Proliferation to 80%, then with 100 nM cGAMP, cell is collected, described in above-described embodiment 1
Method extracts RNA, qPCR detection, and analysis non-nucleoside demethylation drug Hydralazine or EGCG combine place with cGAMP
Manage the influence to IFN β mRNA expression.
As a result as follows:
As shown in figure 4, SGC-7901 is through different demethyl drug-treateds and then carries out cGAMP stimulations, wherein
Zebularine processing groups are as positive control.The result shows that non-nucleoside demethylation drug（Hydralazine or EGCG）
Combination with cGAMP can also significantly improve IFN β mRNA expression.Show that non-nucleoside demethylation drug joins with cGAMP
Used time greatly enhances the expression of IFN β.
5. Zebularine of embodiment improves the expression of STING mRNA in tumour cell
Method is as follows：
By DMEM/F12 medium culture of the ags cell containing 10% FBS, and DMSO control treatments and 50 μM are carried out respectively
The time gradient of Zebularine is handled, and Zebularine is handled 1-4 days, cell is collected, according to 1 the method for above-described embodiment
It extracts RNA, qPCR and detects STING mRNA expressions.
As a result as follows：
The results are shown in Figure 5, and with the lengthening of Zebularine processing times, STING mRNA expression is higher in ags cell, because
This Zebularine processing can enhance the expression of STING mRNA.
6. Zebularine of embodiment activates cGAS-SING pathway associated proteins
Method is as follows：
Ags cell is subjected to DMSO control treatments and the processing of 50 μM of Zebularine time gradients, bed board again after 4 days
Culture, is stimulated after cell Proliferation to 80%, then with 100 nM cGAMP, cell is collected after 0,2,4,6,8,10 hour.
According to the method extraction albumen in above-described embodiment 3 and analyze influences of the Zebularine to cGAS-SING pathway associated proteins.
As a result as follows：
As shown in fig. 6, when ags cell is after 50 μM of Zebularine are handled 4 days, then the thorns of the cGAMP through different time gradient
Swash, the results showed that, Zebularine pretreatments cause the phosphorylation level of TBK1, IRF3 of cGAMP inductions to significantly improve, explanation
The enhancing of these protein active functions.Therefore, Zebularine and cGAMP, which is used in combination, significantly cGAS-SING to be activated to exempt from
Epidemic disease regulatory pathway.
The growth for inhibiting tumour is used in combination in 7. Zebularine of embodiment and cGAMP
Method is as follows：
It after B16F10 cell culture to 95% abundance, is cleaned twice with PBS, after pancreatin digests 1 minute, with containing 2% FBS's
Cell is resuspended in PBS.By the C57Bl/6 female mice back side of B16F10 cell infusions to 8 week old, every injection 1 × 106/100μl
Cell observes tumor formation situation, when tumour grows to about 40-60mm in real time3When, be grouped again, respectively carry out cGAMP and
Zebularine is handled alone or in combination.Wherein, Zebularine（2.5 mg/ml）It is directly handled by drinking-water, in drinking-water
2% sucrose is added to encourage to drink water；And cGAMP（0.5 mg/kg）Swollen tumor-side injection is carried out within every 4 days once, is measured within every 2 days swollen
The growing state of tumor.
As a result as follows：
The results are shown in Figure 7, control group over time, gross tumor volume rapid development, the reduction of simultaneous body temperature,
After 15 days, the tumour of control group is average up to 1800mm3;CGAMP and Zebularine, which is used alone, to be had centainly
Inhibit the effect of tumour, after 15 days, processed tumour mean size is 1100mm3And 980mm3；And the two is used in combination,
There is strong inhibiting effect to tumour, the volume growth of tumour is slower, almost stops increasing to the later stage, after 15 days, the two knot
It is 480mm to close using processed tumour mean size3, hence it is demonstrated that the combination therapy of Zebularine and cGAMP is to tumour
There is significant inhibition.
The influence to B16F10 mice with tumor survival rates is used in combination in 8. Zebularine of embodiment and cGAMP
Method is as follows：
The structure of B16F10 tumour hour models is carried out by the method in embodiment 7, and records B16F10 mice with tumor in real time
Life span.
As a result as follows：
After B16F10 mice with tumor tumor models are built successfully, the hypothermia of mouse can be caused over time, when
After tumour growth to certain size, mouse then can be dead.As shown in figure 8, control group mice is 20 after injecting B16F10 cells
It is just all dead within it.It is administered alone in the group of processing through cGAMP and Zebularine, survival rate has compared with control group
It being improved, life span is delayed to 26 days, and in the case of cGAMP and Zebularine administering drug combinations, greatly carry
The high life span of mouse, life span are delayed to 30 days.Hence it is demonstrated that Zebularine and cGAMP can significantly improve it is swollen
The survival rate of tumor mouse.
The growth for inhibiting tumour is used in combination with cGAMP for 9. -2 '-deoxycytidine of 5- nitrogen of embodiment
Method is as follows：
The structure that B16F10 tumour hour models are carried out by the method in embodiment 7, waits for gross tumor volume in 40-60mm3When,
The model built is grouped again.CGAMP and 5- -2 '-deoxycytidines of nitrogen are carried out respectively to handle alone or in combination.Wherein, often
5- nitrogen -2 '-deoxycytidine of its 0.1 mg/kg of intraperitoneal injection, 10 μ g cGAMP of injection enter by tumour within every 4 days, every two days
Measure a mouse tumor size.Method as described in Example 7 is carried out with Zebularine and cGAMP simultaneously to be handled,
It is compared.
As a result as follows：
The results are shown in Figure 9, control group over time, gross tumor volume rapid development, and Zebularine+cGAMP groups
Tumour growth with 5- nitrogen -2 '-deoxycytidine+cGAMP groups is suppressed significantly, it was demonstrated that Zebularine and 5- nitrogen -2 '-deoxidation
The combination therapy of cytidine and cGAMP have good inhibition to tumour.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification should all belong to the covering scope of the present invention.
Claims (7)
1.DNA methyltransferase inhibitors and application of the cGAMP combination medicines in preparing tumor prevention medicine.
2. application according to claim 1, it is characterised in that：Dnmt rna inhibitor is 4- BrdUs, 5- nitrogen
One kind in cytidine and 5- nitrogen -2 '-deoxycytidine.
3. application according to claim 1, it is characterised in that：CGAMP is ring bird adenylate.
4. application according to claim 1, it is characterised in that：Dnmt rna inhibitor：4- BrdU drug agent
Amount is 1-2000 mg/kg/days and cGAMP drug doses are 0.001-2.5 mg/kg/days.
5. requiring the application according to right 4, it is characterised in that：Dnmt rna inhibitor：4- BrdU drug agent
Amount is 350 mg/kg/days；Every 4 days of cGAMP injections are primary, drug dose be 0.5 mg/kg/time.
6. application according to claim 1, it is characterised in that：The dnmt rna inhibitor：5- nitrogen -2 '-deoxidation
Cytidine drug dose is 0.005-2.5 mg/kg/days and cGAMP drug doses are 0.01-2.5 mg/kg/days.
7. application according to claim 6, it is characterised in that：The dnmt rna inhibitor：5- nitrogen -2 '-deoxidation
Cytidine drug dose is 0.1 mg/kg/day；Every 4 days of cGAMP injections are primary, drug dose be 0.5 mg/kg/time.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810635340.XA CN108498529A (en) | 2018-06-20 | 2018-06-20 | Dnmt rna inhibitor and cGAMP pharmaceutical compositions for tumor prevention treatment |
| PCT/CN2019/084395 WO2019242404A1 (en) | 2018-06-20 | 2019-04-25 | Dna methyltransferase inhibitor and cgamp pharmaceutical composition for tumor prevention and treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810635340.XA CN108498529A (en) | 2018-06-20 | 2018-06-20 | Dnmt rna inhibitor and cGAMP pharmaceutical compositions for tumor prevention treatment |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108498529A true CN108498529A (en) | 2018-09-07 |
Family
ID=63403646
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810635340.XA Pending CN108498529A (en) | 2018-06-20 | 2018-06-20 | Dnmt rna inhibitor and cGAMP pharmaceutical compositions for tumor prevention treatment |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN108498529A (en) |
| WO (1) | WO2019242404A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019242404A1 (en) * | 2018-06-20 | 2019-12-26 | 福建师范大学 | Dna methyltransferase inhibitor and cgamp pharmaceutical composition for tumor prevention and treatment |
| CN111068063A (en) * | 2020-01-15 | 2020-04-28 | 中国医学科学院基础医学研究所 | Application of IFN- α and DNMTi in preparation of tumor treatment drugs |
| US11299512B2 (en) | 2016-03-18 | 2022-04-12 | Immunesensor Therapeutics, Inc. | Cyclic di-nucleotide compounds and methods of use |
| CN114457054A (en) * | 2022-02-24 | 2022-05-10 | 中国科学技术大学 | Preparation of cGAS mRNA and application of cGAS mRNA as immune activator |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11638716B2 (en) | 2017-08-31 | 2023-05-02 | F-star Therapeutics, Inc. | Compounds, compositions, and methods for the treatment of disease |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106267213A (en) * | 2015-05-27 | 2017-01-04 | 聊城市奥润生物医药科技有限公司 | Ring dinucleotide cGAMP application in treatment tumor drug combination |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140155344A1 (en) * | 2010-06-07 | 2014-06-05 | Neil P. Desai | Combination therapy methods for treating proliferative diseases |
| CN108498529A (en) * | 2018-06-20 | 2018-09-07 | 福建师范大学 | Dnmt rna inhibitor and cGAMP pharmaceutical compositions for tumor prevention treatment |
-
2018
- 2018-06-20 CN CN201810635340.XA patent/CN108498529A/en active Pending
-
2019
- 2019-04-25 WO PCT/CN2019/084395 patent/WO2019242404A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106267213A (en) * | 2015-05-27 | 2017-01-04 | 聊城市奥润生物医药科技有限公司 | Ring dinucleotide cGAMP application in treatment tumor drug combination |
Non-Patent Citations (2)
| Title |
|---|
| TUO LI等: "The cGAS–cGAMP–STI NG pathway connects DNA damage to inflammation, senescence, and cancer", 《JOURNAL OF EXPERIMENTAL MEDICINE》 * |
| 杨彩云 等: "DNA甲基化/去甲基化的相关药物治疗研究现状与展望", 《生命科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11299512B2 (en) | 2016-03-18 | 2022-04-12 | Immunesensor Therapeutics, Inc. | Cyclic di-nucleotide compounds and methods of use |
| WO2019242404A1 (en) * | 2018-06-20 | 2019-12-26 | 福建师范大学 | Dna methyltransferase inhibitor and cgamp pharmaceutical composition for tumor prevention and treatment |
| CN111068063A (en) * | 2020-01-15 | 2020-04-28 | 中国医学科学院基础医学研究所 | Application of IFN- α and DNMTi in preparation of tumor treatment drugs |
| CN114457054A (en) * | 2022-02-24 | 2022-05-10 | 中国科学技术大学 | Preparation of cGAS mRNA and application of cGAS mRNA as immune activator |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019242404A1 (en) | 2019-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108498529A (en) | Dnmt rna inhibitor and cGAMP pharmaceutical compositions for tumor prevention treatment | |
| US10092592B2 (en) | Application of cyclic dinucleotide (cGAMP) in anti-tumor field | |
| US5601818A (en) | Cancer therapy utilizing malignant cells expressing HSV-TK | |
| CN105209047A (en) | GLA monotherapy for use in cancer treatment | |
| Jaganjac et al. | Granulocytes as effective anticancer agent in experimental solid tumor models | |
| CN110352067A (en) | Restricted VGLL1 peptide of HLA and application thereof | |
| Schötterl et al. | Adjuvant Therapy Using Mistletoe Containing Drugs Boosts the T‐Cell‐Mediated Killing of Glioma Cells and Prolongs the Survival of Glioma Bearing Mice | |
| WO2023050694A1 (en) | Combined pharmaceutical use of pd-1 antibody and pseudomonas aeruginosa and pharmaceutical composition thereof | |
| Currier et al. | The effect of immunization with killed tumor cells, with/without feeding of Echinacea purpurea in an erythroleukemic mouse model | |
| JP2023156486A (en) | Compositions for preventing or treating graft-versus-host disease comprising tlr5 agonist derived from flagellin as effective component | |
| CN117298121A (en) | Application of dandelionsterol in helicobacter pylori induced gastritis or gastric cancer | |
| CN113117088B (en) | Use of inhibitors of calcium activated chloride channels in tumor immunotherapy | |
| CN108236722B (en) | Application of IDNK inhibitor in preparation of liver cancer treatment drug | |
| CN105521482B (en) | Combined application of HNF1 α, HNF4 α and FOXA3 for inducing differentiation and treating hepatocellular carcinoma | |
| WO2021218802A1 (en) | Isolated recombinant oncolytic poxvirus capable of being regulated and controlled by microrna and use thereof | |
| CN110215516A (en) | It is a kind of to inhibit the treatment of CDK5 synergetic immunity in the application inhibited in breast cancer | |
| CN106540253A (en) | The application of cGAMP and its derivant in anti-tumor vaccine is prepared | |
| Bocharova et al. | Prospects of using phytoadaptogen in the treatment of diffuse stomach cancer | |
| CN109432116A (en) | Astragaloside III is preparing the purposes in immunotherapy of tumors drug | |
| WO2018120496A1 (en) | Recombinant oncolytic influenza virus preparation method and application | |
| EP1871872B1 (en) | Method for activating cd8 t cells | |
| Li et al. | Treadmill training improves neural function recovery in rats with spinal cord injury via JAK2/STAT3 signaling pathway and attenuating apoptosis | |
| CN115948332A (en) | Thymus stromal lymphopoietin and interleukin 2 activated alpha beta T cell and preparation method and application thereof | |
| Lu | Research Status of Tumor Therapy Based on Immunotherapy | |
| Shen et al. | Traditional Chinese herbal medicine: harnessing dendritic cells for anti-tumor benefits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180907 |
|
| RJ01 | Rejection of invention patent application after publication |