CN108484763A - L7D8 monoclonal antibodies and its application - Google Patents
L7D8 monoclonal antibodies and its application Download PDFInfo
- Publication number
- CN108484763A CN108484763A CN201810291609.7A CN201810291609A CN108484763A CN 108484763 A CN108484763 A CN 108484763A CN 201810291609 A CN201810291609 A CN 201810291609A CN 108484763 A CN108484763 A CN 108484763A
- Authority
- CN
- China
- Prior art keywords
- cys
- ala
- thr
- gly
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/32—Immunoglobulins specific features characterized by aspects of specificity or valency specific for a neo-epitope on a complex, e.g. antibody-antigen or ligand-receptor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
Abstract
The present invention relates to gene engineering technology fields, disclose a kind of L7D8 monoclonal antibodies, and the antibody includes heavy chain and light chain, and the heavy chain is made of amino acid sequence SEQ ID No.1, and the light chain is made of amino acid sequence SEQ ID No.2.L7D8 monoclonal antibodies can specifically bind XI collagen types.The L7D8 monoclonal antibodies of the present invention can remove the natural XI collagen types of (histotomy, urine, blood) in detection biological sample in conjunction with natural XI collagen types by the methods of immunohistochemistry, ELISA and WB.
Description
Technical field
The present invention relates to gene engineering technology field, specifically a kind of L7D8 monoclonal antibodies and its application.
Background technology
XI collagen types are that the less albumen of the content in articular cartilage contains according to the maturity of collagen cartilage
Amount can be between 3-10%.And II Collagen Type VIs are then the main components in articular cartilage, account for 80-85% of total amount or so.XI types and
II Collagen Type VIs molecule is all triple-helix structure.Unlike, XI collagen types are by three different α chains [α 1 (XI), α 2
(XI), α 3 (XI)] composition, and II Collagen Type VIs are made of three identical α chains [α 1 (II)].Wherein α 3 (XI) and α 1 (II)
Be to be generated by the same gene code, have an identical amino acid sequence, but α 3 (XI) have it is more complicated glycosylation modified.
Collagenous fibres network assigns the ability that cartilaginous tissue locks proteoglycans, to provide tensile stress for tissue, is
The necessary condition of normal cartilage development.Cartilage specificity collagenous fibres are made of the mixing of XI types, II types and IX Collagen Type VI microfibres,
Containing there are two types of the collagenous fibres of different thicknesses in normal cartilage --- thin collagenous fibres and thick collagenous fibres, their diameter point
It Wei not 20nm and 40nm.Studies have shown that XI collagen type fibers only exist in thin collagenous fibres, thin collagenous fibres have " 4+
10 " patterns, i.e. 2 XI types and 2 II Collagen Type VI microfibres composition fibrillar center parts, then enclosed by 10 II Collagen Type VI microfibres
The annular being coiled into is wrapped.XI collagen microfibrils not only has collagen stroma stability critically important contribution function, also has and is situated between
Lead the effect that normal thin collagenous fibres are formed.Some researches show that (Cho/Cho is small for the deficient mice of coding for alpha 1 (XI) chain
Mouse) and coding for alpha 1 (II), α 1 (XI) or α 2 (XI) chain gene defect crowd (people Stickler/Marshall syndromes)
The phenomenon that normal thin collagenous fibres can not be formed, show dyschondroplasia.
There was only the collagen antibodies such as CII, CI (or generating the hybridoma for being directed to CII/CI antibody) at present, such as patent US
9005912B2, EP 3050899A1, US 8394378B2, the antibody that yet there are no anti-CXI disclose.In addition, XI types and II type glue
Former structure and sequence has certain similitude, it is most likely that also can have one to II Collagen Type VIs for the antibody of XI collagen types
Fixed cross reaction, causes false positive.The monoclonal antibody for XI collagen types is temporarily also found no in the prior art.
Therefore, a kind of L7D8 monoclonal antibodies that can specifically bind XI collagen types are developed, be those skilled in the art urgently
The technical issues of need to solving.
Invention content
In view of the deficiencies of the prior art, the present invention provides a kind of L7D8 monoclonal antibodies and its applications.
The present invention to achieve the above object, takes following technical scheme to be achieved：
A kind of L7D8 monoclonal antibodies, the antibody include heavy chain and light chain, and the heavy chain is by amino acid sequence SEQ ID
No.1 is constituted, and the light chain is made of amino acid sequence SEQ ID No.2.
Wherein, the amino acid sequence SEQ ID NO.1 of heavy chain (IgG) are as follows：
TATGAACCTAGCCCTGATTTCCCCAGCCTTCAGTTCCCAGATTCAGTGATCAGCCTTGAACACAGACCT
GTCACCATGAAGTTGTGGCTGAACTGGATTTTCCTTGTAACACTTTTAAATGGTATCCAGTGTGAGGTGAAACTGGT
GGAGTCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTCACTG
ATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGAAAGGCACCTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAAA
GGTTACACAACAGAGTATAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTA
TCTTCAAATGAACACCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCAAGAGCCCTATCAACTGGGAACCCCT
TCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGCCAAAACAACAGCCCCATCTGTCTATCCACTG
GCCCCTG
The amino acid sequence SEQ ID NO.2 of light chain (Kappa) are as follows：
AAGCATCCTCTCTTCTAGCTCTCAGAGATGGAGACAGACACACTCCTGCTATGGGTGCTGCTGCTCTGG
GTTCCAGGTTCCACTGGTGACATTGTGCTGACACAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCAC
CATCTCATGCAGGGCCAGCCAAAGTGTCAGTACATCTAGCTATAGTTATATGCACTGGTACCAACAGAAACCAGGAC
AGCCACCCAAACTCCTCGTCAGGTATGCATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCT
GGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATACTGCAACATATTACTGTCAGCACAGTTGGGA
GATTCCTCCCACGTTCGGCTCGGGGACAAAGTTGGATATAAAACGGGCTGATGCTGCACCAACTGTATCC
Preferably, the L7D8 monoclonal antibody specificities combination XI collagen types.
Preferably, the XI collagen types are natural XI collagen types.
Preferably, the L7D8 monoclonal antibodies are mouse antibodies.
The L7D8 monoclonal antibodies are applied to detection XI collagen types, can specifically bind XI Collagen Type VI eggs
In vain, the phenomenon that avoiding false positive occurs, and specificity is high.
The detection method that L7D8 monoclonal antibodies are applied to detection XI collagen types be it is conventional, such as by ELISA or
Western blot methods detect.
Compared with prior art, beneficial effects of the present invention are as follows：
The L7D8 monoclonal antibodies of the present invention are the antibody for having specificity for XI collagen types, can specifically be tied
XI collagen types are closed, so as to be used to detect XI collagen types, specificity is high.
The L7D8 monoclonal antibodies of the present invention can pass through immuning tissue in conjunction with natural XI collagen types
The methods of, ELISA and WB remove the natural XI collagen types of (histotomy, urine, blood) in detection biological sample.
Description of the drawings
Fig. 1 is that L7D8 monoclonal antibodies and the combination situation of natural or denaturation rCII, rCXI, bCXI are shown in embodiment 2
It is intended to；
Fig. 2 is the schematic diagram that L7D8 monoclonal antibodies are combined with cartilaginous tissue in vivo or in vitro in embodiment 3；
Wherein, A is the schematic diagram that L7D8 monoclonal antibodies are combined with cartilaginous tissue in vivo, and B is L7D8 monoclonal antibodies
The positive staining of the schematic diagram combined in vitro with cartilaginous tissue, cartilage surface is indicated with white arrow；
Fig. 3 is the serum antibody response schematic diagram that mouse is immunized in CII in embodiment 4；
Fig. 4 is the serum antibody response schematic diagram that mouse is immunized in CXI in embodiment 4.
Specific implementation mode
With reference to embodiment, the invention will be further described, but it should be recognized that embodiment is not to this hair
Bright claimed range is construed as limiting.
Embodiment 1：The acquisition of L7D8 monoclonal antibodies
L7D8 monoclonal antibodies are as follows made from the B cell hybridoma technology based on PEG methods：
(1) 100 μ g XI collagen types (CXI) and isometric CFA are mixed into emulsion, the 0th day, in 8-10 week old
The root intracutaneous injection of male DBA/1J mouse tails is immunized.
It takes a blood sample within (2) the 21st days, with the CXI antibody in ELISA method detection Mice Body.The high mouse of antibody titer is the 21st
It receives booster immunization, i.e. 50 μ g CXI and isometric IFA is mixed into emulsion, and intracutaneous injection is carried out in mouse tail root.Add
Lymph node is taken to do cell fusion after being immunized three days by force.
(3) high pressure 10g PEG-1500 prepare 40%PEG solution while hot with the DMEM culture mediums without any addition, are added
Two drop NaHCO3 adjust pH to 7.4 or so.
(4) the last week recovery NSO-bcl2 myeloma cell lines are carried, it is ensured that cell state is in good health.Cell is blown down, weight
It is suspended from complete mediums of the 20ml containing 10%FCS, carries out cell count.
(5) mouse lymph nodes and thymus gland are taken under aseptic conditions, are fully ground respectively, and it is extra to be removed with 75 μm of nylon leaching nets
Adipose tissue and other impurities, lymphocyte and thymocyte is resuspended with complete mediums of the 20ml containing 10%FCS, respectively into
Row cell count.
(6) according to 1:2 ratio mixing NSO-bcl2 myeloma cell and lymphocyte, after 37 DEG C of water-bath half an hour,
1000rpm is centrifuged 5 minutes, and cell clean twice with the DMEM culture mediums without any addition, centrifugation, with finger bullet cell precipitation,
Cell mass is set to become slightly loose.
(7) according to 3 × 108Cell mixing adds the ratio of 1.5ml PEG solution, and it is suitable to be slowly added into cell mixing
PEG amounts.This process must carry out in 37 DEG C of water-baths, general 1 minute plus 1ml PEG solution, then in front in three minutes plus
The DMEM for entering 3ml preheatings, is finally slowly added to remaining 36ml DMEM, pipe is gently shaken in liquid feeding body.
(8) 1000rpm is centrifuged 5 minutes, discards supernatant liquid, and fused cell is resuspended with the complete medium containing 10%FCS.It takes
Sterile 96 well culture plate calculates 96 required orifice plate quantity according to total cell number, per hole kind 1 × 105A fused cell and 0.5 ×
105Thymocyte, totally 100 μ l.96 well culture plates are put into 37 DEG C, 5%CO2 cell incubators are cultivated.
After (9) 24 hours, 2 × HAT solution is prepared with the complete medium containing 10%FCS, adds 100 per hole into 96 orifice plates
μl.Cell incubator is put back to, culture 10-14 days is continued.
(10) after cultivating 10 days, 96 orifice plates are taken out and have seen whether cell clone generation, and prevent clone long too much or
Culture medium turns yellow.General 14th day, cell conditioned medium is taken, the generation of specific antibody is detected with ELISA, ELISA specific steps are shown in
Embodiment of the method 2, labelled antibody detection is positive and there are the holes of cell clone, and hole inner cell is taken to be subcloned.
(11) as needed do the hole being subcloned number, prepare 96 well culture plates of sufficient amount.Per hole in 96 orifice plates
The 10%FCS complete mediums that 100 μ l contain 1 × HT are added.Constantly piping and druming needs to do the cell hole being subcloned, and cell is blown and beaten
Get off and be transferred in the holes A1 of new 96 orifice plate, carries out 5 times of doubling dilutions down from A to H, then arranged from the 1st to the 12nd with the volley of rifle fire
Row, which are turned right, carries out 2 times of doubling dilutions.The 10%FCS complete mediums that 100 μ l contain 1 × HT are added into per hole again, and put back to
Cell incubator is cultivated 10-14 days.
(12) after being subcloned 10-14 days, the antibody expression situation of cell is detected with ELISA method, selects both high efficient expressions
Antibody and only there are one the holes of cell clone, takes hole inner cell to carry out secondary subclone.Entire hybridoma building process must
5-6 subclone must be repeated, until the cell strain for obtaining stability and high efficiency expression antibody, as long as having the hole of cell, antibody
Expression is the positive, and cell is more, and antibody expression amount is bigger.Notice that the 2nd later subclone no longer needs addition HT molten
Liquid, and since cell state is more good, proliferation is rapid, and the subsequent subclone time may foreshorten to 10 days or even shorter,
It should often check cell state.
(13) after the hybridoma for obtaining stability and high efficiency expression antibody, rallentando expand cell culture from 96 orifice plates, use
FCS freeze-stored cells containing 10%DMSO.
(14) serum in cell culture medium is slowly transformed into from 10%FCS in the FBS of 10% low IgG, gradually from
10%FBS reduces serum content to 8%, 6%, finally in 4%FBS and carrying out large amplification and production antibody.Culture is about
After 3-4 weeks, cell conditioned medium is collected, 0.02-0.05% Sodium azides are added in the filter paper filtration cell relic for being first 1F with aperture,
Finally sterile suction filtration, 4 DEG C of preservation supernatants are carried out with 0.2 μm of filter.
(15) it usesPurifier system monoclonal antibody purifications, with PBS dialysis three times after, 0.2 μm of filter without
Bacterium is filtered.
(16) endotoxin content in Lonza endotoxin detection kits detection antibody is used, when more than 1EU/mg concentration, is used
Pierce removes endotoxin filler antibody purification solution.Antibody is ensured without after endotoxin, and concentrated antibody to 15mg/ml or so is surveyed
Measure actual concentrations, 4 DEG C of preservations.Or the method with freeze-drying, dry powder is made in antibody, it can be in -20 DEG C of long-term preservations.
Antibody obtained above is L7D8 monoclonal antibodies, which includes heavy chain and light chain, wherein heavy chain is by amino
Acid sequence SEQ ID NO.1 are constituted, and light chain is made of amino acid sequence SEQ ID NO.2.L7D8 monoclonal antibodies can combine
Natural XI collagen types can remove (tissue in detection biological sample by the methods of immunohistochemistry, ELISA and WB
Slice, urine, blood) natural XI collagen types.
The amino acid sequence SEQ ID NO.1 of heavy chain (IgG) are as follows：
TATGAACCTAGCCCTGATTTCCCCAGCCTTCAGTTCCCAGATTCAGTGATCAGCCTTGAACACAGACCT
GTCACCATGAAGTTGTGGCTGAACTGGATTTTCCTTGTAACACTTTTAAATGGTATCCAGTGTGAGGTGAAACTGGT
GGAGTCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTCACTG
ATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGAAAGGCACCTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAAA
GGTTACACAACAGAGTATAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTA
TCTTCAAATGAACACCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCAAGAGCCCTATCAACTGGGAACCCCT
TCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGCCAAAACAACAGCCCCATCTGTCTATCCACTG
GCCCCTG
The amino acid sequence SEQ ID NO.2 of light chain (Kappa) are as follows：
AAGCATCCTCTCTTCTAGCTCTCAGAGATGGAGACAGACACACTCCTGCTATGGGTGCTGCTGCTCTGG
GTTCCAGGTTCCACTGGTGACATTGTGCTGACACAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCAC
CATCTCATGCAGGGCCAGCCAAAGTGTCAGTACATCTAGCTATAGTTATATGCACTGGTACCAACAGAAACCAGGAC
AGCCACCCAAACTCCTCGTCAGGTATGCATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCT
GGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATACTGCAACATATTACTGTCAGCACAGTTGGGA
GATTCCTCCCACGTTCGGCTCGGGGACAAAGTTGGATATAAAACGGGCTGATGCTGCACCAACTGTATCC
L7D8 monoclonal antibodies can also be obtained by the method for genetic engineering.
Embodiment 2：The specific detection of L7D8 monoclonal antibodies
We study the specific binding of L7D8 monoclonal antibodies and antigen using ELISA method, are as follows：
(1) with the natural of 5 μ g/ml or denaturation rCXI, rCII, bCXI, 96 hole elisa plates is coated in, per 50 μ l of hole, use film
After sealing, 4 DEG C overnight.
(2) elisa plate is taken out, after being placed at room temperature for one hour, with PBST board-washings 3 times.It is closed again with 3% skimmed milk power
Elisa plate, per 100 μ l of hole, room temperature is closed 2 hours.
(3) after PBST board-washings 3 times, the L7D8 monoclonal antibodies of the purifying of 50 μ l, 1 μ g/ml are added in A rows, or 50 μ are added
l1:1000 diluted mice serum samples, from A to G, row carries out 5 times of doubling dilutions down, retains H rows as blank control, room
Temperature is incubated 2 hours.
(4) after PBST board-washings 3 times, it is added 1:4000 diluted sheep anti mouse Kappa chains are coupled horseradish peroxidase secondary antibody,
Per 50 μ l of hole, it is incubated at room temperature 1 hour.
(5) after PBST washes 4 times, 50 μ l ABTS solution are added per hole, visual color reaction reaches suitable color
When concentration, the sequencing of developing solution is added according to every block of plate, is detected successively under 405nm wavelength.
ELISA testing results are shown：L7D8 monoclonal antibodies can combine natural rCII, rCXI with stronger affinity
And bCXI, but can not be combined with their albuminate, as shown in Figure 1.
Embodiment 3：L7D8 monoclonal antibodies are in vivo or in vitro to the combination situation of cartilage
Antibody can be that can combine autologous tissue in vivo and in vitro to the premise that body has an impact, and L7D8 antibody is in ELISA realities
Test it is middle can collagen combine, in order to detect it in vivo and in vitro combine cartilaginous tissue ability, we with immunohistochemistry technology come
It is studied.
1, newborn, adult mice vitro tissue dyeing
(1) the freezing claw histotomy that 3 age in days newborn mices are injected without antibody, it is dry from room temperature after -20 DEG C of refrigerators taking-ups
It dry 5 minutes, is cleaned 3 times with the PBST containing 0.1%Tween20,3 minutes every time, fixes 5 minutes with acetone on ice, PBST
Cleaning 3 times, every time 3 minutes.It is denoted as slice A.
(2) according to the collagen-induced arthritis step of standard.Joint is induced with 8-10 week old adult DBA/1J mouse
After inflammation, mouse rear solid end is taken to make paraffin section.Slice carries out antigen retrieval with Proteinase K method, is denoted as slice B.
(3) all slices use 3%H successively2O2Closing 10 minutes, 5%BSA+2% rat blood serums are closed 30 minutes, and chain is affine
Element closing 15 minutes, biotin is closed 15 minutes, and all confining liquids are prepared with PBST, is cleaned 3 times with PBST between closing step,
3 minutes every time.
(4) PBS diluted 5 μ g/ml biotinylated antibody M2139, L7D8 or PBS are used, is added in slice A and B, room temperature is incubated
It educates 40 minutes, is cleaned 3 times, every time 3 minutes with PBST.
(5) PBST 1 is used:2000 diluted Avidins are coupled horseradish peroxidase solution, are added in all slices, room temperature
It is incubated 30 minutes, PBST is cleaned 3 times, every time 3 minutes.
(6) it uses diaminobenzidine kit and ultra-pure water to prepare developing solution, develops the color 3 minutes.Visually observe staining conditions,
It is cleaned 1 time with PBS in time, slow list distillation moves bubble and washes 5 minutes, color development stopping.Notice that recycling preserves hypertoxic benzidine
Amine.
(7) HTX impregnates 90 seconds, and slow list distillation is moved bubble and washed 5 minutes, test under microscope staining conditions, if dyeing
It is rinsed disappearance, needs to be developed the color again.
(8) 95% ethyl alcohol impregnate 1 minute, 99% ethyl alcohol 1 minute.
(9) xylene soak twice, 5 minutes every time.
(10) with water-soluble mountant mounting, ambient temperature overnight drying, preservation of taking pictures.
2, newborn mice in-vivo tissue dyes
100 μ g biotinylated M2139, L7D8 or 100 μ l are injected intraperitoneally in the BQ.Cia9i newborn mices of (1) 2 age in days
PBS, every group of 2-3 mouse.When injecting mouse, it should be noted that from the center position inserting needle down close to chest, avoid internal organs, carefully
It is inserted into abdominal cavity and is simultaneously pushed into antibody-solutions, notice after pulling out needle that whether there is or not leakage situations.After antibody is injected 24 hours, mouse rear solid end is taken to make
Freezing microtome section.
(3) slice is after -20 DEG C of refrigerators take out, drying at room temperature 5 minutes, is fixed after five minutes, is used with 4% formalin
PBST is cleaned 3 times.
(4) step (3) is closed during all slices use 1.
(5) step (5) carries out Avidin coupling horseradish peroxidase solution incubation during all slices use 1
(6) step (6) carries out diaminobenzidine method during all slices use 1, develops the color 8-9 minutes.
(7) step (7,8,9,10) subsequently dye, is dehydrated, transparent and mounting during all slices use 1.
3, adult mice in-vivo tissue dyes
(1) 6 week old BQ.Cia9i mouse are injected intravenously the biotinylated M2139 of 1mg, L7D8 antibody or 200 μ l
PBS.Mouse nose cartilaginous tissue is taken after 24 hours, makes the freezing microtome section of crosscutting 7 μ m thick of nose.
(2) slice is taken out from -20 DEG C of refrigerators, fixes 10 minutes with acetone on ice, drying after ten minutes, is put into PBS
It is middle to impregnate 15 minutes.
(3) it after sample is closed 45 minutes with the PBST containing 2%BSA, is cleaned 3 times, every time 3 minutes with PBST.
(4) PBST 1 is used:300 dilution streptavidin coupling Alexa Fluor 568, are incubated at room temperature 60 minutes, use PBST
Cleaning 3 times, every time 3 minutes.
(5) with the VECTASHIELD mountant mountings containing DAPI, drying at room temperature is aobvious with Confocal after 15-30 minutes
Micro mirror is taken pictures preservation.Sample after mounting can be kept in dark place 1 month or so in 4 DEG C of refrigerators.
Can in order to examine L7D8 monoclonal antibodies combine newborn and adult mice cartilaginous tissue in vivo, we be right
M2319 and L7D8 antibody carry out biotinylation, and by biotinylated antibody be injected into 2 ages in days new life or 6 week old at
In year BQ.Cia9i Mice Bodies.Wherein, biotinylated CII antibody M2139 is used as positive control antibodies in this experiment.It is anti-
After body is injected 24 hours, the nasal tissue of the claw and adult mice that take newborn mice makes freezing microtome section, with immuning tissue
Technology analyzes antibody and the Binding in vivo ability of cartilage is (right without decalcification since adult mice bone is harder
The technical difficulty that foot tissue carries out freezing microtome section is very big, hardly results in complete histotomy, it is soft then to change to take mouse nose
Bone tissue replacement).In newborn mice cartilaginous tissue, positive control M2139 antibody can be incorporated into articular cartilage surface, and
L7D8 antibody is without very specific positive staining (such as Fig. 2A, shown on).In adult tissue slice dyeing, positive control
M2139 antibody can be incorporated into articular cartilage zones, and association reaction can not then occur with adult cartilaginous tissue for L7D8 antibody (as schemed
2A, lower shown).
Combine the analysis of cartilage ability in vitro for antibody, we take the newborn mice of no antibody processing, with or without pass
The scorching adult mice claw tissue invaded of section carries out total incubation with biotinylated M2139 or L7D8 antibody, then detects antibody
And the combination situation of cartilaginous tissue.Either newborn mice tissue, or with or without the adult mice joint group that arthritis is invaded
It knits, L7D8 antibody can not react (as shown in Figure 2 B) with these arbitrary tissues.
Embodiment 4：Change of serum C II and the CXI antibody response of arthritis mouse model
In order to probe into the mouse arthritis of CII and CXI inductions, serum antibody and the potential of Arthritis development contact, I
With CII or CXI to express arthritis tumor susceptibility gene AqDBA/1J male mices be immunized, and the 21st He after immune
Take blood sample within 70 days.
It is observed that mouse immune CII produces serious arthritis, and incidence is very high；And immune small of CXI
Mouse incidence is low, and the state of an illness is very light (as shown in table 1).It is existed simultaneously in CII and CXI for the serum antibody response of CII and CXI
In the entire course of disease of immune mouse, and as the course of disease promotes, serum antibody response constantly enhances.In Initial stage of immunization, CII is immune
It is (the 21st day strong for mouse immune the antibody response ratio CXI of CXI in Mice Body：P value=0.0009), but the immune later stage, CII
There is no difference (the 70th day with the CX change of serum C XI antibody responses that mouse is immunized：P value=0.1393) (as shown in Figure 3 and Figure 4).
In mouse immune CII, correlativity is not present with disease severity in change of serum C II and CXI antibody response.
The arthritic rate of mouse and maximum arthritis score is immunized in table 1CII and CXI
CII:Type Ⅱ collagen；CXI:XI collagen types；CFA：Complete Freund's adjuvant；IFA：Incomplete Freund's adjuvant
Fig. 3 and Fig. 4 is the serum antibody response schematic diagram that mouse is immunized in CII and CXI.DBA/1J immune CII and CXI is small
Mouse, took a blood sample at the 21st and 70 day, and serum antibody is detected with enzyme-linked immunosorbent assay (ELISA).Non-immune mice serum is made
For negative control.Mann-Whitney U are examined be used for group between the statistical analysis compared of antibody response.
It is provided for the embodiments of the invention technical solution above to be described in detail, specific case used herein
The principle and embodiment of the embodiment of the present invention are expounded, the explanation of above example is only applicable to help to understand this
The principle of inventive embodiments；Meanwhile for those of ordinary skill in the art, embodiment according to the present invention, in specific embodiment party
There will be changes in formula and application range, in conclusion the content of the present specification should not be construed as limiting the invention.
Sequence table
<110>Dongguan optrode bio tech ltd
<120>L7D8 monoclonal antibodies and its application
<130> 1
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 538
<212> PRT
<213> Mus musculus
<400> 1
Thr Ala Thr Gly Ala Ala Cys Cys Thr Ala Gly Cys Cys Cys Thr Gly
1 5 10 15
Ala Thr Thr Thr Cys Cys Cys Cys Ala Gly Cys Cys Thr Thr Cys Ala
20 25 30
Gly Thr Thr Cys Cys Cys Ala Gly Ala Thr Thr Cys Ala Gly Thr Gly
35 40 45
Ala Thr Cys Ala Gly Cys Cys Thr Thr Gly Ala Ala Cys Ala Cys Ala
50 55 60
Gly Ala Cys Cys Thr Gly Thr Cys Ala Cys Cys Ala Thr Gly Ala Ala
65 70 75 80
Gly Thr Thr Gly Thr Gly Gly Cys Thr Gly Ala Ala Cys Thr Gly Gly
85 90 95
Ala Thr Thr Thr Thr Cys Cys Thr Thr Gly Thr Ala Ala Cys Ala Cys
100 105 110
Thr Thr Thr Thr Ala Ala Ala Thr Gly Gly Thr Ala Thr Cys Cys Ala
115 120 125
Gly Thr Gly Thr Gly Ala Gly Gly Thr Gly Ala Ala Ala Cys Thr Gly
130 135 140
Gly Thr Gly Gly Ala Gly Thr Cys Thr Gly Gly Ala Gly Gly Ala Gly
145 150 155 160
Gly Cys Thr Thr Gly Gly Thr Ala Cys Ala Gly Cys Cys Thr Gly Gly
165 170 175
Gly Gly Gly Thr Thr Cys Thr Cys Thr Gly Ala Gly Ala Cys Thr Cys
180 185 190
Thr Cys Cys Thr Gly Thr Gly Cys Ala Ala Cys Thr Thr Cys Thr Gly
195 200 205
Gly Gly Thr Thr Cys Ala Cys Cys Thr Thr Cys Ala Cys Thr Gly Ala
210 215 220
Thr Thr Ala Cys Thr Ala Cys Ala Thr Gly Ala Gly Cys Thr Gly Gly
225 230 235 240
Gly Thr Cys Cys Gly Cys Cys Ala Gly Cys Cys Thr Cys Cys Ala Gly
245 250 255
Gly Ala Ala Ala Gly Gly Cys Ala Cys Cys Thr Gly Ala Gly Thr Gly
260 265 270
Gly Thr Thr Gly Gly Gly Thr Thr Thr Thr Ala Thr Thr Ala Gly Ala
275 280 285
Ala Ala Cys Ala Ala Ala Gly Cys Thr Ala Ala Ala Gly Gly Thr Thr
290 295 300
Ala Cys Ala Cys Ala Ala Cys Ala Gly Ala Gly Thr Ala Thr Ala Gly
305 310 315 320
Thr Gly Cys Ala Thr Cys Thr Gly Thr Gly Ala Ala Gly Gly Gly Thr
325 330 335
Cys Gly Gly Thr Thr Cys Ala Cys Cys Ala Thr Cys Thr Cys Cys Ala
340 345 350
Gly Ala Gly Ala Thr Ala Ala Thr Thr Cys Cys Cys Ala Ala Ala Ala
355 360 365
Cys Ala Thr Cys Cys Thr Cys Thr Ala Thr Cys Thr Thr Cys Ala Ala
370 375 380
Ala Thr Gly Ala Ala Cys Ala Cys Cys Cys Thr Gly Ala Gly Ala Gly
385 390 395 400
Cys Thr Gly Ala Gly Gly Ala Cys Ala Gly Thr Gly Cys Cys Ala Cys
405 410 415
Thr Thr Ala Thr Thr Ala Cys Thr Gly Thr Gly Cys Ala Ala Gly Ala
420 425 430
Gly Cys Cys Cys Thr Ala Thr Cys Ala Ala Cys Thr Gly Gly Gly Ala
435 440 445
Ala Cys Cys Cys Cys Thr Thr Cys Thr Thr Thr Gly Ala Cys Thr Ala
450 455 460
Cys Thr Gly Gly Gly Gly Cys Cys Ala Ala Gly Gly Cys Ala Cys Cys
465 470 475 480
Ala Cys Thr Cys Thr Cys Ala Cys Ala Gly Thr Cys Thr Cys Cys Thr
485 490 495
Cys Ala Gly Cys Cys Ala Ala Ala Ala Cys Ala Ala Cys Ala Gly Cys
500 505 510
Cys Cys Cys Ala Thr Cys Thr Gly Thr Cys Thr Ala Thr Cys Cys Ala
515 520 525
Cys Thr Gly Gly Cys Cys Cys Cys Thr Gly
530 535
<210> 2
<211> 447
<212> PRT
<213> Mus musculus
<400> 2
Ala Ala Gly Cys Ala Thr Cys Cys Thr Cys Thr Cys Thr Thr Cys Thr
1 5 10 15
Ala Gly Cys Thr Cys Thr Cys Ala Gly Ala Gly Ala Thr Gly Gly Ala
20 25 30
Gly Ala Cys Ala Gly Ala Cys Ala Cys Ala Cys Thr Cys Cys Thr Gly
35 40 45
Cys Thr Ala Thr Gly Gly Gly Thr Gly Cys Thr Gly Cys Thr Gly Cys
50 55 60
Thr Cys Thr Gly Gly Gly Thr Thr Cys Cys Ala Gly Gly Thr Thr Cys
65 70 75 80
Cys Ala Cys Thr Gly Gly Thr Gly Ala Cys Ala Thr Thr Gly Thr Gly
85 90 95
Cys Thr Gly Ala Cys Ala Cys Ala Gly Thr Cys Thr Cys Cys Thr Gly
100 105 110
Cys Thr Thr Cys Cys Thr Thr Ala Gly Cys Thr Gly Thr Ala Thr Cys
115 120 125
Thr Cys Thr Gly Gly Gly Gly Cys Ala Gly Ala Gly Gly Gly Cys Cys
130 135 140
Ala Cys Cys Ala Thr Cys Thr Cys Ala Thr Gly Cys Ala Gly Gly Gly
145 150 155 160
Cys Cys Ala Gly Cys Cys Ala Ala Ala Gly Thr Gly Thr Cys Ala Gly
165 170 175
Thr Ala Cys Ala Thr Cys Thr Ala Gly Cys Thr Ala Thr Ala Gly Thr
180 185 190
Thr Ala Thr Ala Thr Gly Cys Ala Cys Thr Gly Gly Thr Ala Cys Cys
195 200 205
Ala Ala Cys Ala Gly Ala Ala Ala Cys Cys Ala Gly Gly Ala Cys Ala
210 215 220
Gly Cys Cys Ala Cys Cys Cys Ala Ala Ala Cys Thr Cys Cys Thr Cys
225 230 235 240
Gly Thr Cys Ala Gly Gly Thr Ala Thr Gly Cys Ala Thr Cys Cys Ala
245 250 255
Ala Cys Cys Thr Ala Gly Ala Ala Thr Cys Thr Gly Gly Gly Gly Thr
260 265 270
Cys Cys Cys Thr Gly Cys Cys Ala Gly Gly Thr Thr Cys Ala Gly Thr
275 280 285
Gly Gly Cys Ala Gly Thr Gly Gly Gly Thr Cys Thr Gly Gly Gly Ala
290 295 300
Cys Ala Gly Ala Cys Thr Thr Cys Ala Cys Cys Cys Thr Cys Ala Ala
305 310 315 320
Cys Ala Thr Cys Cys Ala Thr Cys Cys Thr Gly Thr Gly Gly Ala Gly
325 330 335
Gly Ala Gly Gly Ala Gly Gly Ala Thr Ala Cys Thr Gly Cys Ala Ala
340 345 350
Cys Ala Thr Ala Thr Thr Ala Cys Thr Gly Thr Cys Ala Gly Cys Ala
355 360 365
Cys Ala Gly Thr Thr Gly Gly Gly Ala Gly Ala Thr Thr Cys Cys Thr
370 375 380
Cys Cys Cys Ala Cys Gly Thr Thr Cys Gly Gly Cys Thr Cys Gly Gly
385 390 395 400
Gly Gly Ala Cys Ala Ala Ala Gly Thr Thr Gly Gly Ala Thr Ala Thr
405 410 415
Ala Ala Ala Ala Cys Gly Gly Gly Cys Thr Gly Ala Thr Gly Cys Thr
420 425 430
Gly Cys Ala Cys Cys Ala Ala Cys Thr Gly Thr Ala Thr Cys Cys
435 440 445
Claims (5)
1. a kind of L7D8 monoclonal antibodies, which is characterized in that the antibody includes heavy chain and light chain, and the heavy chain is by amino acid sequence
It arranges SEQ ID NO.1 to constitute, the light chain is made of amino acid sequence SEQ ID NO.2.
2. a kind of L7D8 monoclonal antibodies according to claim 1, which is characterized in that the monoclonal antibody specificity knot
Close XI collagen types.
3. a kind of L7D8 monoclonal antibodies according to claim 1, which is characterized in that the XI collagen types are natural
XI collagen types.
4. a kind of L7D8 monoclonal antibodies according to claim 1, which is characterized in that the antibody is mouse antibodies.
5. application of any one of Claims 1 to 4 antibody in detecting XI collagen types.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810291609.7A CN108484763A (en) | 2018-04-03 | 2018-04-03 | L7D8 monoclonal antibodies and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810291609.7A CN108484763A (en) | 2018-04-03 | 2018-04-03 | L7D8 monoclonal antibodies and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108484763A true CN108484763A (en) | 2018-09-04 |
Family
ID=63317847
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810291609.7A Pending CN108484763A (en) | 2018-04-03 | 2018-04-03 | L7D8 monoclonal antibodies and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108484763A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1207046A (en) * | 1995-11-13 | 1999-02-03 | 菲布洛根有限公司 | Type IX collagen and chimeras |
| CN1345331A (en) * | 1999-01-06 | 2002-04-17 | 南加利福尼亚大学 | Method and composition for angiogenesis inhibition |
| EP2151505A1 (en) * | 2008-08-05 | 2010-02-10 | Institut Gustave Roussy | Method for determining a predisposition to basal cell carcinoma and for screening treatments thereof |
| CN105924522A (en) * | 2016-04-22 | 2016-09-07 | 四川耀康生物科技有限公司 | Type VI collagen antibody, and preparation method and application thereof |
-
2018
- 2018-04-03 CN CN201810291609.7A patent/CN108484763A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1207046A (en) * | 1995-11-13 | 1999-02-03 | 菲布洛根有限公司 | Type IX collagen and chimeras |
| CN1345331A (en) * | 1999-01-06 | 2002-04-17 | 南加利福尼亚大学 | Method and composition for angiogenesis inhibition |
| EP2151505A1 (en) * | 2008-08-05 | 2010-02-10 | Institut Gustave Roussy | Method for determining a predisposition to basal cell carcinoma and for screening treatments thereof |
| CN105924522A (en) * | 2016-04-22 | 2016-09-07 | 四川耀康生物科技有限公司 | Type VI collagen antibody, and preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 姚敏捷等: ""抗人Ⅳ型胶原蛋白单克隆抗体制备和鉴定"", 《中华肝脏病杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2194782T5 (en) | Improved procedure for the detection of acid-resistant bacteria of the genus Helicobacter in feces | |
| Beutner | Immunofluorescent staining: the fluorescent antibody method | |
| CN102245767B (en) | Immunoassay method for human CXCL1 protein | |
| Heddle et al. | Dog immunoglobulins. I. immunochemical characterization of dog serum, parotid saliva, colostrum, milk and small bowel fluid. | |
| CN104792997B (en) | A kind of HCT's original immunity detection reagent and preparation method and application | |
| Crandall et al. | Trichinella spiralis: immunologic response to infection in mice | |
| CN108623682A (en) | For the antibody of TAU | |
| CN106574258A (en) | Anti-transthyretin humanized antibody | |
| CN109387627A (en) | A kind of Reagent Protocol of screening for cancer and early diagnosis based on placenta sample chondroitin sulfate A (CSA) | |
| KR101499302B1 (en) | Methods, devices, kits and compositions for detecting roundworm | |
| CN101362800A (en) | Test strip for rapid detection of brucella | |
| Sinha et al. | Improved fluorescent smear technique and its application in detecting virus antigens in an insect vector | |
| CN104744580B (en) | A kind of TgVP1 extracellular regions antigen polypeptide, the polyclonal antibody of anti-TgVP1 and its application | |
| DE69733957T2 (en) | PROCEDURE FOR DETECTING THE PRESENCE OF BRAIN SPECIFIC PROTEIN S-100 BETA | |
| CN108484763A (en) | L7D8 monoclonal antibodies and its application | |
| CN109142738A (en) | Marker and its application of the ECM1 as Serologic detection liver fibrosis | |
| CN104459127B (en) | Bio-carrier and its application in the detection | |
| Søltoft et al. | Immunoglobulin-containing cells in the small intestine during acute enteritis | |
| CN108659127A (en) | L10D9 antibody and its application | |
| CN113817054A (en) | Mouse monoclonal antibody 5B11 specifically binding porcine rotavirus VP6 protein and application thereof | |
| CN104130328B (en) | Monoclonal antibody of anti-Eriocheir sinensis granular hemocyte cell membrane 30.9kDa albumen and preparation method thereof | |
| CN107043752A (en) | Hybridoma cell strain and the anti-CRH antibody N D19 based on hybridoma cell strain and its application of context of detection | |
| CN104897834A (en) | Method for detecting toxoplasma acute infection and target protein thereof | |
| Haramoto et al. | Ultrastructural Localization of the Three Major Basement Membrane Components-Type IV Collagen, Heparan Sulfate Proteoglycan and Laminin–in Human Membranous Glomerulonephritis | |
| Miranda et al. | Searching for specific binding sites of the secretory glycoproteins of the subcommissural organ |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Richard Homeidu Inventor before: Tong Dongmei |
|
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180904 |