CN109142738A - Marker and its application of the ECM1 as Serologic detection liver fibrosis - Google Patents
Marker and its application of the ECM1 as Serologic detection liver fibrosis Download PDFInfo
- Publication number
- CN109142738A CN109142738A CN201710458079.6A CN201710458079A CN109142738A CN 109142738 A CN109142738 A CN 109142738A CN 201710458079 A CN201710458079 A CN 201710458079A CN 109142738 A CN109142738 A CN 109142738A
- Authority
- CN
- China
- Prior art keywords
- ecm1
- albumen
- liver fibrosis
- antibody
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/001—Assays involving biological materials from specific organisms or of a specific nature by chemical synthesis
- G01N2333/003—Assays involving biological materials from specific organisms or of a specific nature by chemical synthesis of Peptide-nucleic acids (PNAs)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/08—Hepato-biliairy disorders other than hepatitis
- G01N2800/085—Liver diseases, e.g. portal hypertension, fibrosis, cirrhosis, bilirubin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Peptides Or Proteins (AREA)
Abstract
Marker and its application the present invention relates to a kind of ECM1 as Serologic detection liver fibrosis.Specifically, the present invention provides extracellular CaM (ECM1 albumen) or its specific antibody (a) be used to prepare detection liver fibrosis diagnostic reagent or kit and/or (b) be used to prepare blood plasma or serum detection liver fibrosis diagnostic reagent or kit in purposes.The present invention also provides corresponding detection kits.
Description
Technical field
The present invention relates to diagnostic fields.More particularly it relates to a kind of blood plasma that can be used for detecting liver fibrosis or
Serum markers and application thereof.
Background technique
For liver fiber due to being reversible, cirrhosis is irreversible process, therefore safety, noninvasive early diagnosis are in liver fibre
Play the role of in dimensionization therapeutic process particularly significant.
The existing diagnosis to liver fibrosis is broadly divided into several: 1, Liver biopsy pathological examination is still current
The goldstandard of diagnosing liver fibrosis and cirrhosis, but there is death, parts to reflect the disadvantages of whole.2,
The Non-invasive detections such as Fibroscan.Fibroscan reflects liver parenchyma hardness by measurement liver instantaneous elasticity map, passes through survey
Liver hardness is measured to judge the degree of hepatic fibrosis-renal tubular ectasia syndrome, and liver fibrosis is accurately classified.Fibroscan be frequently necessary to
Other index joint-detections, and due to being influenced by patient's ascites and fat deformation, lead to testing result accuracy slightly
It is weak.3, Serologic detection mainly includes pre-collagen type Ⅲ amino terminal peptide, Serum Laminin, serum hyalomitome
A series of indexs such as acid, IV collagen of serum, matrix metalloproteinase, there is also specificity and accuracys for existing serological index
Not high disadvantage, therefore the outstanding index of liver fibrosis detection can not be become.Reason following points: 1) most of direct blood
Clear index of learning is response matrix metabolic rate, and is closely related with inflammatory reaction, when there are cannot be special when inflammation for body
Opposite sex detection degree of hepatic fibrosis.2) most of there is no liver specificity.3) it is largely influenced by organism metabolism.In order to
The accuracy rate of serological index is improved, last decade domestic and foreign scholars establish diagnostic model much based on many indexes
(Fibrometer, APRI, Hepascore, FibroTest etc.) improves the accuracy of serological index.In view of existing blood
More than clear index has the shortcomings that, therefore the serology reference substance for finding a high specific is combined with existing detection method
Or it is used alone and is had a very important significance in liver fibrosis detection process to improve the detection accuracy of liver fibrosis.
Therefore, there is an urgent need in the art to develop to can be used for detecting or judging the blood plasma or blood serum special mark of liver fibrosis
The accurate Serologic detection kit of the diagnosis of object and liver fibrosis.
Summary of the invention
It is an object of the invention to provide a kind of blood plasma that can be used for detecting or judging liver fibrosis or blood serum special marks
Object.
In the first aspect of the present invention, extracellular CaM (ECM1 albumen) or the use of its specific antibody are provided
On the way, they are used to prepare the diagnostic reagent or kit of detection liver fibrosis by (a)；And/or (b) it is used to prepare blood plasma or serum
Detect the diagnostic reagent or kit of liver fibrosis.
In another preferred example, the ECM1 albumen or the coupling of its specific antibody have or with detectable label.
In another preferred example, the specific antibody is monoclonal antibody.
In another preferred example, the detectable label is selected from the group: chromophore, chemiluminescent groups, fluorogen, same to position
Element or enzyme.
In another preferred example, the diagnostic reagent is monoclonal antibody.
In another preferred example, the detection liver fibrosis is blood plasma or serum detection.
In another preferred example, the blood plasma or serum detection be ELISA method or double antibodies sandwich time resolution be immunized it is glimmering
Light method (TRFIA method).
In the second aspect of the present invention, provide a kind of for detecting the diagnostic kit of liver fibrosis, the reagent
Box contains a container, contains ECM1 albumen or its specific antibody in the container；And label or specification, the label or
Specification indicate the kit for detect or diagnosing liver fibrosis.
In another preferred example, the following contents is indicated in the label or specification:
If (i) the blood plasma ECM1 concentration of test object is lower than 5ug/ml, the probability which occurs liver fibrosis is big
In normal population.
In another preferred example, the ECM1 albumen or the coupling of its specific antibody have or with detectable label.
In another preferred example, the detectable label is selected from the group: chromophore, chemiluminescent groups, fluorogen, same to position
Element or enzyme.
In another preferred example, the specific antibody is monoclonal antibody.
In the third aspect of the present invention, a kind of purposes of extracellular CaM (ECM1 albumen) is provided, it is used as
Blood plasma or the marker of serum detection liver fibrosis.
In the fourth aspect of the present invention, a kind of purposes of the agonist of extracellular CaM (ECM1 albumen) is provided,
It is used to prepare the drug for inhibiting liver fibrosis or is used to prepare the inhibitor for inhibiting liver fibrosis.
In another preferred example, the agonist includes: ECM1 albumen, cRGD or combinations thereof.
It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention
It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist
This no longer tires out one by one states.
Detailed description of the invention
Fig. 1 shows the acquisition of mouse ECM1 gene.M:Marker；1-2:ECM1-pcDNA3.1-Fc.
Fig. 2 shows that mouse ECM1 albumen Western Blot is identified.M:Marker；1: negative control；2: cell conditioned medium.
Fig. 3 shows the Protein G affinitive layer purification of rabbit anteserum.Caption M:Marker；1: the rabbit anteserum of purifying；2:
Unpurified rabbit anteserum.
Fig. 4 shows the Activity determination of purified antibodies.
Fig. 5 shows rabbit anteserum titer determination.
Fig. 6 shows the how anti-determination of protein concentration of rabbit anteserum.
Fig. 7 shows primarily determining for mouse ELISA kit detection range.
Fig. 8 shows the standard curve of mouse ELISA kit.
Fig. 9 shows that mouse samples test format determines.Caption WT: wild-type mice, N=5；HE: hybrid mice, N
=5.
Figure 10 shows that the dilution ratio of mice plasma determines.
Figure 11 shows the contents level of ECM1 in the blood plasma of different type mouse.
Figure 12, which is shown, takes 12 mouse to carry out CCL4Modeling 4 weeks, and mice plasma is collected weekly, it is detected using ECM1
Kit detects the content of the ECM1 in blood plasma.The result shows that with CCL4Modeling is goed deep into, and hepatic fibrosis in mice degree gradually adds
Deep, the ECM1 content in mice plasma gradually decreases.
Specific embodiment
The present inventor after extensive and in-depth study, for the first time it was unexpectedly observed that the content of ECM1 albumen is in liver in blood plasma
It is gradually reduced during fibrosis.Therefore, ECM1 protein content in blood plasma and liver fibrosis occurrence and development degree are utilized
Correlation, blood plasma or serum ECM1 can be used as the marker of detection liver fibrosis.The present invention is completed on this basis.
ECM1 albumen and gene
In the present invention, term " albumen of the present invention ", " ECM1 albumen ", " ECM1 polypeptide " or " extracellular matrix protein
ECM1 " is used interchangeably, and is all referred to mouse cell extracellular matrix protein ECM1 amino acid sequence (GenBank:AAI45382.1)
Albumen or polypeptide.They include the extracellular matrix protein ECM1 with or without initial methionine.In addition, the term is also
ECM1 and its segment including overall length.ECM1 albumen of the invention signified include its complete amino acid sequence, its secretory protein,
Its mutant and its functionally active segment.
In the present invention, term " ECM1 gene ", " ECM1 polynucleotides " or " extracellular matrix protein gene ECM1 " can
It is used interchangeably, all refers to the nucleic acid sequence with mouse ECM1 nucleotide sequence (Gene ID:13601).It is to be understood that when compiling
When the identical amino acid of code, the substitution of codon nucleotide is acceptable.It is also to be understood that by nucleotide replace and
When generating conservative amino acid substitution, the transformation of nucleotide is also can be received.
In the case where having obtained the amino acid fragment of ECM1, its nucleic acid sequence of coding can be constructed according to it, and
Specific probe is designed according to nucleotide sequence.Nucleotide full length sequence or its segment can usually use PCR amplification method, recombination
Method or artificial synthesized method obtain.For PCR amplification method, can disclosed ECM1 nucleotide sequence according to the present invention, especially
It is that open reading frame sequence carrys out design primer, and with the commercially available library cDNA or presses conventional method institute well known by persons skilled in the art
The library cDNA of preparation expands as template and obtains related sequence.When sequence is longer, it is often necessary to carry out twice or repeatedly PCR
The segment that each time amplifies, is then stitched together by amplification by proper order again.
Once obtaining related sequence, so that it may obtain related sequence in large quantity with recombination method.This is usually will
It is cloned into carrier, then is transferred to cell, then the isolated related sequence from the host cell after proliferation by conventional method.
In addition, related sequence can be also synthesized with artificial synthesized method, when especially fragment length is shorter.In general, logical
After first synthesizing multiple small fragments, it is then attached the very long segment of available sequence again.
At present, it is already possible to obtain encoding albumen of the present invention (or its segment, derivative) completely by chemical synthesis
DNA sequence dna.Then the DNA sequence dna can be introduced into various existing DNA moleculars (such as carrier) as known in the art and cell.
By the recombinant dna technology of routine, it can be used to express or produce recombination using polynucleotide sequence of the invention
ECM1 polypeptide.In general there are following steps:
(1) with the polynucleotides (or variant) of encoding murine ECM1 polypeptide of the invention, or with containing the polynucleotides
Recombinant expression carrier conversion or suitable host cell of transduceing；
(2) host cell cultivated in suitable culture medium；
(3) it is separated from culture medium or cell, protein purification.
In the present invention, ECM1 polynucleotide sequence be can be plugged into recombinant expression carrier.As long as in short, can be in host
It replicates and stablizes, any plasmid and carrier can be used.One important feature of expression vector is to usually contain replication orgin, open
Mover, marker gene and translation control element.
Method well-known to those having ordinary skill in the art can be used to construct DNA sequences encoding containing ECM1 and suitably transcribe/turn over
Translate the expression vector of control signal.These methods include recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..
The DNA sequence dna can be effectively connected in the appropriate promoter in expression vector, to instruct mRNA to synthesize.Expression vector also wraps
Include the ribosome bind site and transcription terminator of translation initiation.
In addition, expression vector preferably includes one or more selected markers, to provide for selecting conversion
The phenotypic character of host cell, such as the dihyrofolate reductase of eukaryotic culture, neomycin resistance and green fluorescence egg
White (GFP), or tetracycline or amicillin resistance for Escherichia coli.
Carrier comprising above-mentioned appropriate DNA sequence dna and appropriate promoter or control sequence, can be used for converting suitable
When host cell, allow it to expression protein.
Host cell can be prokaryotic cell, such as bacterial cell；Or low eukaryocyte, such as yeast cells；Or it is high
Equal eukaryocytes, such as mammalian cell.Representative example has: Escherichia coli, the bacterial cell of streptomyces；Fungal cell is such as
Yeast；Plant cell；Insect cell；Zooblast etc..
It can be carried out with routine techniques well known to those skilled in the art with recombinant DNA conversion host cell.When host is original
When core biology such as Escherichia coli, the competent cell that can absorb DNA can harvest after exponential phase of growth, use CaCl2Method processing, institute
With the step of it is generally well-known in the art.Another method is using MgCl2.If desired, conversion can also use the side of electroporation
Method carries out.When host is eucaryote, following DNA transfection method can be selected: calcium phosphate precipitation, conventional mechanical methods are such as
Microinjection, electroporation, liposome packaging etc..
The transformant of acquisition can use conventional method culture, express the polypeptide of coded by said gene of the invention.According to used
Host cell, culture medium used in culture can be selected from various conventional mediums.Under conditions of being suitable for host cell growth
It is cultivated.After host cell growth is to cell density appropriate, with suitable method (such as temperature transition or chemical induction)
Cell is further cultured for a period of time by the promoter for inducing selection.
Recombinant polypeptide in the above methods can be expressed in cells, or on the cell membrane, or secreted outside the cell.Such as
Fruit needs, and can be separated by various separation methods and purify the albumen of recombination using its physics, chemical and other characteristics.This
A little methods are well-known to those skilled in the art.The example of these methods includes but is not limited to: conventional renaturation process is used
Protein precipitant handles (salting-out method), centrifugation, permeates broken bacterium, super processing, ultracentrifugation, sieve chromatography (gel filtration), inhales
The combination of attached chromatography, ion-exchange chromatography, high performance liquid chroma- tography (HPLC) and various other liquid chromatography technologies and these methods.
Specific antibody
In the present invention, term " antibody of the present invention " and " specific antibody of anti-ECM1 " are used interchangeably.
The invention also includes the polyclonal antibodies and monoclonal antibody to mouse ECM1 polypeptide with specificity, especially singly
Clonal antibody.Here, " specificity " refers to that antibody can be incorporated into mouse ECM1 gene product or segment.Preferably, referring to those energy
In conjunction with mouse ECM1 gene product or segment but nonrecognition and the antibody for being incorporated into other non related antigen molecules.In the present invention
Antibody includes the molecule that those can combine and inhibit mouse ECM1 albumen, also includes that those have no effect on mouse ECM1 albumen function
The antibody of energy.The invention also includes those can with modification or unmodified form mouse ECM1 gene product in conjunction with antibody.
The present invention not only includes complete monoclonal or polyclonal antibody, but also including with immunocompetent antibody piece
Section, such as Fab ' or (Fab)2Segment；Heavy chain of antibody；Antibody light chain；Genetically engineered Single Chain Fv Molecule A (Ladner et al.,
United States Patent (USP) No.4,946,778)；Or chimeric antibody, such as there is mouse antibody binding specificity but still retain the antibody portion from people
The antibody divided.
Antibody of the invention can be prepared by various technologies known to those skilled in the art.For example, purifying
Mouse ECM1 gene product or its with antigenic segment, animal can be applied to induce the production of polyclonal antibody
It is raw.Similar, it expresses mouse ECM1 albumen or its cell with antigenic segment can be used to immune animal to produce
Antibody.Antibody of the invention is also possible to monoclonal antibody.Such monoclonal antibody can use hybridoma technology prepare (see
Kohler et al.,Nature256；495,1975；Kohler et al.,Eur.J.Immunol.6:511,1976；Kohler etc.
People,Eur.J.Immunol.6:292,1976；Hammerling et al.,In Monoclonal Antibodies and T Cell Hybridomas,Elsevier,N.Y.,1981).Antibody of the invention includes that can block mouse ECM1 protein function
Antibody and the antibody for not influencing mouse ECM1 protein function.All kinds of antibody of the invention can use mouse ECM1 gene product
Segment or functional areas, obtained by common immunological techniques.These segments or functional areas can use recombination method preparation or benefit
It is synthesized with Peptide synthesizer.Antibody in conjunction with the unmodified form of mouse ECM1 gene product can with prokaryotic cell (such as
E.Coli the gene product produced in) generates animal is immunized；In conjunction with posttranslational modification form antibody (as glycosylation or
The albumen or polypeptide of phosphorylation), it can be immunized with the gene product generated in eukaryocyte (such as yeast or insect cell)
Animal and obtain.
The antibody of anti-mouse ECM1 albumen can be used in immunohistochemistry technology, detect sample (especially plasma sample)
In mouse ECM1 albumen.
Detection method
Be present in blood plasma or serum using ECM1, and with this closely related feature of liver fibrosis, the present invention also provides
Detection or the method for judging liver fibrosis, especially Serology test.
In a preference of the invention, the present invention provides a kind of ELISA method for detecting blood plasma ECM1 and time point
Distinguish immunofluorescence technique (TRFIA).
In another preference of the invention, the present invention provide it is a kind of detect serum ECM1 ELISA method and the time
Resolved immuno fluorometric method (TRFIA).
Detection kit
The present invention also provides a kind of kits for detecting liver fibrosis, it contains the immune globulin of anti-ECM1 of the invention
White or immune conjugate or its active fragment.
Experiment is completed in hepatic fibrosis in mice blood plasma of the invention or serological diagnostic kit.
It is lower than 5ug/ml with ECM1 content in the blood plasma diagnostic kit detection blood plasma of hepatic fibrosis in mice of the invention
The occurrence probability of liver fibrosis of mouse obviously increase.
Pharmaceutical composition
The present invention also provides a kind of pharmaceutical compositions, it contains the agonist of above-mentioned ECM1, and can pharmaceutically connect
The carrier received.The pharmaceutical composition can be used for inhibiting liver fibrosis.
ECM1 albumen can be used as the drug for inhibiting liver fibrosis.
In general, these substances can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium,
Middle pH is usually about 5-8, and preferably pH is about 6-8, although pH value can be with the property and illness to be treated for being formulated substance
And it is varied.Prepared pharmaceutical composition can be administered by conventional route, including (but being not limited to): abdomen
In film, intravenous or local administration.
Pharmaceutical composition of the invention can be directly used for inhibiting liver fibrosis.In addition, can also be with other treating liver fibrosis
Agent combination.
The above-mentioned ECM1 agonist of the invention and pharmaceutically may be used that pharmaceutical composition of the invention contains safe and effective amount
The carrier or excipient of receiving.This kind of carrier include (but being not limited to): salt water, buffer, glucose, water, glycerol, ethyl alcohol,
And combinations thereof.Pharmaceutical preparation should match with administration mode.Pharmaceutical composition of the invention can be made into injection form, such as
It is prepared by conventional method with physiological saline or the aqueous solution containing glucose and other adjuvants.Pharmaceutical composition such as needle
Agent, solution preferably aseptically manufacture.The dosage of active constituent is therapeutically effective amount, such as about 1 micro- g kg body daily
About 5 mg/kg weight of weight-.In addition, polypeptide of the invention can be also used together with other therapeutic agents.
It is that the ECM1 antagonist of the invention of safe and effective amount is applied to mammal when using pharmaceutical composition,
In the safe and effective amount typically at least about 10 micrograms/kg body weight, and in most cases no more than about 8 mg/kgs
Weight, preferably the dosage is about 1 mg/kg weight of about 10 micrograms/kg body weight-.Certainly, specific dosage be also contemplated that
The factors such as medicine approach, patient health situation, within the scope of these are all skilled practitioners technical ability.
Inhibit or promote the method and composition of liver fibrosis
The present invention also provides ECM1 antagonist and its promote the purposes in liver fibrosis, especially promotes liver in preparation
The promotor of fibrosis or the purposes of composition.It in the present invention, can be with ECM1 antagonist or containing the composition of the antagonist
Promote liver fibrosis.
In a preferred example, a kind of external method for promoting liver fibrosis is provided, comprising steps of depositing in ECM1 antagonist
Under, culture hepatocyte.
The present invention also provides ECM1 agonist and its inhibit the purposes in liver fibrosis, especially inhibits liver in preparation
The inhibitor of fibrosis or the purposes of composition.It in the present invention, can be with ECM1 agonist or containing the composition of the agonist
Inhibit liver fibrosis.
In a preferred example, a kind of external method for inhibiting liver fibrosis is provided, comprising steps of swashing in ECM1 or ECM1
In the presence of dynamic agent, culture hepatocyte.
Main advantages of the present invention include:
(1) method for providing through blood plasma or serum mark analyte detection and judging liver fibrosis for the first time facilitates early stage
Detection or auxiliary detection liver fibrosis, to help to make a definite diagnosis as early as possible and take corresponding treatment measure；
(2) blood plasma or serum detection method are more convenient quickly, accurate, noninvasive, be easier to receive for patient；
(3) convenient for the disease progression of dynamic supervision nonalcoholic fatty liver, HBV infection, HCV infection, alcoholic patients.
(4) cheap, patient dependence is good.
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part, such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor
Laboratory Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, no
Then percentage and number are weight percent and parts by weight.
Experimental method
1.RNA extracting
(1) mouse Th2 cell, people's Thp1 cell quantity nearly 10 are cultivated7Appropriate 200 μ l is added after discarding culture medium in a/hole
Trizol blows down cell from plate with pipette tips, is then transferred into 1.5ml EP pipe；
(2) 200 μ l of chloroform is added, firmly shakes 15 seconds.2-3min is incubated at 15-30 DEG C, be centrifuged (4 DEG C, 12000g,
15min)；
(3) liquid is divided into three layers after being centrifuged, and careful upper layer colourless liquid of drawing moves into a new EP pipe；
(4) isometric isopropanol is added to mix, 30min is incubated at -20 DEG C, be centrifuged (4 DEG C, 12000g, 10min)；
(5) supernatant is removed, 75% ethyl alcohol 1ml, slight oscillatory 15sec is added in precipitating, is centrifuged (4 DEG C, 7,500g, 5min)；
(6) supernatant is carefully removed, air blast standing and drying 3-5min in super-clean bench is deposited in pipe, is preferably drawn with pipette tips
Clearly, it removes as far as possible；
(7) 40 μ l DEPC water are added and dissolve RNA.
2.cDNA reversion
Reverse transcription is carried out using TOKOBO reverse transcription reagent box；
The clone of 3.ECM1 gene
Mouse ECM1 primer sequence
Mouse-ECM1- positive-sense strand (sense): 5'ATTTGCGGCCGCACCATGGGGACCGTATCCAGAGCAGCCT 3'
(SEQ ID NO.:1)
Mouse-ECM1- antisense strand (anti): 5'CGCGGATCCTTCTTCCTTGGACCCAGGGGCG 3'(SEQ ID NO.:
2)
Use the archaeal dna polymerase PrimeSTAR HS DNA Polymerase of hi-fi and high amplification efficiency
(Takara) PCR amplification is carried out to target gene.Its reaction system is as follows:
PCR response procedures are as follows:
4. constructing ECM1pcDNA3.1 secretion expression carrier
Expand Mouse-ECM1 gene, Mouse-ECM1 and Human-ECM1 it is forward and reverse 5 ' end respectively introduce NotI and
Two restriction enzyme sites of BamHI are connected to the pcDNA3.1-FC of same double digestion processing respectively by limitation enzymes double zyme cutting
On expression vector.
The system of double digestion is as follows
Linked system
30min or 4 DEG C of connection of 16 DEG C of connections is overnight
5. conversion
(1) it takes 50 μ L DH5 α to be added to connection product, gently shakes up, ice bath 30min；Then 42 DEG C of heat shock 45s quickly will
Test tube turns (2) and moves on to 3min in ice bath；The LB liquid medium that 500 μ L are not added with antibiotic is added, 37 DEG C, 200 revs/min are trained
1h is supported, bacteria resuscitation is made；
(3) plate is placed in 37 DEG C and is absorbed to liquid, is inverted overnight by bacterium solution spread plate；
(4) picking colony, 37 DEG C of culture 8h.Positive colony is verified using PCR, positive colony is sequenced；
(5) according to sequencing result, it will correctly clone and protect glycerol stock (bacterium solution: 20% glycerol=1:1), -70 DEG C of preservations.
6. extracting plasmid using the small extraction reagent kit of FavorPrepTM centrifugal column type plasmid
(1) 200 μ L solution FAPD1 (by taking 1-4mL LB biomass as an example) are added into the centrifuge tube there are bacterial sediment,
It is precipitated using the thorough suspended bacterial of pipettor.
(2) 200 μ L solution FAPD2 are added into centrifuge tube, gentle inversion centrifuge tube 10 times immediately mix solution to solution
Clear viscous is placed at room temperature for 2min.
(3) 300 μ L solution FAPD3 are added into centrifuge tube, mildly a large amount of whites extremely occurs for several times in reverse centrifuge tube immediately
Flocculent deposit.Maximum speed is centrifuged 5 minutes.
(4) carefully supernatant is transferred in adsorption column, maximum speed is centrifuged 30s.The waste liquid in collecting pipe is outwelled, will be adsorbed
Column is reset in recycling collector.
(5) 400 μ L solution Ws 1 are added into adsorption column, maximum speed is centrifuged 30s, outwells the waste liquid in waste collection pipe,
Adsorption column is placed back in collecting pipe.
(6) 600 μ L Wash solution are added into adsorption column, maximum speed is centrifuged 30s.It outwells useless in waste collection pipe
Liquid places back in adsorption column in collecting pipe, and maximum speed is centrifuged 3min, removes remaining solution as far as possible.
(7) adsorption column is carefully taken out, is inserted in a clean 1.5mL centrifuge tube, is added in the film center of adsorption column
Enter 50 μ L aqua sterilisas.After being placed at room temperature for 2min, maximum speed is centrifuged 1min.
7.CHO-S cell non-serum, which suspends to cultivate, transiently transfects expression ECM1 albumen and purifying
(1) before transfection for 24 hours, CHO-S cell density reaches 1.2-1.5x106/ ml, culture solution are diluted to 5-
6x105cells/ml.Shaking flask is fixed on gyrate shaker.37 DEG C of 120-135rpm at, 8%CO2, suspend culture.
(2) the transfection same day, cell count, density reach 1.2-1.5x106/ ml, is diluted to 1x106/ ml, nutrient solution volume
150ml is added to fresh serum-free medium.
(3) 200 μ g are diluted with OptiProTMSFM contain the pcDNA3.1 secretion expression carrier of coding ECM1 gene extremely
2.5ml prepares individual pipe, dilutes 200 μ l Free Style TMMAX transfection reagents to 2.5ml with OptiProTMSFM,
It mixes gently, the liquid of two pipes is mixed immediately, lightly mixes, is placed at room temperature for 10min.
(4) slowly mixture is added to inside cell culture fluid, plus, shakes rolling bottle at leisure on one side on one side.120-
37 DEG C of 135rpm at, 8%CO2。
(5) after 72h, cells and supernatant is collected.
ECM1 albumen of the 8.proteinG affinitive layer purification with FC label
(1) cell conditioned medium for taking 2ml previous step to collect after 50% saturated ammonium sulphate preliminary purification, uses ultraviolet spectrometry
Luminosity measures protein concentration；
(2) 2ml ProteinG-sepHarose4B pillar is filled, and is balanced with about 10ml PB；
(3) the albumen upper prop after preliminary purification, and iterative cycles；
(4) PB elution is not associated with the albumen in column, surveys protein concentration, until in eluent without albumen；
(5) ECM1 albumen of the 0.1mol/L pH2.7glycine elution of bound on column, while the liquid eluted are used
It is neutralized with 1M pH 9.0Tris-Hcl, keeps its pH value neutral；
(6) eluent is collected, protein concentration is surveyed；
(7) pillar is washed with PB, makes the pH value 7.0 or so of pillar；
(8) 20% ethyl alcohol save pillar.
9. prepared by odd contradictive hydroperitoneum
It learns from else's experience and produces F1 generation mouse, in intraperitoneal injection 0.5ml norphytane (pristane).After 7-10 days, it is injected intraperitoneally again
0.5ml 1×106Hybridoma.Observation mouse growth situation daily, 7 days or so visible abdomen protuberances, acquires ascites in time.
10. hybridoma freezes and recovers
It freezes:
(1) the good cell of growth conditions is selected, the old culture solution in Tissue Culture Flask is removed, complete culture solution is added
Make cell
It suspends:
(2) 1000rpm is centrifuged 10min, removes supernatant.Frozen stock solution is added, cell suspension is made, makes into 1.0 × 107Cell/
ml；
(3) it samples, platform expects blue dyeing, and living cell counting should be 95% or more；
(4) cell suspension is dispensed into cryopreservation tube, every bottle of 0.5-1.0ml；
(5) -70 DEG C of refrigerators are put；
(6) after a week, it is transferred in liquid nitrogen container.
Recovery:
(1) cryopreservation tube is taken out from liquid nitrogen container, is put immediately instant in 37 DEG C of water-baths；
(2) cryopreservation tube is opened in sterile working, is taken out cell suspension, is transferred in the centrifuge tube of the complete culture solution containing 10ml；
(3) it is centrifuged, 1000rpm, 3min；
(4) supernatant is abandoned, mixes, is transferred in culture bottle after complete culture solution is added, culture in 37 DEG C of carbon dioxide incubators.
11. prepared by polyclonal antibody
It is health male for immune new zealand white rabbit, weight is 2~3kg.Take 500 μ g of ECM1 dilute with 1ml PBS
It releases, after adding isometric Freund's adjuvant fully emulsified, in the subcutaneous multi-point injection of rabbit back.First time fundamental immunity is helped completely with Freund
Agent, later booster immunization incomplete Freund's adjuvant.Each immunization interval 2 weeks.Immune rear 10d takes out in rabbit auricular vein every time
A little blood is taken, serum is separated, detects immune effect.When serum titer reaches 1: 40 ten thousand or more, from arteria carotis bloodletting, blood is separated
Clearly, 7 DEG C of placement 1h stay overnight for 4 DEG C later, collect serum rapidly after clot is sufficiently shunk, and 2500rpm is centrifuged at 4 DEG C
20min collects supernatant and mixes with the serum of front, and 1500rpm is centrifuged 20min at 4 DEG C, collects supernatant and dispenses, -80
It DEG C freezes spare.
12.proteinG affinity chromatography
(1) hybridoma ascites of the anti-ECM1 albumen of 2ml are taken, after 50% saturated ammonium sulphate preliminary purification, with ultraviolet point
Light luminosity measures protein concentration；
(2) 2ML ProteinG-sepHarose4B pillar is filled, and is balanced with about 10ml PB；
(3) the albumen upper prop after preliminary purification, and iterative cycles；
(4) PB elution is not associated with the albumen in column, surveys protein concentration, until in eluent without albumen；
(5) antibody of the 0.1mol/LpH2.7glycine elution of bound on column, while the liquid 1M eluted are used
PH 9.0Tris-Hcl is neutralized, and keeps its pH value neutral；
(6) eluent is collected, protein concentration is surveyed；
(7) pillar is washed with PB, makes the pH value 7.0 or so of pillar；
(8) 20% ethyl alcohol save pillar.
13. antibody biotin marks
(1) it calculates and biotin reagent amount is added: corresponding to 20mol biotin (Biotin) according to every mol albumen and calculate, 1ml
The albumen of 2mg/ml needs biotin reagent amount:
1. calculating the amount of biotin required for the biotin solution of configuration 20mol.
Ml albumen × (mg albumen/ml albumen) × (mmol albumen/mg albumen) × (20mmol biotin/mmol albumen)=
Mmol biotin
2. calculating the amount of the biotin of 10mM required for label specific protein.
Mmol biotin × (1,000,000ul/L) × (L/10mmol)=ul biotin
(2) it configures Biotin Reagent reagent: 180 μ lddH being added into Biotin Reagent powder2O is obtained
The Biotin Reagent of 10mM；
(3) monoclonal antibody of 8.6 μ lBiotin Reagent to 0.3mg/ml 1ml purifying, 4 DEG C of reaction 2h are added；
It (4) 4 DEG C, is dialyzed overnight with 1X (one times of concentration) PBS, changes 2-3 not good liquor.
(5) it carries out excess Biotin Reagent using 10KD super filter tube to remove, 4 DEG C, 600RCF, 5min.
14. the method for the pairing ELISA based on the double fastener heart identifies epitope
(1) coated antibody: coated antibody is made into appropriate dilution with coating buffer, concentration is 10 μ g/ml, and 100 holes μ l/, 4 DEG C put
It sets 16~18 hours.
(2) it washs: using up liquid in plate hole, fill it up with cleaning solution, it is quiet to put 3min, repeatedly for three times, reaction plate is upside down in suction
On water paper, flow to end washing lotion in hole.
(3) close: 200 hole μ l/ of 1%BSA confining liquid, 37 DEG C are placed 2 hours.
(4) it washs: with 2.
(5) it is loaded: the antigen (1000ng/ml, 100ng/ml, 10ng/ml, 1ng/ml) of series of concentrations, 100 μ l/ is added
Hole, while unrelated protein BSA is added and makees negative control, 37 DEG C are reacted 2 hours.
(6) it washs: with 2.
(7) secondary antibody: another monoclonal antibody of biotin labeling, 100 holes μ l/, 37 DEG C are reacted 2 hours.
(8) it washs: with 2.
(9) it develops the color: adding substrate TMB, 100 holes μ l/ are protected from light 10-15min at room temperature.
(10) it terminates reaction: adding the dense H of terminate liquid 2mol/L2SO4, 100 holes μ l/.
(11) result detects: being detected at wavelength 450nm with enzyme-linked immunosorbent assay instrument.
15. the working concentration of chessboard method measurement pairing antibody
Make the ladder of 1:160,1:320,1:640,1:1280,1:2560,1:5120 respectively to coated antibody and detection antibody
Degree dilution simultaneously optimizes the concentration by antibody and detection antibody of double sandwich-ELISA using chessboard method, ordinary circumstance
Under, the optimisation criteria of ELISA method condition is with positive hole absorbance value close to 1, meanwhile, negative control suction shading value compared with
It is small, and positive hole and optimum condition when negative hole absorbance ratio minimum to react.
16. the foundation of sandwich ELISA method
Sandwich ELISA tests (ELISA)
(1) coated antibody: making appropriate dilution for coated antibody with coating buffer, and concentration is 100 μ g/ml, 100 holes μ l/, and 4 DEG C
It places 16~18 hours.
(2) it washs: using up liquid in plate hole, fill it up with cleaning solution, it is quiet to put 3min, repeatedly twice, reaction plate is upside down in suction
On water paper, flow to end cleaning solution in hole.
(3) close: 200 hole μ l/ of confining liquid, 37 DEG C are placed 2 hours.
(4) it washs: with 2.
(5) it is loaded: the antigen (1000ng/ml, 100ng/ml, 10ng/ml, 1ng/ml) of series of concentrations, 100 μ l/ is added
Hole, while unrelated protein BSA is added and makees negative control, 37 DEG C are reacted 2 hours.
(6) it washs: with 2.
(7) secondary antibody: another monoclonal antibody of biotin labeling, 100 holes μ l/, 37 DEG C are reacted 2 hours.
(8) it washs: with 2.
(9) it develops the color: adding substrate TMB, 100 holes μ l/ are protected from light 10-15min at room temperature.
(10) it terminates reaction: adding the dense H of terminate liquid 2mol/L2SO4, 100 holes μ l/.
(11) result detects: being detected at wavelength 450nm with enzyme-linked immunosorbent assay instrument.
17. detection sensitivity measures
Sensitivity refers to the minimum flow that determinand can be detected using the method, i.e. minimum detectable activity, and minimum detectable activity is lower, spirit
Sensitivity is higher, in ELISA reagent, can be determined with the OD value for surveying " 0 " standard pipe, measurement 10 or 10 or more
" 0 " standard pipe, finds out average, along with testing concentration corresponding to twice of standard deviation is minimum detection limit.
18. detecting linear range measurement
The research of range is measured using multiple concentration samples within the measurement range, which should be evenly distributed
In the entire measurement range of kit.
19. accuracy in detection (rate of recovery) measures
Some way measurement result is often tried by TIANZHU XINGNAO Capsul close to the degree of true value, the referred to as accuracy of this method
It tests and is evaluated, it, can be using the measurement to international or national standard, addition recovery test for quantitative determining product
The methods of, evaluate the accuracy of measurement of the product.
20. detecting precision measurement
Precision is also known as repeatability, and reflection measuring method repeatedly measures the repetition journey of acquired results to a certain specific sample
Degree, this is to evaluate the most basic parameter of quality, and precision can be indicated with the coefficient of variation (CV).The standard curve ratio of immunoassays
It is more complex, it does not usually linearly include the curve handled by linearization(-sation), nearby slope absolute value is larger for mid point of curve, and measurement is quasi-
Exactness is higher.Larger in high concentration and low concentration end changes in pitch, variation increases, and range can be surveyed by limiting.
The acquisition of 1 mouse ECM1 albumen of embodiment
The acquisition of 1.1 mouse ECM1 genes
The Th2 cell saved using this laboratory is template, with Mouse-ECM1-sense and Mouse-ECM1-anti primer
The segment of 1600bp is amplified,
PCR product is run after glue is tapped and recovered with NotI and BamHI double digestion, and same double digestion processing is connected to
On pcDNA3.1-FC expression vector, bacillus coli DH 5 alpha is converted, Plasmid inserts are verified through bacterium solution PCR, and positive colony carries out
DNA sequencing (sequencing is completed by winning still biological Co., Ltd).From figure 1 it appears that expression vector pcDNA3.1-FC is obtained,
Express piece segment length 1600bp.
1.2pcDNA3.1-Fc-ECM1 the expression and purification of albumen, Western blot identification
The method validation mouse ECM1 expression of Western blot.Transiently transfect pcDNA3.1-Fc-ECM1 plasmid
Cell, the cell conditioned medium for transiently transfecting pcDNA3.1-Fc plasmid (negative control), each 10 μ l add sample-loading buffer, boil, on
Loading buffer is added in sample, and SDS electrophoresis, transferring film, closing, after washing, addition mouse ECM1 monoclonal antibody (is enough bought and sticks up mind in justice
State), it is incubated for, development.
The cell conditioned medium for having transfected pcDNA3.1-Fc-ECM1 plasmid as can see from Figure 2 has band (swimming at 110kD
Road 2), negative control plasmids pcDNA3.1-Fc cell conditioned medium has been transfected without obvious band (swimming lane 1), illustrates that ECM1-FC is expressed
Success.
The preparation of 2 polyclonal antibody of embodiment
2.1Protein-G affinitive layer purification
Rabbit anteserum after immune is carried out after purification, by the sample before purification of collection, Protein-G, sample is carried out after purification
SDS-PAGE examines purification effect, sees Fig. 3, and rabbit anteserum after purification has good purity and concentration.
2.2Anti-mECM1 rabbit anteserum Property Identification after purification
Figure 4, it is seen that the OD value of the antibody of purifying and Biotin label is significantly larger than negative control group, show
The affine activity for the antibody for purifying and marking is fine, is not influenced by purifying and Biotin label.
The how anti-titer determination of 2.3Anti-mECM1 rabbit
Take coating mECM1 concentration 10ng/ml, 2 Duplicate Samples of each dilution, in polystyrene plate hole plus 100 μ
L, 4 DEG C overnight, next day with washing buffer washing 3 times, 100 hole μ l/ of confining liquid, 37 DEG C 2 hours, washing buffer wash 3 times,
Enzymic-labelled antibody dilutes 8 gradients from 1:1000 doubling dilution.The calculation method of antibody titer is above blank control group
OD450 value adds the highest dilution of 2 times of control group standard deviations.How anti-potency after purification is 1:120,000 as shown in Figure 5.
The how anti-determination of protein concentration of 2.4Anti-mECM1 rabbit
Using green skies BCA method protein determination kit measure, and measure standard curve as shown in fig. 6, standard items and
The linear relationship of habit degree is good, R2The light absorption value of Anti-mECM1 is substituted into obtain the mostly anti-concentration of rabbit by=0.9984 is
2.1ug/ul。
The preparation of embodiment 3ELISA kit
The experiment of 3.1 antibody conjugates
The mouse ECM1 monoclonal antibody of Divine Land purchase is stuck up using justice and how anti-the rabbit that has carried out Biotin label is is matched, it is sharp
The ECM1 of purifying used as antigen be successively diluted to 1000ng, 100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng,
0.0001ng, detection justice stick up Divine Land monoclonal antibody as capture antibody, and biotin marks the how anti-light absorption value as detection antibody of rabbit, and
And primarily determine that the detection range of pairing antibody is 10ng/ml-0.1ng/ml, see Fig. 7.
The chessboard method optimization of 3.2 pairing antibody
Coated antibody is determined using chessboard method and detects the most suitable concentration of antibody, the concentration of envelope antigen is 10ng/ml,
It chooses antibody peridium concentration corresponding to hole of the OD450nm value between 2.0-1.5 and enzyme labelled antibody concentration is that most suitable coating is anti-
The working concentration of body and enzyme labelled antibody, by the following table 1 it can be seen that coated antibody detects antibody in 1ug/ml in 1.1ug/ml
It complies with standard.
The optimization of 1 mouse ELSIA kit chessboard method of table
The standard curve of 3.3 kits and sensitivity
It is examined using the mECM1 albumen that laboratory oneself purifies as the range of linearity of the standard items to ELISA kit
Survey, setting 10ng/ml, 5ng/ml, 2.5ng/ml, 1.25ng/ml, 0.625ng/ml, 0.31ng/ml, 0.15ng/ml,
0.075ng/ml.Experimental results are shown in figure 8, and the detection range of ELISA kit is 0.1ng/ml-10ng/ml, linear regression
Equation y=5.3608x-1.4513, residual error R2=0.9953, with reference to detection sensitivity method for measuring.ECM1ELISA Kit's
Sensitivity 0.01ng/ml.
3.4 accuracy detection
By 1000 times of diluted plasma of mouse, and be added standard concentration 10ng/ml, 5ng/ml, 2.5ng/ml,
1.25ng/ml, 0.625ng/ml, 0.31ng/ml, 0.15ng/ml, 0.075ng/ml, using the Kit of preparation to sample in blood plasma
It is detected and calculates detection ratio, as a result as shown in table 2 below.
2 mouse ELISA kit of table adds recovery experiment
4 mice plasma sample detection of embodiment
4.1 determine the testing result of mice serum, blood plasma.
In order to determine detection mouse samples form, two groups of mouse of WT, HE, every group of mouse difference are respectively set in experiment
Blood plasma and serum are taken, is detected respectively with laboratory self-control detection kit after dilution, experimental result is as shown in Figure 9.By
The content of ECM1 in the blood plasma of same mouse is real for the content of more convenient detection ECM1 compared with serum content height
Take mice plasma as sample detection form in testing.
4.2 determine the dilution ratio of mice plasma
By mice plasma gradient dilution, Kit is prepared by laboratory and detects light absorption value under different extension rates, as a result such as
Shown in Figure 10, appropriate dilutions multiple of the 1:512 as mice plasma sample is determined.
4.3WT, HE, gene knock out (KO) and CCL4ECM1 comparision contents in the blood plasma of modeling mouse
In the present invention, there are 5 mouse in four groups every group of mouse of setting, is detected in its blood plasma by making Kit by oneself with laboratory
The concentration of ECM1, experimental result are as shown in figure 11: wild type (WT) mouse concentration is up to 7.5ng/ml, and heterozygote (HE)
It is decreased obviously with the ECM1 content of the mouse of CCL4 modeling.Show that the content of its ECM1 during hepatic fibrosis in mice obviously drops
It is low.
4.4 mouse CCL4Continuous blood sampling detection ECM1 content during modeling
In order to further verify the variation of ECM1 content during hepatic fibrosis in mice, 12 mouse conducts are taken in experiment
To same mouse, primary have altogether of blood sampling continues 5 weeks to experimental subjects weekly during CCL4 modeling, continuously detects it in fiber
During change in blood plasma ECM1 changes of contents, experimental result is as shown in figure 12: in liver fibrosis process in mice plasma
The content of ECM1 is being gradually reduced.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Sequence table
<110>Institut Pasteur of Shanghai, Chinese Academy of Sciences
<120>marker and its application of the ECM1 as Serologic detection liver fibrosis
<130> P2017-0070
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 40
<212> DNA
<213>artificial sequence
<400> 1
atttgcggcc gcaccatggg gaccgtatcc agagcagcct 40
<210> 2
<211> 31
<212> DNA
<213>artificial sequence
<400> 2
cgcggatcct tcttccttgg acccaggggc g 31
Claims (10)
1. the purposes of extracellular CaM (ECM1 albumen) or its specific antibody, which is characterized in that
(a) diagnostic reagent or kit of detection liver fibrosis are used to prepare；And/or
(b) diagnostic reagent or kit of blood plasma or serum detection liver fibrosis are used to prepare.
2. purposes as described in claim 1, which is characterized in that the ECM1 albumen or the coupling of its specific antibody have or band
There is detectable label.
3. purposes as claimed in claim 2, which is characterized in that the detectable label is selected from the group: chromophore, chemiluminescence
Group, fluorogen, isotope or enzyme.
4. purposes as described in claim 1, which is characterized in that the diagnostic reagent is monoclonal antibody.
5. purposes as described in claim 1, which is characterized in that the detection liver fibrosis is blood plasma or serum detection.
6. a kind of for detecting the diagnostic kit of liver fibrosis, which is characterized in that the kit contains a container, described
Contain ECM1 albumen or its specific antibody in container；And label or specification, the label or specification indicate the examination
Agent box is for detection or diagnosing liver fibrosis.
7. kit as claimed in claim 6, which is characterized in that the ECM1 albumen or its specific antibody coupling have or
With detectable label.
8. a kind of purposes of extracellular CaM (ECM1 albumen), which is characterized in that it is used as blood plasma or serum detection liver
The marker of fibrosis.
9. a kind of purposes of the agonist of extracellular CaM (ECM1 albumen), which is characterized in that be used to prepare and inhibit liver fine
The drug of dimensionization is used to prepare the inhibitor for inhibiting liver fibrosis.
10. purposes as claimed in claim 9, which is characterized in that the agonist includes: ECM1 albumen, cRGD or its group
It closes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710458079.6A CN109142738A (en) | 2017-06-16 | 2017-06-16 | Marker and its application of the ECM1 as Serologic detection liver fibrosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710458079.6A CN109142738A (en) | 2017-06-16 | 2017-06-16 | Marker and its application of the ECM1 as Serologic detection liver fibrosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109142738A true CN109142738A (en) | 2019-01-04 |
Family
ID=64830646
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710458079.6A Pending CN109142738A (en) | 2017-06-16 | 2017-06-16 | Marker and its application of the ECM1 as Serologic detection liver fibrosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109142738A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020088070A1 (en) * | 2018-11-02 | 2020-05-07 | 中国科学院上海生命科学研究院 | Application of ecm1 in prevention and/or treatment of liver fibrosis-related diseases |
| CN111154802A (en) * | 2018-11-08 | 2020-05-15 | 中国科学院上海生命科学研究院 | Application of ECM1 gene knockout mouse in screening anti-hepatic fibrosis drugs |
| CN111936858A (en) * | 2019-04-04 | 2020-11-13 | 清华大学 | Gastric cancer very early cell marker and gastric precancerous lesion early cell marker and application thereof in diagnostic kit |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101353696A (en) * | 2007-07-24 | 2009-01-28 | 财团法人工业技术研究院 | Biological marker of liver fiber damage including liver fibrosis and/or hepatic cirrhosis and detecting method thereof |
| CN102552910A (en) * | 2010-12-31 | 2012-07-11 | 中国科学院上海生命科学研究院 | Application of extracellular matrix protein 1 and regulator thereof in preparing medicament for diagnosing or treating allergic diseases |
| US20140273275A1 (en) * | 2013-03-14 | 2014-09-18 | Battelle Memorial Institute | Biomarkers for liver fibrosis |
| CN106596978A (en) * | 2017-02-20 | 2017-04-26 | 成都朴华科技有限公司 | ECM1 protein antibody and applications thereof, and kit |
-
2017
- 2017-06-16 CN CN201710458079.6A patent/CN109142738A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101353696A (en) * | 2007-07-24 | 2009-01-28 | 财团法人工业技术研究院 | Biological marker of liver fiber damage including liver fibrosis and/or hepatic cirrhosis and detecting method thereof |
| CN102552910A (en) * | 2010-12-31 | 2012-07-11 | 中国科学院上海生命科学研究院 | Application of extracellular matrix protein 1 and regulator thereof in preparing medicament for diagnosing or treating allergic diseases |
| US20140273275A1 (en) * | 2013-03-14 | 2014-09-18 | Battelle Memorial Institute | Biomarkers for liver fibrosis |
| WO2014160275A2 (en) * | 2013-03-14 | 2014-10-02 | Battell Memorial Institute | Biomarkers for liver fibrosis |
| CN106596978A (en) * | 2017-02-20 | 2017-04-26 | 成都朴华科技有限公司 | ECM1 protein antibody and applications thereof, and kit |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020088070A1 (en) * | 2018-11-02 | 2020-05-07 | 中国科学院上海生命科学研究院 | Application of ecm1 in prevention and/or treatment of liver fibrosis-related diseases |
| CN111154802A (en) * | 2018-11-08 | 2020-05-15 | 中国科学院上海生命科学研究院 | Application of ECM1 gene knockout mouse in screening anti-hepatic fibrosis drugs |
| CN111154802B (en) * | 2018-11-08 | 2023-05-02 | 中国科学院分子细胞科学卓越创新中心 | Application of ECM1 gene knockout mice in screening anti-hepatic fibrosis drugs |
| CN111936858A (en) * | 2019-04-04 | 2020-11-13 | 清华大学 | Gastric cancer very early cell marker and gastric precancerous lesion early cell marker and application thereof in diagnostic kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101491835B1 (en) | A hybridoma cell line 10G4 and a monoclonal antibody against the total of aflatoxin B1, B2, G1 and G2 | |
| CN108795880B (en) | Mouse hybridoma cell strain for generating human thymidine kinase 1(TK1) specific monoclonal antibody and application thereof | |
| CN111925432B (en) | Preparation method of cardiac troponin I recombinant antigen and monoclonal antibody thereof | |
| CN112574306B (en) | Adiponectin monoclonal antibody, antibody pair, preparation method and application thereof | |
| CN101290318B (en) | ELISA reagent kit for diagnosing liver cancer | |
| CN109142738A (en) | Marker and its application of the ECM1 as Serologic detection liver fibrosis | |
| CN109387627A (en) | A kind of Reagent Protocol of screening for cancer and early diagnosis based on placenta sample chondroitin sulfate A (CSA) | |
| CN102276721B (en) | Monoclonal antibody for serological diagnosis of liver cancer and application thereof | |
| CN114478785A (en) | Mouse-derived monoclonal antibody of anti-human CHI3L1 and application | |
| CN113999303B (en) | Novel coronavirus nucleocapsid protein antibodies for in vitro diagnosis | |
| CN103074303A (en) | Hybridoma cell strain generating anti-human NGAL specific monoclonal antibody, monoclonal antibody generated by same and application | |
| CN103059117B (en) | The high flux screening of the important antigen of Schistosoma japonicum and the application in schistosomiasis diagnosis thereof | |
| CN114349855A (en) | Novel coronavirus Delta mutant strain specific antibody and application thereof | |
| CN106399294B (en) | A kind of preparation of the monoclonal antibody 7H8 of anti-human Procalcitonin protein N terminal epitope | |
| CN105732810B (en) | A kind of Procalcitonin monoclonal antibody and its application | |
| CN102778566B (en) | The application of DLK1 in diagnosing cancer of liver and Index for diagnosis | |
| CN103509115A (en) | Nanometer antibodies to human cystatin C and application thereof | |
| ES2374812T3 (en) | METHOD FOR DETECTING OR MEASURING HBV. | |
| CN103965348B (en) | Monopterus albus (Zuiew) estrogen receptorαgene, encoding proteins and enzyme-linked immune detection method | |
| CN115286715B (en) | anti-CD3 nano antibody or antigen binding portion thereof and preparation method thereof | |
| CN113956355B (en) | Anti-human Brain Natriuretic Peptide (BNP) rabbit monoclonal antibody and application thereof | |
| CN110183530A (en) | Leptin immunogene, hybridoma, monoclonal antibody, polyclonal antibody and application | |
| ES2355265T3 (en) | A KIT FOR IMMUNE DETECTION OF NUROGLOBULIN LINKED TO ENZYME AND USE OF THE SAME. | |
| CN102818896B (en) | Detection method of nitration modification sites based on specific antibodies and antibody capable of specifically recognizing succinyl-CoA: 3-oxoacid CoA transferase (SCOT) nitration sites | |
| CN113929776A (en) | Antifungal (1, 3) -beta-D glucan monoclonal antibody, encoding gene thereof, expression and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |