CN108484761A - A kind of specific recognition simultaneously induces the oligomer of A β 42 and single-chain antibody, single-chain antibody gene and its application of fibrinogen depolymerization - Google Patents
A kind of specific recognition simultaneously induces the oligomer of A β 42 and single-chain antibody, single-chain antibody gene and its application of fibrinogen depolymerization Download PDFInfo
- Publication number
- CN108484761A CN108484761A CN201810196910.XA CN201810196910A CN108484761A CN 108484761 A CN108484761 A CN 108484761A CN 201810196910 A CN201810196910 A CN 201810196910A CN 108484761 A CN108484761 A CN 108484761A
- Authority
- CN
- China
- Prior art keywords
- chain antibody
- oligomer
- fibrinogen
- ser
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
Abstract
A kind of specific recognition simultaneously induces 42 oligomer of A β and the single-chain antibody and single-chain antibody gene of fibrinogen depolymerization, belongs to genetic engineering antibody technical field.Specifically there is provided a kind of single-chain antibody HT7 of anti-42 oligomer of A β of humanized including heavy chain variable region, light chain variable region, amino acid sequence is as shown in SEQ ID NO.3.The gene engineering expression carrier that a kind of nucleotide sequence encodes the gene of single-chain antibody HT7 and the single-chain antibody HT7 of the vector constructions such as the gene and pET 28a, pET 41b, pMA5, pPZW103 as shown in SEQ ID NO.4 is provided simultaneously.Single-chain antibody HT7 energy specific recognitions simultaneously combine 42 oligomer of A β and fibrinogen, and reduce the level of 42 oligomer of A β and fibrinogen, the neural cellular toxicity for effectively inhibiting 42 oligomer of A β and fibrinogen, can have extensive use in preparing the drug of anti-neurotoxicity A β 42 or Alzheimer's disease.
Description
Technical field
The invention belongs to genetic engineering antibody technical fields, and in particular to a kind of specific recognition simultaneously induces beta amyloid egg
In vain the oligomer of (A β 42) and the single-chain antibody of fibrinogen depolymerization, this single-chain antibody of coding gene and its preparing anti-nerve
42 drugs of toxicity A β or the application in preparing Kang Aercihaimoshi medicines.
Background technology
Alzheimer disease (Alzheimer ' s disease, AD) is a kind of neurodegenerative disease, the main and beginning
The pathological characters of hair are aggregation and the depositions of gradual A β 42.For AD pathogenesis there are many viewpoint, wherein generally recognizing
Same is 42 toxicity theories of A β.It has been demonstrated that, 42 oligomer of A β and fibrinogen formed by 42 monomer aggregations of A β has Nervous toxicity
Property, it is the major virulent factor for causing AD.However, the antibody of the mithridatism A β 42 reported in the world at present is to be directed to A β 42 mostly
Primary sequence, the monomer, oligomer, fibrinogen or fiber of these antibody and A β 42 can combine, can not specifically (or specially
One ground) it combines 42 oligomer of A β or fibrinogen and inhibits their toxicity, thus easily cause larger secondary work in the treatment of AD
With.Although in addition, the antibody of selectively targeted 42 oligomer of A β or fibrinogen reported can specific recognition and combine it is specific
42 aggregations of A β, but cannot simultaneously effective induce the depolymerization of 42 oligomer of A β and fibrinogen, can not long-acting inhibition or effectively
Eradicate the toxicity of 42 oligomer of A β and fibrinogen.
Much the monoclonal antibody using humanization in passive immunotherapy report in relation to AD, but these antibody because
Molecule is not easy greatly easily to cause side effect across blood-brain barrier or poor specificity and limit application clinically.To overcome these
Limitation screens specific recognition and combines 42 oligomer of neurotoxicity A β from humanized's single-chain antibody of structure small molecule
And the single-chain antibody of fibrinogen becomes current diagnosis or treats the hot spot of AD.
Single-chain antibody (single chain Fv, scFv) is a kind of genetic engineering antibody of small molecule, it is in DNA water
It is flat that natural antibody heavy chain variable region (VH) and light chain variable region (VL) are above passed through into one section of link peptide using gene engineering method
(Linker) the small molecule recombinant antibodies being formed by connecting.Compared with complete antibody molecule, it has the characteristics that：Containing complete
Antibody variable region has more complete antigen binding site；Fc sections without containing antibody molecule, thus immunogenicity is weak, is used for
Human body is not likely to produce immune response；Molecular weight is small, and penetration power is strong, easily passes through blood-brain barrier, is suitable for the diagnosis or treatment of AD；Body
Interior circulating half-life is short, is easily excluded from blood circulation；Need not carry out it is glycosylation modified can form functional antibody molecule,
Institute is so that progress genetic engineering operates and can be in favor of prokaryotic expression system mass production.Therefore, single-chain antibody is to report at present
Road at most, the genetic engineering antibody of also most promising anti-AD.
Although the single-chain antibody of current anti-42 oligomer of A β existing in the world report (Sebollela A etc., 2017, J
Neurochem.doi:10.1111/jnc.14118；Yoshihara T etc., 2008, J Biochem, 143,475-486；
Zameer A etc., J Mol Biol, 384,917-928；Robert R etc., 2009, Protein Eng Des Sel.22,199-
208), but these single-chain antibodies are also limited to the specific not high or compatibility of 42 oligomer of A β and fibrinogen, and do not show
The effect of going out significantly inducible 42 oligomer of A β and fibrinogen depolymerization.So far, the country is there is not yet specific binding A β
42 oligomer and fibrinogen, and can effectively induce the report of 42 oligomer of A β and the single-chain antibody of fibrinogen depolymerization.
Invention content
The purpose of the present invention is to provide a kind of specific recognition and 42 oligomer of A β and fibrinogen are combined, and can effectively be lured
Lead the single-chain antibody of 42 oligomer of A β and fibrinogen depolymerization and the gene of this single-chain antibody of coding.
The present invention not only solve existing anti-42 antibody of A β without specifically with all A β 42 including 42 monomers of A β
The combinative technical problem of form, and the single-chain antibody for solving existing anti-42 oligomer of A β is special to 42 fibrinogens of A β
Property it is poor, while without induction 42 oligomer of A β and the technical issues of fibrinogen depolymerization effect.The present invention utilizes genetic engineering antibody skill
Art successfully filters out specificity and is combined with 42 oligomer of A β and fibrinogen, without being combined with 42 monomers of A β and fiber, and simultaneously may be used
Induce 42 oligomer of A β and the single-chain antibody of fibrinogen depolymerization.Single-chain antibody of the present invention and 42 oligomer of A β and fibrinogen
The characteristic of specific binding is unrelated with the primary structure of A β 42, but is based on conformation specific to 42 oligomer of A β and fibrinogen,
It is the single-chain antibody of conformation dependence type.
42 oligomer of A β and fibrinogen of the present invention are formed by 2 to tens 42 monomer aggregations of A β not etc.
, intermolecular to be mainly combined with hydrogen bond, hydrophobic bond and Van der Waals force, molecular weight is differed from 9kDa to 100kDa.
The present invention provides anti-42 oligomerizations of A β of humanized that one kind including heavy chain variable region (VH), light chain variable region (VL)
The single-chain antibody HT7 of body and fibrinogen, for amino acid sequence as shown in SEQ ID NO.3, wherein VH has SEQ ID NO.1
Shown in amino acid sequence, VL have SEQ ID NO.2 shown in amino acid sequence, the molecular weight of HT7 is about 29kDa.
The present invention also provides a kind of anti-42 oligomer of A β of foregoing humanized of coding and the single-chain antibodies of fibrinogen
The gene of HT7, nucleotide sequence is as shown in SEQ ID NO.4.
Further, single-chain antibody HT7 of the present invention can effectively inhibit the aggregation of 42 monomers of A β, additionally it is possible to make A β 42
Oligomer and fibrinogen depolymerization, and the toxicity of 42 oligomer of A β and fibrinogen to nerve cell can be substantially reduced, prepare anti-Ah
There is extensive use in the drug of Er Cihai Mo's diseases.
Further, the single-chain antibody HT7 of a kind of anti-42 oligomer of A β of humanized of coding of the present invention and fibrinogen
Gene can be recombinated with pET-28a, pET-41b, pMA5 or pPZW103, be built into the gene engineering expression of single-chain antibody HT7
Carrier, the HT7 genes and the HT7 gene engineering expressions carrier have in the drug for preparing Kang Aercihaimoshi diseases answers extensively
With.
Single-chain antibody HT7 (scFv HT7) of the present invention being capable of specific recognition and 42 oligomer of combination A β and fibril
Dimension, before the immune formulation as the treatment of the clinical diagnosis preparation and AD of detection 42 oligomer of A β and fibrinogen has wide application
Scape.
Description of the drawings
Fig. 1：The sequencing spectrogram of pET28a-HT7 recombinant expression carriers；
Fig. 2：The SDS-PAGE spectrograms of the single-chain antibody HT7 of purifying, wherein M：Protein Marker；1：Control group；2:Table
The HT7 reached；3：HT7 after purification；
Fig. 3：The Dot-blot analysis of spectra that single-chain antibody HT7 and different shape A β 42 are identified；
Fig. 4：The Western blot analysis of spectra of single-chain antibody HT7 and the identification of 42 aggregations of different molecular weight A β；
Fig. 5：ELISA method measures the curve graph of HT7 and 42 oligomer affinity of A β；
Fig. 6：ThT-F methods analyze single-chain antibody HT7 and A β 42 are inhibited to assemble and induce the spectrogram of 42 aggregation depolymerization of A β；Its
In, M：Monomer, O：Oligomer, P：Fibrinogen, F：Fiber；* p ＜ 0.01, * p ＜ 0.05.
Fig. 7：Mtt assay measures the curve graph that single-chain antibody HT7 concentration dependents inhibit 42 cytotoxicities of A β.
Specific implementation mode
The preparation of 1 A β of embodiment, 42 oligomer, 42 fiber of fibrinogen and A β
42 monomers of A β (being purchased from Sigma Co., USA) ice-cold hexafluoroisopropanol (HFIP) is dissolved to a concentration of 1mg/
ML, ice-water bath ultrasound 10min, vacuum drying, -20 DEG C freeze.In use, first by 42 monomers of A β obtained above dimethyl Asia
Sulfone (DMSO) is dissolved to a concentration of 1mg/mL, then by A β 42 be diluted to a concentration of 10 μM of phosphate buffer (pH 7.4,
In 50mM), final concentration of 10 μM of A β 42, it is incubated 3~12h respectively at 37 DEG C and forms 42 oligomer of A β, is incubated 12~24 hours
42 fibrinogens of A β are formed, 36~37 hours coherent conditions for forming 42 mature fibers of A β are incubated.All 42 coherent conditions of A β are logical
Cross Electronic Speculum confirmation.Since A β 42 form the irreversibility of aggregation, the various aggregations of A β 42 are current existing preparation.
The screening of 2 positive colony of embodiment
(1) peripheral blood lymphocytes RNA extractions and reverse transcription synthesize cDNA
Peripheral blood lymphocytes separation and Extraction：Alzheimer ' is acquired with EDTAP dipotassium ethylene diamine tetraacetate (EDTA-2K) anticoagulant tube
Silent patient peripheral blood blood sample 10mL (is purchased from green skies biotechnology with the balanced salt solution (D ' Hanks) of no calcium and magnesium ion
Research institute) with 1：1 volume dilution, to dilute blood sample and lymphocyte separation medium=2：Poly- sugarcane is added in the ratio of 1 (volume ratio)
Sugar-cardiografin lymphocyte separation medium (is purchased from sigma companies of the U.S.).At room temperature, 20min is centrifuged with 2000rpm/min.From
After the heart, mononuclearcell layer is drawn.Cell is washed with D ' Hanks, 1000rpm/min centrifuges 10min, obtains periphery hemolymph
Cell.
Peripheral blood lymphocytes RNA extractions：1 × 1071mL phenol-isothiocyanic acid is added in a peripheral blood lymphocytes
Guanidine total serum IgE extraction agent (- Reagent is purchased from Invitrogen companies), 4 DEG C of standing 5min.200 μ L chlorine are added
It is imitative, it turns upside down and slurry white occurs to solution.It is placed in 5min on ice.Under the conditions of 4 DEG C, 12000rpm/min centrifuges 15min.It will
Upper strata aqueous phase moves into another centrifuge tube, adds isometric isopropanol, is incubated 10min on ice.Under the conditions of 4 DEG C, 12000rpm/min,
Centrifuge 10min.Supernatant is abandoned, in precipitation (containing RNA) plus 1mL 75% (volume fraction) ethyl alcohol washs.Under the conditions of 4 DEG C,
12000rpm/min centrifuges 5min, obtains RNA precipitate.After being air-dried, with appropriate trishydroxymethylaminomethane-ethylenediamine tetraacetic
Acetate buffer (TE) or deionized water dissolving without RNA enzyme are spare.
Reverse transcription synthesizes cDNA：The method of the RNA synthesis cDNA of said extracted is as follows under the action of reverse transcriptase, takes
The 4 μ L of RNA solution (1000 μ g/ μ L) of above-mentioned preparation are added in 0.1mL centrifuge tubes, and oligomerization thymidylic acid is added
Primer (Oligo dT Primer) 1 μ L and 1 μ L of deoxyribonucleoside triphosphate mixture (dNTP), finally with no RNA enzyme go from
After sub- water is supplemented to 10 μ L, 65 DEG C of heat preservation 5min, cooled down rapidly in ice bath.Reverse transcription buffer is added in above-mentioned centrifuge tube
(II Buffer of PrimerScript) 4 μ L, RNase inhibitor (RNase Inhibitor) 0.5 μ L, reverse transcriptase
(II RTase of PrimerScript) 1 μ L, finally add to 20 μ L, slow mixing with the deionized water of no RNA enzyme.With 42 DEG C
After the condition of 45min, 95 DEG C of 5min carry out reverse transcription reaction, cooled on ice.
(2) the DNA fragmentation amplification of coding VH and VL
According to the conserved sequence of VH and VL, the primer of the DNA fragmentation of amplification coding VH and VL, sequence have been designed and synthesized
It is as follows：
VHS1 5′GGAATTCCATATGCAGGTGCAGCTGGTG 3′
5′CCTGAGCCACCTCCGCCAGAACCGCCTCCACCTGAAGAGACGGT VHA1
GACCGTTGTCC 3′
5′TGGCGGAGGTGGCTCAGGCGGTGGAGGATCGGATATCCAGATGA VLS1
CTCAGTCTCC 3′
VLA1 5′ATAAGAATGCGGCCGCACGTTTGATCTCCACTTTGGTCC 3′
5 ' underscore part CATATG sequences are I recognition sites of restriction endonuclease Nde in VHS1, the underscores at 3 ' ends in VLA1
Part GCGGCCGC sequences are I recognition sites of restriction endonuclease Not.
Amplification procedure is as follows：
After the deionized water of the no RNA enzyme of cDNA prepared in above-mentioned steps (1) dilutes 50 times, take 1 μ L be separately added into as
In the PCR system of the DNA fragmentation of lower amplification coding VH, VL, the DNA fragment amplification systems of VH are encoded：VHS1(25μmol/L)
0.4 μ L, VHA1 (25 μm of ol/L) 0.4 μ L；Encode the DNA fragment amplification systems of VL：VLS1 (25 μm of ol/L) 0.4 μ L, VLA1
(25μmol/L)0.4μL；0.8 μ L, 10 × buffer 1 of archaeal dna polymerase (r-Taq) 0.1 μ L, dNTPs is respectively added in two systems again
μ L, the 6.3 μ L of deionized water of no RNA enzyme carry out the amplification of target fragment respectively：94 DEG C of 5min, 94 DEG C of 30s, 55 DEG C of 30s, 72
DEG C 1min acts on 30 cycles, 72 DEG C of 10min.Finally use plastic recovery kit (limited purchased from Shanghai life work bioengineering respectively
Company) recycle the DNA fragmentation for encoding VH, VL.
(3) splicing and amplification of the DNA fragmentation of coding scFv
Splicing system is as follows：The 1 μ L of DNA segments of the 2 μ L of DNA fragmentation [coming from step (2)], coding VL that encode VH [come from
Step (2)], 0.8 1 μ L, r-Taq archaeal dna polymerases of μ L, 10 × buffer of dNTPs, 0.1 μ L, the deionized water 5.1 of no RNA enzyme
μ L realize the splicing of the DNA fragmentation of coding scFv under the following conditions：94 DEG C of 5min, 94 DEG C of 50s, 55 DEG C of 50s, 72 DEG C
1min acts on 30 cycles, 72 DEG C of 10min, 4 DEG C of preservations.
Encode the amplification of the DNA fragmentation of scFv：The DNA fragmentation of spliced coding scFv is diluted 50 times, 5 μ L is taken to be added
In following amplification system：2.5 2.5 μ L, r-Taq archaeal dna polymerases of μ L, VLA1 of VHS1 0.5 μ L, dNTPs 4 μ L, 10 ×
5 μ L of buffer, the 30.5 μ L of deionized water of no RNA enzyme, amplification condition are：94 DEG C of 5min, 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C
1min acts on 30 cycles, 72 DEG C of 10min.1 μ L amplified productions are taken to carry out 1% agarose gel electrophoresis identification, rest part is solidifying
With plastic recovery kit recycling (being purchased from Shanghai Sheng Gong bioengineering Co., Ltd) after gel electrophoresis.
(4) screening of positive colony
Designed Nde I and I restriction enzyme sites of Not and the prokaryotic expression carrier pET28a used in the present invention are (logical in primer
Coli expression carrier, containing T7 strong promoters, C- terminal Histidin Tags and kalamycin resistance gene etc.,
The companies such as Novagen, Invitrogen are on sale) Nde I and Not I match, be suitable in E. coli.Profit
With Nde I and I cleavage sites of Not by this person source scFv gene fragment clones into I digestion of Nde I in expression vector pET28a and Not
Between site, connection just obtains recombinant expression carrier.
The construction step of above-mentioned expression vector is specific as follows：
Double digestion reacts：By 1.0 μ g pET28a carriers and the scFv genetic fragments of above-mentioned acquisition respectively with appropriate deionization
Water mixing, it is respectively 18 μ L to make its total volume, the Not I of each restriction enzyme Nde I that 2-3 units are added and 2-3 units and
Corresponding 10 × H the buffer solutions of 2 μ L, mixing are set after 37 DEG C of water-baths keep the temperature 2-3 hours, are recycled with glue after gel electrophoresis is respectively adopted
Kit recycles target DNA (being purchased from Shanghai Sheng Gong bioengineering Co., Ltd).
Encode the connection of the DNA fragmentation and pET28a carriers of scFv：The pET28a carriers for taking 0.5 μ g above-mentioned steps to recycle
Coding scFv genetic fragments, 2 μ L 10 × T4DNA connection enzyme buffers that the above-mentioned steps of 2-10 times of mole obtain are added in DNA
Liquid is added deionized water constant volume and sets 20 μ L, is eventually adding the T4DNA ligases of 1 unit, simultaneously moment centrifuges so that drop mixing
Assemble tube bottom, sets 16 DEG C of water-baths and stay overnight, the recombinant expression carrier pET28a-scFv connected.
Recombinant expression carrier pET28a-scFv Transformed E .coli BL21 (DE3) competent cell【E.coli BL21
(DE3) the preparation method reference " Molecular Cloning:A Laboratory guide " (second edition, Science Press) page 49 of competent cell】In, ice
42 DEG C of water-baths of merging keep the temperature 1 minute after bath 30 minutes, take out immediately 2 minutes cooling in juxtaposition ice bath.It is pre- that 37 DEG C of 200 μ L are added
The LB liquid medium of heat, 37 DEG C of 150rpm shakings cultures after sixty minutes, are taken out 100 μ L culture solutions and are coated on containing kanamycins
(Kan) on LB agar plates, after 37 DEG C of culture 12h, there is conversion bacterium colony.
(it is purchased from Corning companies of the U.S.) on picking monoclonal to 96 hole Bacteria Culture plates, LB Liquid Cultures are added per hole
200 μ L of base contain 100 μ g/mL kanamycins (Kan) in culture medium.37 DEG C of 200rpm shake overnight incubation.2 μ L are drawn per hole
Bacterium solution is added in other one block 96 new hole Bacteria Culture plates, and per hole, 200 μ L of addition LB culture mediums, culture medium contain 100 μ
G/mL Kan, 37 DEG C of 200rpm shakings cultures to OD600=0.8~1.0.The glycerine of certain volume is added to first block of plate again,
Final glycerol concentration is 15%, -80 DEG C of preservations.Isopropyl-β-D-thiogalactoside is added per hole into second piece of 96 orifice plate
(IPTG) (be purchased from sigma companies of the U.S.) to final concentration of 0.05mM, 20 DEG C, after 160rpm oscillation inductions 12h, with 96 orifice plates from
Scheming is centrifuged 10 minutes with 4000rpm, is discarded culture medium and is collected thalline.The cracking of cellular lysate liquid ice bath is added into 96 orifice plates again
1 hour, 4000rpm was centrifuged 10 minutes, collected the total protein after cracking.
96 hole elisa Plates are coated with 100 holes μ L/ (be purchased from the U.S. with 42 oligomer of A β (coming from embodiment 1) of 10 μ g/mL
Corning companies), 4 DEG C, 16-18h.Antigen liquid is abandoned, the bovine serum albumin(BSA) of 100 μ L 1% (volume ratio) is added per hole
(BSA), 1h is closed in 37 DEG C.Phosphate buffer (PBS) [contain 0.1% (volume ratio) Tween-20] board-washing three times, per hole
The above-mentioned total proteins being collected into of 100 μ L, 37 DEG C of incubation 2h are added.Positive control wells add commercialization A β antibody B4 (to be purchased from the U.S.
Santa cruz companies), negative control hole adds BSA.PBS [containing 0.1% (volume ratio) Tween-20] board-washing six times.It is added
100μL 1:The diluted anti-His monoclonal antibodies of 2000 (volume ratios) (are purchased from Santa cruz companies of the U.S.), 37 DEG C of incubation 1h.PBS
[containing 0.1% (volume ratio) Tween-20] board-washing six times.100 μ L 1 are added:4000 (volume ratios) dilute horseradish peroxidase
The goat anti-rabbit igg antibody (purchased from Chinese doctor's moral company) of enzyme (HRP) label, 37 DEG C of incubation 1h.PBS [contains 0.1% (volume
Than) Tween-20] board-washing six times.3,3', 5,5'- tetramethyl benzidines (TMB) (being purchased from Amresco companies of the U.S.) 50 μ is added
The holes L/, room temperature are protected from light 15min, add 30 μ L 2mol/L H per hole2SO4Terminate reaction, microplate reader surveys OD values, and (wavelength is
450nm).Result judgement：It is more than 3 times of negative control for the positive with OD values, the OD values of blank control should be less than 0.2.It reflects through result
It is fixed, it filters out one plant strong with antigen binding power of monoclonal bacterial strain HT7 and carries out subsequent experimental.
The determined dna sequence of 3 single-chain antibody HT7 genes of embodiment
Plasmid pET28a-HT7 is extracted, transfers to Shanghai life work sequencing portion to carry out sequencing, as a result such as Fig. 1 (pET28a-
Spectrogram is sequenced in HT7 carriers, wherein the gene of coding HT7 is nucleotide 120~869) shown in.By measured HT7 gene sequences
Row are compared with the Ig gene sequences in GeneBank, as a result prove：The HT7 clones obtained compile for one
The DNA sequence dna of code scFv, initiation codon ATG, terminator codon TGA, nucleotide sequence such as SEQ ID NO.4 institutes
Show, it contain encoding antibody heavy variable region (VH), light chain variable region (VL) DNA sequence dna, the corresponding amino being derived by
Acid sequence (SEQ ID NO.1, SEQ ID NO.2) has typical antibody variable plot structure.
The expression and preparation of 4 single-chain antibody HT7 of embodiment
By 37 DEG C of shaking overnight incubations of E.coli BL21 (DE3) containing pET28a-HT7 plasmids.With 1:100 ratio
Inoculation, 37 DEG C of shaken cultivation OD600The expression of IPTG inductions HT7 is added after=0.8~1.0,20 DEG C, 160rpm oscillations induce
After 12h, 4 DEG C of 5000rpm centrifugations 5min collect thalline.Thalline is resuspended with PBS (pH7.4), is collected by centrifugation after ultrasonication
Clearly.Ni is used to the supernatant of collection2+The humanized's single-chain antibody HT7 of-NTA column purification present invention：Supernatant is slowly flowed across into Ni2 +Then-NTA columns wash column, finally with 8 times of column volumes of buffer (20mM phosphate buffers, 500mM sodium chloride, 20mM imidazoles)
With humanized's single-chain antibody of elution buffer (20mM phosphate buffers, 500mM sodium chloride, 250mM imidazoles) the elution present invention
HT7.Fig. 2 shows the SDS-PAGE qualification results of prepared humanized's single-chain antibody HT7, the humanized purified is single-stranded
Antibody HT7 molecular weight is about 29.0kDa.
The binding specificity of embodiment 5 Dot-blot detections single-chain antibody HT7 and A β 42 monomer and aggregation
42 monomers of A β, oligomer, fibrinogen and fiber are placed on nitrocellulose filter, with 5% (volume ratio) defatted milk
Powder close membrane sets room temperature 1h.After single-chain antibody HT7 incubations 1h is added, film is washed 3 times with PBS, each 10min.Add His-
Tag antibody [1：1000 (volume ratios)], 37 DEG C of incubation 1h wash film 3 times with PBS [containing 0.1% (volume ratio) Tween-20],
Each 10min.Film is added to the rabbit IgG [1 of HRP labels:5000 (volume ratios)] in, 37 DEG C of incubation 1h.PBS [contains
Have 0.1% (volume ratio) Tween-20] wash film 3 times, each 10min.PBS washes film 1 time, 10min.Film is shone through substrate
Colour reagent box (ECL) (be purchased from green skies biotechnology research institute) development, the results are shown in Figure 3, only in 42 oligomer of A β and
Show apparent spot at fibrinogen, and the hardly display dot in 42 monomers of A β and fibre morphology.
Identifications of the 6 Western blot detections single-chain antibody HT7 of embodiment to 42 aggregations of A β
42 mixtures of A β (monomer, oligomer, fibrinogen, fiber volume fraction 1：1：1：1) through native gel electrophoresis point
It from rear, is transferred on polyvinylidene fluoride (PVDF) film, 5% (volume ratio) skim milk closes 1h.[contain 0.1% with PBS
(volume ratio) Tween-20] wash film 3 times, each 10min.Film is placed in hybridization bag, single-chain antibody HT7 is added, control group adds
Enter anti-42 antibody of A β (B4) (being purchased from Santa Cruz companies) [1:1000 (volume ratios)], after room temperature hybridizes 2h, PBS [contains
0.1% (volume ratio) Tween-20] wash film 3 times, each 10min.Film is placed in hybridization bag, anti-histidine is added in experimental group
Tag antibody (anti His-Tag) (being purchased from Santa Cruz companies) [1:1000 (volume ratios)] antibody, after room temperature hybridizes 1h,
PBS [containing 0.1% (volume ratio) Tween-20] washes film 3 times, each 10min.Each group is separately added into corresponding HRP labels
IgG[1:5000 (volume ratios)], room temperature hybridizes 1h.PBS [containing 0.1% (volume ratio) Tween-20] washes film 3 times, every time
10min.ECL colour developings are added, the results are shown in Figure 4：HT7 can specific recognition molecules amount be 18KDa~55KDa region,
That is 42 oligomer of A β and fibrinogen region, and 42 monomers of A β, 42 mature fibers forms of A β are not combined significantly.
The measurement of 7 single-chain antibody HT7 affinity of embodiment
The affinity of single-chain antibody HT7 is measured with indirect ELISA method, and normal with the dissociation of the balance of antigen antibody complex
Number (KD) indicate.It is stayed overnight with 4 DEG C of 42 oligomer of A β or fibrinogen coated elisa plate of 1 μ g/mL concentration, with 1% BSA in 37 DEG C
1h is closed, by single-chain antibody HT7 and 10 in another ELISA Plate-10~10-442 oligomer of A β or fibril of mol/L concentration
Dimension mixing is added isometric confining liquid incubation at room temperature 1h, then mixed liquor is added in antigen coat hole, and 37 DEG C are incubated 2h, PBS
After [containing 0.1% (volume ratio) Tween-20] washing, 100 μ L 1 are added per hole:The diluted anti His- of 2000 (volume ratios)
Tag antibody is added TMB colour developings after 37 DEG C of incubation 1h, PBS [containing 0.1% (volume ratio) Tween-20] washings, measures 450nm
OD value (OD450), the results are shown in Figure 5 for 42 oligomer of A β, and the result of 42 fibrinogens of A β is similar to 42 oligomer of A β
(summary).KDTo reach maximum OD450Value 50% when 42 oligomer of A β or fibrinogen concentration, learnt by experimental data, KD oligomerWith
KD fibrinogensIt is 3.1 × 10-6M。
The inhibiting effect that 8 single-chain antibody HT7 of embodiment assembles A β 42
The monomer of A β 42, oligomer, fibrinogen and fiber and single-chain antibody HT7 are mixed with equimolar ratio respectively, 37
It DEG C is incubated, respectively in 0h, 3h, 12h, dyes the aggregation extent that (ThT-F) method measures A β 42 with 48h sulphur productions for 24 hours,
The results are shown in Figure 6.Fig. 6 shows：1, single-chain antibody HT7 can significantly A β 42 monomer and oligomer aggregation；2, HT7 is single-stranded anti-
Body can significantly induce the depolymerization of 42 oligomer of A β and fibrinogen；3：HT7 single-chain antibodies are certain to being populated with for 42 fibers of A β
Inhibiting effect, while the effect of also certain 42 fibril disaggregations of induction A β.It can be obtained by result above：Single-chain antibody
HT7 can not only inhibit the aggregation of A β 42, can also effectively induce the depolymerization of 42 oligomer of A β and fibrinogen that have been formed.
9 single-chain antibody of embodiment inhibits the toxic effect of 42 oligomer of A β and fibrinogen to cell
By SH-SY5Y cells in the cell inoculation to porous cell culture plate of 5000, every hole, per 100 μ L of pore volume, carefully
Born of the same parents carry out following 17 groups of experiments after 37 DEG C of cultures for 24 hours：
After above 17 groups are incubated 20h at 37 DEG C respectively, 3- (4,5- dimethylthiazole -2) -2,5- diphenyl four is added per hole
20 μ L of nitrogen azoles bromide (MTT) (being purchased from sigma companies of the U.S.) solution (5mg/mL), 37 DEG C are continued to be incubated 4h, terminate culture, MTT
Method detects the survival rate of cell, and the results are shown in Figure 7, and single-chain antibody HT7 inhibits 42 monomers of A β, oligomer, fibrinogen and fiber
Toxic effect to cell is in concentration dependent, and 42 oligomer of A β and fibrinogen make cell survival rate significantly reduce, and is passed through
Corresponding cell survival rate is significantly raised after single-chain antibody HT7 effects.In contrast, single-chain antibody HT7 is to 42 monomers of A β and fibre
The toxicity inhibition effect of dimension is limited.These results also illustrate, single-chain antibody HT7 and 42 oligomer of A β and the affine energy of fibrinogen
Power is stronger, and can be effectively combined 42 oligomer of A β and fibrinogen, and inhibits its toxic effect to cell.
10 in vitro blood-brain barrier model foundation of embodiment and single-chain antibody penetrate the detection of blood-brain barrier
Using the method that human umbilical vein endothelial cell HUVEC and glioma cell C6 are co-cultured, establish external
Blood-brain barrier model.
Co-culture method is as follows：Human umbilical vein endothelial cell HUVEC condition of culture：In Ham's F12K culture mediums
Final concentration of 2mM L-Glutamines, 1.5g/L sodium bicarbonates, 0.03mg/mL endothelial growth factor supports is added
(ECGS) and 10% fetal calf serum.
Glioma cell C6 condition of culture：Final concentration of 10% fetal calf serum is added in DMEM-F12 culture mediums.
C6 cells are first inoculated in the bottom surface of PET film with 45,000/hole, are just setting the cells transwell after adherent, by
Appropriate culture medium is added in pond, and HUVEC cells, 37 DEG C, 5%CO are inoculated in the fronts PET with 30,000/hole after 2~3 days2And it is full
It is co-cultured 5~7 days under damp condition.
Identification：
A. optical microphotograph microscopic observation
B. leak test is tested：So that the small indoor and outdoor liquid level differences of transwell is reached 0.5cm or more, liquid level difference is observed after cultivating 4h
Variation.
C. across transendothelial electrical resistance value (transendothelial electrical resistance, TEER) is detected：It uses
MilliCell-ERS Voltohmmeter measure HUVEC and co-culture bilateral resistance value with C6 cells.Fresh cultured is replaced daily
Base measures TEER values simultaneously, until confirming that cell merges completely and TEER values reach stable under microscope.
Single-chain antibody penetrates the detection of blood-brain barrier：When HUVEC/C6 cells co-culture 5~7 days, detection TEER values reach
630ohm/cm2And after stablizing, across the blood brain barrier transport test experience of single-chain antibody is carried out.In 5 μ g single-chain antibodies of small indoor addition
HT7.When working as 5min, 15min, 30min, 60min, 90min and 120min, 60 μ L samples are drawn in small outside, are added to enzyme
In target, 4 DEG C of coatings are overnight.ELISA method detection single-chain antibody HT7 penetrates blood-brain barrier.As a result：Single-chain antibody HT7 is penetrated
The efficiency of blood-brain barrier increases within 60 minutes and increases at any time, and its penetrance is close to peak value in 60min, later
Stable situation is almost presented.The results show that single-chain antibody HT7 can effectively penetrate blood-brain barrier.
<110>Jilin University
<120>A kind of specific recognition simultaneously induces the oligomer of A β 42 and single-chain antibody, the single-chain antibody gene of fibrinogen depolymerization
And its application
<160> 4
<210> 1
<211> 126
<212> PRT
<213> VH
<400> 1
Met Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly
1 5 10 15
Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Val Thr Ser
20 25 30
Tyr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
35 40 45
Met Gly Gly Ile Asn Thr Asn Thr Gly Asn Pro Ala Tyr Ala Pro Gly
50 55 60
Phe Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala
65 70 75 80
His Leu Gln Ile Gly Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Phe
85 90 95
Cys Ala Arg Ser Ser Ser Gly Tyr Gln Gly Ser Ser Tyr Tyr Phe Asp
100 105 110
Met Asp Val Trp Asp Gln Gly Thr Thr Val Thr Val Ser Ser
115 120 125
<210> 2
<211> 108
<212> PRT
<213> VL
<400> 2
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Arg Thr Ile Ser Ser Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Pro Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ile Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Val Ser Gly Thr His Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr His Tyr Cys Gln Gln Ser Ser Ser Thr Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210> 3
<211> 249
<212> PRT
<213> HT7
<400> 3
Met Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly
1 5 10 15
Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Val Thr Ser
20 25 30
Tyr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
35 40 45
Met Gly Gly Ile Asn Thr Asn Thr Gly Asn Pro Ala Tyr Ala Pro Gly
50 55 60
Phe Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala
65 70 75 80
His Leu Gln Ile Gly Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Phe
85 90 95
Cys Ala Arg Ser Ser Ser Gly Tyr Gln Gly Ser Ser Tyr Tyr Phe Asp
100 105 110
Met Asp Val Trp Asp Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly
115 120 125
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln
130 135 140
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val
145 150 155 160
Thr Ile Thr Cys Arg Ala Ser Arg Thr Ile Ser Ser Tyr Leu Asn Trp
165 170 175
Tyr Gln Gln Lys Pro Gly Lys Pro Pro Lys Leu Leu Ile Tyr Ala Ala
180 185 190
Ser Ile Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Val Ser
195 200 205
Gly Thr His Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe
210 215 220
Ala Thr His Tyr Cys Gln Gln Ser Ser Ser Thr Pro Leu Thr Phe Gly
225 230 235 240
Gly Gly Thr Lys Val Glu Ile Lys Arg
245
<210> 4
<211> 747
<212> DNA
<213> HT7
<400> 4
atg cag gtg cag ctg gtg cag tct gga gct gag gtg aag aag cct ggg
Met Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly
1 5 10 15
gcc tca gtg aag gtc tcc tgc aag gct tct ggt tac acc gtt acc agt
Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Val Thr Ser
20 25 30
tat ggt atc agc tgg gtg cga cag gcc cct gga caa ggg ctt gag tgg
Tyr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
35 40 45
atg gga ggg atc aac acc aat act ggg aac cca gcg tat gcc ccg ggc
Met Gly Gly Ile Asn Thr Asn Thr Gly Asn Pro Ala Tyr Ala Pro Gly
50 55 60
ttc aca gga cga ttt gtc ttc tcc ttg gac acc tct gtc agc acg gca
Phe Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala
65 70 75 80
cac ctg cag atc ggc agc cta aag gct gag gac acc gcc gtt tat ttc
His Leu Gln Ile Gly Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Phe
85 90 95
tgt gcg agg agt tcg agt ggt tat cag ggt tcc tcc tac tac ttc gat
Cys Ala Arg Ser Ser Ser Gly Tyr Gln Gly Ser Ser Tyr Tyr Phe Asp
100 105 110
atg gac gtc tgg gac caa ggg aca acg gtc acc gtc tct tca ggt gga
Met Asp Val Trp Asp Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly
115 120 125
ggc ggt tct ggc gga ggt ggc tca ggt ggt gga gga tcg gat atc cag
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln
130 135 140
atg act cag tct cca tcc tcc ctg tct gcg tct gta gga gac aga gtc
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val
145 150 155 160
acc atc act tgc cgg gca agt cgg acc att agc agt tat tta aat tgg
Thr Ile Thr Cys Arg Ala Ser Arg Thr Ile Ser Ser Tyr Leu Asn Trp
165 170 175
tat cag cag aaa cca ggg aaa ccc cct aaa ctc ctg atc tat gct gca
Tyr Gln Gln Lys Pro Gly Lys Pro Pro Lys Leu Leu Ile Tyr Ala Ala
180 185 190
tcc att tta caa agt ggg gtc cca tca agg ttc agt ggc agt gta tct
Ser Ile Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Val Ser
195 200 205
ggg aca cat ttc act ctc acc atc agc agt ctg caa cct gaa gat ttt
Gly Thr His Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe
210 215 220
gca acc cac tac tgt caa cag agt tcc agt acc ccg ctt act ttc ggc
Ala Thr His Tyr Cys Gln Gln Ser Ser Ser Thr Pro Leu Thr Phe Gly
225 230 235 240
gga ggg acc aaa gtg gag atc aaa cgt
Gly Gly Thr Lys Val Glu Ile Lys Arg
245
Claims (10)
1. a kind of single-chain antibody HT7, it is characterised in that：Its amino acid sequence is as shown in SEQ ID NO.3.
2. applications of the single-chain antibody HT7 described in claim 1 in terms of inhibiting 42 monomer aggregations of A β.
3. single-chain antibody HT7 described in claim 1 inhibit 42 oligomer of A β and fibrinogen assemble and make 42 oligomer of A β and
Application in terms of fibrinogen depolymerization.
4. single-chain antibody HT7 described in claim 1 is in terms of reducing by 42 oligomer of A β and fibrinogen to neurotoxicity
Using.
5. applications of the single-chain antibody HT7 described in claim 1 in preparing anti-42 drugs of neurotoxicity A β.
6. applications of the single-chain antibody HT7 described in claim 1 in preparing Kang Aercihaimoshi medicines.
7. a kind of gene of coding single-chain antibody HT7 described in claim 1, it is characterised in that：Its nucleotide sequence such as SEQ
Shown in ID NO.4.
8. a kind of gene engineering expression carrier, it is characterised in that：It is by the base of the coding single-chain antibody HT7 described in claim 7
Because of the expression vector with the single-chain antibody HT7 of pET-28a, pET-41b, pMA5 or pPZW103 vector construction.
9. gene the answering in preparing anti-42 drugs of neurotoxicity A β or Kang Aercihaimoshi medicines described in claim 7
With.
10. gene engineering expression carrier according to any one of claims 8 is preparing anti-42 drugs of neurotoxicity A β or anti-Alzheimer
Application in family name's medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810196910.XA CN108484761B (en) | 2018-03-10 | 2018-03-10 | Single-chain antibody for specifically recognizing and inducing depolymerization of oligomer and fibril of Abeta 42, single-chain antibody gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810196910.XA CN108484761B (en) | 2018-03-10 | 2018-03-10 | Single-chain antibody for specifically recognizing and inducing depolymerization of oligomer and fibril of Abeta 42, single-chain antibody gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108484761A true CN108484761A (en) | 2018-09-04 |
| CN108484761B CN108484761B (en) | 2021-04-30 |
Family
ID=63338310
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810196910.XA Active CN108484761B (en) | 2018-03-10 | 2018-03-10 | Single-chain antibody for specifically recognizing and inducing depolymerization of oligomer and fibril of Abeta 42, single-chain antibody gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108484761B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115925923A (en) * | 2022-09-26 | 2023-04-07 | 吉林大学 | Single-chain antibody for catalyzing degradation of Abeta 42 oligomer, single-chain antibody gene and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1728864A1 (en) * | 1995-01-26 | 2006-12-06 | Bristol-Myers Squibb Company | Monoclonal antibodies specific for different epitopes of human gp39 and methods for their use in diagnosis and therapy |
| CN103408661A (en) * | 2007-01-05 | 2013-11-27 | 苏黎世大学 | Method of providing disease-specific binding molecules and targets |
| CN103804496A (en) * | 2014-02-22 | 2014-05-21 | 吉林大学 | Single-chain antibody specifically identifying and combining Abeta 42 oligomer and gene of single-chain antibody |
| CN104479013A (en) * | 2014-11-14 | 2015-04-01 | 吉林大学 | Anti-Abeta42 oligomer single-chain antibody and gene for coding single-chain antibody |
| CN104736168A (en) * | 2012-05-31 | 2015-06-24 | 索伦托治疗有限公司 | Antigen binding proteins that bind pd-l1 |
-
2018
- 2018-03-10 CN CN201810196910.XA patent/CN108484761B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1728864A1 (en) * | 1995-01-26 | 2006-12-06 | Bristol-Myers Squibb Company | Monoclonal antibodies specific for different epitopes of human gp39 and methods for their use in diagnosis and therapy |
| CN103408661A (en) * | 2007-01-05 | 2013-11-27 | 苏黎世大学 | Method of providing disease-specific binding molecules and targets |
| CN104736168A (en) * | 2012-05-31 | 2015-06-24 | 索伦托治疗有限公司 | Antigen binding proteins that bind pd-l1 |
| CN103804496A (en) * | 2014-02-22 | 2014-05-21 | 吉林大学 | Single-chain antibody specifically identifying and combining Abeta 42 oligomer and gene of single-chain antibody |
| CN104479013A (en) * | 2014-11-14 | 2015-04-01 | 吉林大学 | Anti-Abeta42 oligomer single-chain antibody and gene for coding single-chain antibody |
Non-Patent Citations (6)
| Title |
|---|
| JU-HEE KANG 等: "Simultaneous analysis of cerebrospinal fluid biomarkers using microsphere-based xMAP multiplex technology for early detection of Alzheimer’s disease", 《METHODS》 * |
| LUIS PENNANEN 等: "Different tau epitopes define A b42-mediated tau insolubility", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| LUKA KULIC 等: "Active immunization trial in AB 42-injected P301L tau transgenic mice", 《NEUROBIOLOGY OF DISEASE》 * |
| YUAN ZHANG 等: "The protective effects and underlying mechanism of an anti-oligomeric Aβ42 single-chain variable fragment antibody", 《NEUROPHARMACOLOGY》 * |
| YUNLONG ZHANG 等: "Directed Screening of Anti-Oligomeric Aβ42 Antibodies", 《JOURNAL OF NEUROLOGY & EXPERIMENTAL NEUROSCIENCE》 * |
| 抗Β-淀粉样蛋白(AΒ1-42)单克隆抗体杂交瘤细胞系的建立及初步鉴定: "周辉 等", 《第九次全国生物制品学术会议论文集》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115925923A (en) * | 2022-09-26 | 2023-04-07 | 吉林大学 | Single-chain antibody for catalyzing degradation of Abeta 42 oligomer, single-chain antibody gene and application thereof |
| CN115925923B (en) * | 2022-09-26 | 2023-09-15 | 吉林大学 | Single-chain antibody catalyzing degradation of Abeta 42 oligomer, single-chain antibody gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108484761B (en) | 2021-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110845603B (en) | Human collagen 17-type polypeptide, production method and use thereof | |
| CN109593126A (en) | Polypeptide, its production method and purposes | |
| CN105175526B (en) | Penetratin hPP8 and application thereof | |
| CN107245494A (en) | Solution expression with high efficiency and purification process of the A β 42 in Escherichia coli | |
| CN113087804B (en) | Bivalent plant immune fusion protein and production method and application thereof | |
| CN106834336A (en) | A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281 | |
| CN105112383A (en) | Cell membrane penetrating peptide hPP5 and application thereof | |
| CN110029118B (en) | Method for synthesizing quercetin-4' -glucoside | |
| US10519203B2 (en) | Gene for biosynthesis of core structure of ophiobolin | |
| US11702454B2 (en) | Multivalent plant immune fusion protein, production method thereof and its use | |
| CN111499759B (en) | Zinc finger protein-lactoferrin fusion protein with cell membrane penetrating property and preparation and application thereof | |
| CN108484761A (en) | A kind of specific recognition simultaneously induces the oligomer of A β 42 and single-chain antibody, single-chain antibody gene and its application of fibrinogen depolymerization | |
| CN104479013B (en) | A kind of single-chain antibody of anti-oligomer of A β 42 and the gene for encoding the single-chain antibody | |
| CN106755042A (en) | A kind of bioactive micro peptide preparation method based on combination self cleavage with albumen support | |
| CN110716035A (en) | Echinococcosis-resistant high-throughput drug screening method based on echinococcosis tubulin as target spot | |
| CN104788571B (en) | The fusion protein and its construction method and application that a kind of targeting antineoplastic vascular suppresses | |
| CN107779464A (en) | A kind of preparation method of human source copper-zinc superoxide dismutase | |
| CN112342224B (en) | Porphyra haitanensis glutamate dehydrogenase gene and application thereof | |
| CN107746432A (en) | A kind of modified proteins of A β 42 and its expression and purification method | |
| CN103804496B (en) | A kind of specific recognition in conjunction with the single-chain antibody of A β 42 oligomer and single-chain antibody gene | |
| CN109439638B (en) | Separated fish antiviral protein gene CMPK2 and antiviral activity thereof | |
| CN102898512A (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN108314719A (en) | A kind of antibacterial peptide CC313js, preparation method and application | |
| CN108864273A (en) | A kind of simulation human antibiotic peptide and preparation method thereof | |
| CN108753802A (en) | One malate dehydrogenase gene CIMDH1 and its recombinant expression carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |