CN108459163A - A kind of proximity ligation assay is used to quantitatively detect kit, the method for preparation and use of CRP contents - Google Patents
A kind of proximity ligation assay is used to quantitatively detect kit, the method for preparation and use of CRP contents Download PDFInfo
- Publication number
- CN108459163A CN108459163A CN201711271925.XA CN201711271925A CN108459163A CN 108459163 A CN108459163 A CN 108459163A CN 201711271925 A CN201711271925 A CN 201711271925A CN 108459163 A CN108459163 A CN 108459163A
- Authority
- CN
- China
- Prior art keywords
- crp
- kit
- probes
- preparation
- ligation assay
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4737—C-reactive protein
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of kit the present invention provides proximity ligation assay for quantitatively detecting CRP contents.The kit includes：CRP probe A, CRP probes B, connection buffer solution, qPCR reaction solutions；Preparation method the invention also discloses a kind of proximity ligation assay for quantitatively detecting CRP content kits, this method include：The preparation of CRP probes A, the preparation of CRP probes B；Finally also disclose the application method of the kit；Originally bright for the first time to apply proximity ligation assay method in the quantitative detection of CRP, compared with art methods, have many advantages, such as sensitivity height, high specificity, high throughput, the accuracy of the antidiastole of bacterium infection and non-bacterial infection can be improved, there is great market value.
Description
Technical field
A kind of content the present invention relates to proximity ligation assay for CRP in ion vitro immunization diagnosis detection human body, belongs to disease
Disease diagnosis detection field.
Background technology
C reactive protein (C-reactive protein, CRP) is one of Acute reaction protein, nineteen thirty U.S. Lip river
The Tillett and Fransic in gram laboratories Filler research institute AVERY have found serum energy and the Diplococcus pneumopniae of acute infection patient
Precipitation reaction occurs for the C polysaccharide on cell wall, and what rear confirmation participated in reaction is a kind of protein, therefore referred to as c reactive protein.
Serum CRP level be indicate bacterium infection a sensitivity and objective index.When bacterium infection, serum CA125
Level can in it is isocratic to significantly raised, positive rate is up to 90% or more.And CRP is horizontal how normal or slight when the infection such as virus
It increases, therefore the antidiastole of bacterium infection and non-bacterial infection can be helped.In addition, quantitative determination cerebrospinal fluid, pleural effusion
In CRP levels can also have the certain significance to meningitis, pleuritic antidiastole.Moreover, CRP levels also with infection
Range and infection severity have certain relationship.
The common method of detection CRP contents includes enzyme-linked immunosorbent assay and immunoturbidimetry etc. at present.These
Method haves the shortcomings that corresponding, and the detection sensitivity of enzyme-linked immunosorbent assay is relatively low, and there are liquid for immunoturbidimetry
Emulsion reagent stability is bad, and testing result accuracy is bad.And it is proposed by the present invention based on a kind of detection of proximity ligation assay
The immunodiagnosis detection method of CRP contents, have detection sensitivity high, detection high specificity, sample loss it is low, easy to operate,
The advantages such as detection device is common, are applied to the diagnosis of bacterium infection, can improve bacterium infection and differentiate with non-bacterial infection
Accuracy, have great market value.
Invention content
For the technical problems in the prior art, the present invention provides a kind of detection examination can be used for quantitative detection CRP
Agent box, its method of preparation and use.
The invention is realized by the following technical scheme：
A method of the kit for quantitatively detecting CRP contents based on proximity ligation assay is prepared, is included the following steps：
1) the CRP probes A of anti crp antibody coupling oligonucleotide；
2) the CRP probes B of anti crp antibody coupling oligonucleotide；
In the above-mentioned technical solutions, the anti crp antibody is the monoclonal antibody or Anti-TNF-α for CRP different epitopes
Body.
According to the CRP detection kits based on proximity ligation assay prepared described in any of the above technical solution.It is led
Form including：
1) CRP probes A；
2) CRP probes B；
3) buffer solution is connected；
4) qPCR reaction solutions.
The application method of kit described in any of the above technical solution, it is characterised in that：Include the following steps：
1) sample to be tested is added in reacting hole, adds CRP probe A and CRP probe B, be added after being incubated 5-30min
5-30min is reacted to connection buffer solution, is finally mixed with qPCR reaction solutions；
2) to it is above-mentioned 1) in end reaction liquid carry out qPCR, the Ct values of each reacting hole of survey calculation.
The reacting hole of this kit can be microwell plate, micro-fluidic reagent disc, reaction cup, reaction tube etc..
Description of the drawings
Fig. 1 is that a kind of kit of the proximity ligation assay provided in an embodiment of the present invention for quantitatively detection CRP contents is former
Manage schematic diagram, wherein 1- oligodeoxynucleotide, 2- coupling agents, 3- anti crp antibody, 4- determinands (CRP), 5- oligomerization deoxidations
Nucleotide, 6- coupling agents, 7- anti crp antibody, 8-Taqman fluorescence probes, 9-Taq enzymes.
Fig. 2 is a kind of kit inspection of the proximity ligation assay provided in an embodiment of the present invention for quantitatively detection CRP contents
Linear areal map.
Fig. 3 is a kind of kit knot of the proximity ligation assay provided in an embodiment of the present invention for quantitatively detecting CRP contents
Fruit correlation compares.
Specific implementation mode
Below with reference to attached drawing to a kind of proximity ligation assay of the present invention for the quantitatively kit of detection CRP contents, system
Standby and its application method is described in detail.
Embodiment 1
The preparation of CRP probes A：
1) 0.1mg anti crp antibody is taken to carry out total incubation 5-30min with DBCO-sulfo-NHS reagents；
2) 10 μ L 0.5mol/L Tris-HCl after reaction, are added, are incubated 5-10min to terminate reaction；
3) the above-mentioned antibody that is modified is added oligodeoxynucleotide a, 4 DEG C are incubated overnight to get to CRP probes A.
Embodiment 2
The preparation of CRP probes B：
1) 0.1mg anti crp antibody is taken to carry out total incubation 5-30min with DBCO-sulfo-NHS reagents；
2) 10 μ L 0.5mol/L Tris-HCl after reaction, are added, are incubated 5-10min to terminate reaction；
3) the above-mentioned antibody that is modified is added oligodeoxynucleotide b, 4 DEG C are incubated overnight to get to CRP probes B.
Embodiment 3
Kit mainly forms：
1) CRP probes A；
2) CRP probes B；
3) buffer solution is connected；
4) qPCR reaction solutions.
Embodiment 4
Kit application method, includes the following steps：
1) sample to be tested is added in reacting hole, adds CRP probe A and CRP probe B, be added after being incubated 5-30min
5-30min is reacted to connection buffer solution, is finally mixed with qPCR reaction solutions；
2) to it is above-mentioned 1) in end reaction liquid carry out qPCR, the Ct values of each reacting hole of survey calculation.
The reacting hole of this kit can be microwell plate, micro-fluidic reagent disc, reaction cup, reaction tube etc..
Embodiment 5
Kit method evaluation of the present invention：
1. linear
Compound concentration is the CRP standard items of 0 μ g/mL, 2 μ g/mL, 10 μ g/mL, 50 μ g/mL, 100 μ g/mL, 300 μ g/mL
Solution.It is separately added into 10 μ L standard items in reacting hole, 100 μ L CRP probe A are added, is added 100 μ L CRP probes B, 37 DEG C
It incubates 10 minutes.After incubation, after 20 μ L connection buffer solutions reaction 10min is added, the progress of 20 μ L qPCR reaction solutions is added
QPCR reacts, the Ct values of each reacting hole of survey calculation.
Using Ct values as ordinate, standard concentration is abscissa, draws standard working curve (see attached drawing 2).
2. accuracy
Correlation compares：As shown in figure 3, being with the correlation of Japanese ponding CRP kits：Y=1.013x+0.893, R2
=0.998.
The present invention is compared with existing method and product, and with detection sensitivity height, specificity is good, cost is relatively low, to detection
The low advantage of instrument requirements.
The above description is merely a specific embodiment, but scope of protection of the present invention is not limited thereto, any
Those familiar with the art within the technical scope disclosed by the invention, the change or replacement that can be readily occurred in, all
It is covered by the protection scope of the present invention.
Claims (10)
1. kit, method of preparation and use of a kind of proximity ligation assay for quantitatively detecting CRP contents, it is characterised in that：
1) kit mainly forms：CRP probe A, CRP probes B, connection buffer solution, qPCR reaction solutions；
2) application method：Sample to be tested is added in reacting hole, CRP probe A and CRP probe B are added, is incubated 5-30min
After be added to connection buffer solution reaction 5-30min, finally mixed with qPCR reaction solutions；
3) detection method：To it is above-mentioned 2) in end reaction liquid carry out qPCR, the Ct values of each reacting hole of survey calculation.
2. a kind of preparation method of proximity ligation assay for the quantitatively kit of detection CRP contents, which is characterized in that including such as
Lower step：
1) preparation of CRP probes A；
2) preparation of CRP probes B.
3. CRP probes A according to claim 1 and probe B are the oligodeoxynucleotide of anti crp antibody coupling.
4. anti crp antibody according to claim 3 is the monoclonal antibody or polyclonal antibody for CRP different epitopes.
5. the oligodeoxynucleotide a sequences on CRP probes A according to claim 3 are：5’-
GCATTGATCTAGTCATTCTAGTTATGTAGGGCCAACGACGACTGCAGATGAATTAATGAGGA-3’。
6. the oligodeoxynucleotide b sequences on CRP probes B according to claim 3 are：5’-
CGTAGCCGGCATATGGTACGACGACATGTACAGATACGACTGACGATCAGTACGTTTAAGGATAC-3’。
7. a kind of kit of the proximity ligation assay according to claim 1 for quantitatively detecting CRP contents, feature exist
In the connection buffer solution in the kit is 0.02%BSA, 20mmol/L Tris, 50mmol/L KCl, 20mmol/
LMgCl2, 0.03U/ μ L DNA ligases, 100mmol/L oligonucleotides bridge chains.
8. the sequence of oligonucleotide bridge chain is 5 '-according to claim 7
TCGTACCATATGCCGGCTACGTCCTCATTAATTCATCTG-3’。
9. a kind of kit of the proximity ligation assay according to claim 1 for quantitatively detecting CRP contents, feature exist
In the qPCR reaction solutions in the kit are poly- comprising PCR forward primers, PCR reverse primers, TaqMan probe, Taq DNA
Synthase.
10. PCR forward primers sequence according to claim 9 is 5 '-ATTGATCTAGTCATTCTAGTTATG-3 ', PCR
Reverse primer sequences are 5 '-ATCCTTAAACGTACTGATCGTCAGTCG-3 ', TaqMan probe sequences are 5 '-
TGAATTAATGAGGACGTAGCCGGCATATGGTAC-3’。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711271925.XA CN108459163A (en) | 2017-11-27 | 2017-11-27 | A kind of proximity ligation assay is used to quantitatively detect kit, the method for preparation and use of CRP contents |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711271925.XA CN108459163A (en) | 2017-11-27 | 2017-11-27 | A kind of proximity ligation assay is used to quantitatively detect kit, the method for preparation and use of CRP contents |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108459163A true CN108459163A (en) | 2018-08-28 |
Family
ID=63220500
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711271925.XA Pending CN108459163A (en) | 2017-11-27 | 2017-11-27 | A kind of proximity ligation assay is used to quantitatively detect kit, the method for preparation and use of CRP contents |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108459163A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113528611A (en) * | 2021-06-01 | 2021-10-22 | 上海交通大学 | Protein detection kit and detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104280556A (en) * | 2014-10-31 | 2015-01-14 | 杨子学 | Detection method and kit for simultaneously determining content of lipoprotein phospholipase A2 and C reactive protein in blood plasma |
-
2017
- 2017-11-27 CN CN201711271925.XA patent/CN108459163A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104280556A (en) * | 2014-10-31 | 2015-01-14 | 杨子学 | Detection method and kit for simultaneously determining content of lipoprotein phospholipase A2 and C reactive protein in blood plasma |
Non-Patent Citations (1)
| Title |
|---|
| MARTIN LUNDBERG等: "Multiplexed Homogeneous Proximity Ligation Assays for High-throughput Protein Biomarker Research in Serological Material", 《MOLECULAR & CELLULAR PROTEOMICS》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113528611A (en) * | 2021-06-01 | 2021-10-22 | 上海交通大学 | Protein detection kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ye et al. | Equipment-free nucleic acid extraction and amplification on a simple paper disc for point-of-care diagnosis of rotavirus A | |
| Hogan et al. | Comparison of the Panther Fusion and a laboratory-developed test targeting the envelope gene for detection of SARS-CoV-2 | |
| US7294466B2 (en) | Multiplexed detection of biological agents | |
| JP4976429B2 (en) | Human papillomavirus detection kit and method using oligonucleic acid probe bead array | |
| CN102399877B (en) | Staphylococcus aureus methicillin resistant strain PCR (Polymerase Chain Reaction) detection kit | |
| Peri et al. | New microbiological techniques for the diagnosis of bacterial infections and sepsis in ICU including point of care | |
| CN102507918B (en) | Kit for determining anti-cyclic citrullinated peptide (Anti-CCP) antibody | |
| Zhao et al. | Establishment and application of multiple cross displacement amplification coupled with lateral flow biosensor (MCDA-LFB) for visual and rapid detection of Candida albicans in clinical samples | |
| CN108913792A (en) | Primer and probe and its kit and method based on digital pcr technology detection Streptococcus suis | |
| CN110331209A (en) | Application of the biomarker in adenocarcinoma of lung diagnosis | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| Quigley et al. | Rate of detection of high-risk HPV with two assays in women≥ 30 years of age | |
| CN108459163A (en) | A kind of proximity ligation assay is used to quantitatively detect kit, the method for preparation and use of CRP contents | |
| GB2513507A (en) | Colorectal cancer diagnosis and indication marker | |
| CN115948544B (en) | Use of CITED4 and/or METRN in differential diagnosis of the degree of disc degeneration | |
| Idris et al. | Evaluating the sensitivity of presumptive and confirmatory tests for body fluids | |
| CN101955991A (en) | Joint detection method of fusion genes related to leukemia and diagnosis kit | |
| CN102337352B (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN108956991A (en) | A kind of fluorescence resonance energy transfer biosensor and its application | |
| CN111647690B (en) | RT-RAA primer pair and diagnostic kit for detecting COVID-19 virus | |
| WO2018085363A2 (en) | Cd147 detection in diagnostic, prognostic and monitoring methods for multiple myeloma | |
| CN102181566A (en) | Real-time fluorescence quantitative PCR (Polymerase Chain Reaction) kit for detecting candida tropicalis | |
| CN102154511A (en) | Preparation method and application of reagent for detecting novel type A H1N1 2009 influenza virus with one-step method | |
| CN105886618A (en) | Method for quantitatively detecting mercury ions in liquid sample and kit | |
| CN108220390A (en) | A kind of proximity ligation assay is for the quantitatively kit of detection Cys C contents, method of preparation and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180828 |
|
| WD01 | Invention patent application deemed withdrawn after publication |