CN105886618A - Method for quantitatively detecting mercury ions in liquid sample and kit - Google Patents
Method for quantitatively detecting mercury ions in liquid sample and kit Download PDFInfo
- Publication number
- CN105886618A CN105886618A CN201610251998.1A CN201610251998A CN105886618A CN 105886618 A CN105886618 A CN 105886618A CN 201610251998 A CN201610251998 A CN 201610251998A CN 105886618 A CN105886618 A CN 105886618A
- Authority
- CN
- China
- Prior art keywords
- amplification
- pcr
- isothermal
- mercury ion
- microdroplet
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for quantitatively detecting mercury ions in a liquid sample and a kit for quantitatively detecting the mercury ions. The absolute quantitative detection of the mercury ions can be performed through a quantitative detection method based on a biosensor and a droplet polymerase chain reaction (PCR) technology and the detection kit, the quantitative detection limit can reach 40 fmol, the sensitivity can reach 10 fmol, and the requirements of actually detecting of the mercury ions can be met. In addition, the method is simple to operate and high in flexibility and is an effective method for performing absolute quantitative detection of the mercury ions.
Description
Technical field
The present invention relates to technical field of molecular biological detection, concrete, relate to a kind of quantitatively inspection
Survey method and the test kit of mercury ion in fluid sample.
Background technology
In heavy metal ion in all of water, mercury ion is all human body to be had serious harm
One of metal ion.Present stage has been developed for the substantial amounts of detection side for trace amount mercury ion
Method.In the recent period, detection method based on biosensor is with its relatively simple operation and relatively low
Cost has been achieved for quickly being in progress.Most sensor is all based on physics or chemistry
Signal is converted into nucleic acid signal, and therefore, biosensor provides a kind of by detection nucleic acid letter
Number method detecting content of beary metal.
Generation form based on nucleic acid signal, biosensor can be divided into " open form (turn-on) "
Sensor and " pass type (turn-off) " sensor.For " pass type " sensor, due to
Its nucleic acid signal is as the increase of testing goal material and reduces, so this kind of detection method
Be easier to by detection sample in fluorescence interference factor affected, thus cause false positive or
False-negative result.Therefore, " open form " sensor is more suitable for actually detected needs.Recently,
A kind of biosensor based on T-Hg-T structure develops and is widely used.
This structure can be with the mercury ion of specific combining prescribed amt, and by the core of ad hoc structure
The conversion of acid signal reaches the purpose of mercury ion detecting.Current such biosensor is
Through square with fluoroscopic examination, isothermal detection, G-tetra-weight structure, micro-fluidic chip, electrochemistry etc.
Method combines and have developed various types of detection method.For actually detected work,
We need the mercury ion to trace to carry out quantitatively, such that it is able to hydrargyrum in sample or sewage from
Whether son exceeds standard is made mark.But above all methods are all to need by different gradients
Sample carry out gradient dilution and just can obtain quantitative result, can be by artificial during this
The impact of the series of factors such as operation.Therefore a kind of heavy metal not relying on standard curve is developed
Ion detection method is the most necessary.
For mercury ion absolute quantitation detect for, detection method have to comply with following some want
Ask: it must be linear that (1) mercury ion signal is converted into the process of nucleic acid signal, and this
The signal enrichment that affects of step also must be controlled；(2) follow-up detection method must be a kind of
Do not rely on the detection method of standard curve.Microdroplet PCR is that a kind of novel PCR expands skill
Art.This method, by primitive reaction system being split, makes the template in original system divide
Son has also been assigned in different little reaction systems, after PCR EP (end of program), is examined by streaming
Measurement equipment measures the fluorescence signal value of each reaction system, determines negative microdroplet after unified Analysis
With the number of positive microdroplet, by Poisson distribution so that it is determined that purpose fragment in whole reaction system
Copy number.Microdroplet PCR due to the operation of its simplicity, stable amplification and can carrying out
The advantage of absolute quantitation, present stage has been obtained for quickly developing, and it is in Single Molecule Detection,
The aspects such as gene library amplification have been achieved for the biggest progress.Can borrow owing to it is follow-up
The fluorescence detection method of fluidizer formula also can realize absolute quantitation by mathematical statistics, so microdroplet
PCR is also considered as a kind of replacement method of important quantitative PCR.
It is therefore desirable to provide a kind of for mercury ion based on biosensor and microdroplet PCR
Quantitative detecting method.
Summary of the invention
It is an object of the invention to provide a kind of that be made without sample pre-treatments step, and not
Depend on the mercury ion detecting method of Specification Curve of Increasing, it is achieved to mercury ion in testing sample
Absolute quantitation.
In order to reach object above, the invention provides in a kind of quantitative detecting liquid sample hydrargyrum from
The method of son, said method comprising the steps of:
(1) with liquid sample as template solution, mercury ion biosensor is utilized to carry out
Isothermal PCR amplification obtains system after the amplification containing isothermal PCR amplified production；
(2) utilize ultra-pure water that system after described amplification is carried out 108Dilution again, it is thus achieved that final
Dilution after material, after described dilution, material is as template solution, utilizes microdroplet PCR to expand
Increase primer and probe carries out microdroplet PCR amplification, gather the fluorescence letter that microdroplet PCR amplification produces
Number, determine that fluorescence threshold is to obtain positive amplification hole count according to the fluorescence of negative hole；
(3) formula I is utilized to calculate after each amplification copying of isothermal pcr amplification product in system
Shellfish number, in formula I, A is the copy number of isothermal pcr amplification product in system after amplification,
N0For always expanding hole count, X is positive amplification hole count；
Formula I:A=-ln [(N0-X)/N0]×N0
(4) utilizing formula II to calculate the concentration of mercury ion in sample, in formula II, n makes a living
Can form the quantity of T-Hg-T structure in thing sensor, A is isothermal PCR in system after amplification
The copy number of amplified production, ER is ion concentration of mercury in fluid sample:
Formula II: ER=nA/4816.
Preferably, in step (1), the system of isothermal PCR amplification is:
In method provided by the present invention, described liquid sample can be directly to gather
Initial liquid sample, testing sample kind can be blood serum sample and Natural Water sample.
Wherein, the purpose being diluted system after described amplification is the amount making purpose nucleic acid fragment
Meet the detection range of digital pcr, it is preferred that by system dilution 10 after described amplification8Times
Time, there is optimal Detection results.
Wherein, the step of isothermal PCR amplification includes: first by liquid sample, mercury ion
Biosensor and ddH2After O contact mixing, at 95 DEG C, temperature bath 4.5-5.5min obtains temperature bath
Rear system, adds Klenow large fragment isothermal and expands after system is cooled to 25 DEG C after described temperature being bathed
Increase enzyme, isothermal PCR buffer and dNTPs, obtain at 37 DEG C of temperature bath 1.8-2.2h after mixing
System after amplification containing isothermal PCR amplified production.
Optionally, the system of microdroplet PCR amplification is:
Optionally, the condition of microdroplet PCR reaction includes existing described microdroplet PCR amplification system
50 DEG C of hot activation 300s, 95 DEG C of denaturations 300s, 95 DEG C of degeneration 15s, anneal and prolong for 60 DEG C
Stretch 60s, totally 50 circulations, at 60 DEG C, finally gather fluorescence signal.
In method provided by the present invention, described microdroplet PCR generates chip at microdroplet PCR
On carry out, concrete may comprise steps of, and is first expanded by microdroplet PCR described in 20 μ L
Increasing system joins microdroplet PCR and generates on chip, adds the microdroplet generation oil of 70 μ L,
Carry out microdroplet generation step, after completing microdroplet generation step, the reaction system of microdroplet is shifted
To 96 orifice plates, sealer, 96 orifice plates after sealer are put into PCR amplification instrument is carried out micro-
Drip PCR amplification.After completing microdroplet PCR amplification, microdroplet is sucked in streaming fluorescence detector
Carry out fluoroscopic examination.Wherein, described microdroplet PCR generates chip and described microdroplet generation oil
Can be well known in the art be suitable for carrying out the commercial prod of microdroplet PCR reaction.
The decision method of threshold value is the fluorescence threshold determining reaction according to the fluorescent value of negative sample
To distinguish the negative bright spot in reaction and positive bright spot.
Wherein, in step (3), the copy number in each sample is by positive amplification hole
The ratio of number and total amplification hole count determines.Public by the Poisson distribution as shown in formula I
Formula calculates after amplification in system after the copy number of isothermal pcr amplification product by the meter of ER value
Calculate in the absolute content obtaining heavy metal ion, last calculated ER numerical value and sample
Ion concentration of mercury is equal, and in formula, the concentration of mercury ion is in units of pmol.
This detection system reaction principle is as shown in Figure 1.Detection system mainly includes three parts:
Biosensor isothermal extends step, microdroplet PCR step, microdroplet fluorescence read step.?
In first step, by biosensor, mercury ion signal is converted into nucleic acid signal, real
The linear signal conversion of existing mercury ion.Another one aspect, the structure of T-Hg-T is at relatively low temperature
Can keep stable under Du.So the inscribe that the present invention chooses in isothermal PCR amplification step
Enzyme is that Klenow large fragment expands enzyme.After isothermal extends, hairpin structure is blunted into flush end,
Thus produce primer binding site.After isothermal process terminates, the product of the first step is carried out
As the template of second step microdroplet PCR amplification after dilution.Only the first step is through sending out of extending
Card structure can produce the amplified signal of the positive in this step.Microdroplet PCR step terminates
After, by reading positive amplification hole count, can reach purpose fragment is carried out absolute quantitation
Purpose.
In method provided by the present invention, the T-Hg-T that biosensor interior sequences comprises
The quantity of structure can produce impact to the quantitation capabilities of final testing result and amplification performance, excellent
Choosing, described mercury ion biosensor be T-Hg-T quantity be the biosensor of 5.
In the present invention, when in liquid sample ion concentration of mercury at 40fmol to 40pmol
Time, ER is the most linear Y=0.963X+0.153, linear phase along with the concentration of mercury ion has
Close coefficients R2=0.992.This explanation, when ion concentration of mercury is positioned at 40fmol to 40pmol,
ER presents linear increase along with the increase of ion concentration of mercury, and in data ER value with
Ion concentration of mercury identical (pmol is unit).The present invention has low-down detection by quantitative line can
Needs with the actually detected sample of the satisfied overwhelming majority.
Preferably, the nucleotide sequence such as SEQ ID NO.1 of described mercury ion biosensor
Shown in.
Described, microdroplet pcr amplification primer thing and probe sequence be:
Forward primer Hg-F-5:CCCAACCCGCCCTACC；
Downstream primer Hg-R-5:TACCCGCTGAGGTTAAACAAC；
Probe Hg-P-5:FAM-GCTGAGGTTTTTCTTCCCCAGACCCTCTG-BQ1.
Present invention also offers a kind of mercury ion immue quantitative detection reagent box, described test kit contains hydrargyrum
Ion biosensor and microdroplet pcr amplification primer thing and probe:
Wherein, the nucleotide sequence such as SEQ ID NO.1 institute of described mercury ion biosensor
Show.
Microdroplet pcr amplification primer thing and probe sequence be:
Forward primer Hg-F-5:CCCAACCCGCCCTACC,
Downstream primer Hg-R-5:TACCCGCTGAGGTTAAACAAC,
Probe Hg-P-5:FAM-GCTGAGGTTTTTCTTCCCCAGACCCTCTG-BQ1.
Preferably, described test kit also includes dNTPs, Taq archaeal dna polymerase, Klenow
Large fragment isothermal duplication enzyme, Mg2+, PCR reaction buffer.
Mercury ion in detected sample can directly be carried out fixed by method provided by the present invention
Amount detection, thus eliminate the sample pre-treatments step in conventional instrument detection and sensor
The step needing standard curve in detection so that detection process is simple and easy to do, it is to avoid numerous
The trivial operation harmful effect to testing result accuracy.It addition, in the methods of the invention,
By defining ER parameter, it is the most fixed directly can be carried out mercury ion by the calculating of ER
Amount, greatly simplify reactions steps.
Utilize that the present invention provides based on biosensor and the detection by quantitative of microdroplet round pcr
Method and detection kit can realize the detection of the absolute quantitation to mercury ion, and detection by quantitative limit can
Reaching 40fmol, sensitivity can reach 10fmol, it is possible to meets the need that mercury ion is actually detected
Want.Additionally, this method is simple to operate, motility is strong, is that one realizes mercury ion absolute quantitation
The effective ways of detection.
Accompanying drawing explanation
Fig. 1 is based on biosensor and the schematic diagram of microdroplet PCR reaction system.
Fig. 2 is the disparity map of the secondary structure after biological sensor sequence is combined with mercury ion.
2+ in figure, 2-are T-Hg-T structure when being two, containing mercury ion with without mercury ion
Circular dichroism spectra curve；5+, 5-be T-Hg-T structure be four；7+, 7-are that T-Hg-T structure is
Seven.
Fig. 3 is the difference of the expanding effect of different biosensors；
Wherein a is the biosensor mercury ion gradient dilution amplification containing 2 T-Hg-T structures
Curve (circular lines), b is the biosensor containing 5 T-Hg-T structures, and c is containing 7
The biosensor of T-Hg-T structure.
Fig. 4 is the optimization figure for affecting quantitative effect factor；
Wherein a is the optimization to isothermal proliferation time, and b is to biosensor sequence final concentration
Optimize；Line with circle is the condition group finally chosen.
Fig. 5 is the amplification hotspot graph of microdroplet PCR；In a-h figure, ion concentration of mercury is from low to high；
In figure, vertical coordinate is Chi amplitude (Chi Amplitude), and abscissa is event number
(Event Number)。
Fig. 6 is the scatterplot graph of a relation between quantification range and ER and mercury ion addition；
Wherein, Fig. 6 a is the linear relationship chart between mercury ion amount and ER value；Fig. 6 b be hydrargyrum from
Scatterplot between son amount and ER value；Abscissa is the amount of mercury ion present in original system,
Vertical coordinate is the ER value calculated by this detection system.
Fig. 7 is the specificity verification figure of detecting system.
Fig. 8 is the proof diagram of the interfering ion impact of detecting system, and in figure, Positive is positive right
According to.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention is described in detail.Following example are used for
The present invention is described, but is not limited to the scope of the present invention.If not specializing, in embodiment
The conventional means that technological means used is well known to those skilled in the art, raw materials used is city
Sell commodity.As Sambrook equimolecular Cloning: A Laboratory Manual (Sambrook J&Russell DW,
Molecular cloning:a laboratory manual, 2001), or according to manufacturer's description
The condition of suggestion.
Embodiment 1 is used for mercury ion based on biosensor and the biology of microdroplet PCR detection by quantitative
Sensor sequence and primer and the design of probe combinations
Hairpin structure within biosensor is set according to reaction principle, and carries out difference
The optimization of T-Hg-T structure, designs different mercury ion biosensor sequences: SEQ.1-3；
Design amplimer probe groups: SEQ.4-12.
Embodiment 2 for mercury ion detecting based on biosensor and microdroplet PCR detection by quantitative
The foundation of method
1.1 experiment material
The mercury ion standard sample and the solution that use in the present embodiment are purchased from sigma company.Micro-
Drip relevant for PCR SuperMix, microdroplet generates chip and is purchased from Bio-Rad company, isothermal
Amplification enzyme and its buffer are purchased from NEB company.
1.2 biosensor isothermals extend
Isothermal duplication system is test serum 2 μ L, 10 μMs of mercury ion biosensor 2 μ L,
10 × isothermal PCR buffer 2 μ L, dNTP mixed liquor 2 μ L, Klenow large fragment isothermal expands
Increase enzyme 0.2 μ L, ddH2O complements to 20 μ L.First by solution to be measured, bio-sensing during operation
After device, three kinds of composition mixings of water at 95 DEG C after temperature bath 5min, slow cooling under room temperature,
After being down to room temperature, add isothermal duplication enzyme, buffer, tri-kinds of components of dNTPs, mix rearmounted
In 37 DEG C of temperature bath 2h.After taking out product, carry out 108Dilution again is for follow-up microdroplet PCR
Reaction.
1.3 microdroplet pcr amplification reactions
(1) configuration microdroplet PCR reaction system.The reaction system of microdroplet pcr amplification reaction with
20 μ L are calculated as 10 μ L 2 × SuperMix, 10 μMs of each 0.8 μ L of upstream and downstream primer, 10 μMs
Probe 0.4 μ L, through the product 2 μ L, ddH of the step 1.2 of dilution2O complements to 20 μ L.
(2) on the generation chip of microdroplet PCR, the reaction of the previous step of 20 μ L is added
System, adds the microdroplet generation oil of 70 μ L, carries out microdroplet generation step, complete microdroplet
After generation step, the reaction system of microdroplet is transferred in 96 orifice plates, sealer.
(3) putting in PCR amplification instrument by 96 orifice plates after sealer, PCR amplification program is 50 DEG C
Hot activation 300s；95 DEG C of denaturations 300s；95 DEG C of degeneration 15s, 60 DEG C of annealing and extension 60
S, totally 50 circulations；
(4), after completing PCR amplification, microdroplet is sucked in streaming fluorescence detector, at 60 DEG C
Carry out fluoroscopic examination.
1.4 data analysis
After digital pcr has expanded, gather the fluorescence signal that all samples amplification produces.Warp
The system of mistake automatically analyzes, and sets fluorescence threshold to distinguish feminine gender according to the fluorescent value in negative reaction hole
Point and positobe focus.
Copy number in each sample is by positive amplification hole count and total ratio expanding hole count
Determine.By Poisson distribution formula calculating actual copy number: A=-ln [(N0-X)/
N0]×N0.In above-mentioned formula, A is the copy number in each sample, N0For always expanding hole count,
X is positive amplification hole count.By the absolute content calculating acquisition heavy metal ion of ER value,
ER computing formula is as follows: ER=nA/4816.T-Hg-T can be formed during wherein n is biosensor
The quantity of structure, A is the copy number in each sample.Last calculated ER numerical value with
The concentration of mercury ion equal (in units of pmol) in sample.
1.5 sensor sequence are on reaction result and the impact of secondary structure
In this detection system, the number of the T-Hg-T structure that biosensor interior sequences comprises
Amount can produce impact to the quantitation capabilities of final testing result and amplification performance, so this detection
This respect has been carried out excellent by the method for circular dichroism spectra and quantitative PCR before checking by system
Change.
1.5.1 the circular dichroism detector mensuration to sensor sequence secondary structure
Owing to the quantity of different T-Hg-T structures can cause the binding capacity of different mercury ions, institute
The circular dichroism spectra method for measuring biosensor sequence to different T-Hg-T numbers is passed through with us
Row have carried out the analysis of secondary structure.
The analysis result of circular dichroism spectra is as shown in fig. 2, it can be seen that the chromatographic curve of blank group
Making a big difference compared to the chromatographic curve adding mercury ion, this explanation, after adding mercury ion
Really the secondary structure of biosensor can be produced impact.It addition, when biosensor sequence
In when having the T-Hg-T structure of varying number, the secondary structure of biosensor can produce substantially
Difference, from chromatogram analyze, along with the increase of T-Hg-T number of structures, chromatographic curve
Can move to the right.
1.5.2 the quantitative PCR analysis to different sensors amplification performance
The quantity of T-Hg-T structure can be to the stable generation of hairpin structure and the combination of mercury ion
Quantity produces impact, thus can further affect amplification performance and the range of linearity of system.
This experiment uses quantitative PCR to the optimizing evaluation of detection system as it is shown on figure 3, by scheming
3 it can be seen that be optimized the sensor sequence that T-Hg-T quantity is 2,5,7,
When T-Hg-T quantity is 2, quantitative PCR there is no positive findings, and this explanation is worked as
When T-Hg-T number of structures is 2, biosensor can not form stable secondary structure, this
The data of some circular dichroism spectra before us can also draw.When T-Hg-T quantity is 7,
From quantitative PCR, the experiment of the range of linearity can be drawn, bigger T-Hg-T number of structures meeting
The range of linearity is produced negative impact.T-Hg-T quantity is the biosensor sequence energy of 5
Enough obtain optimal testing result.
The optimization of 1.6 reaction systems
In order to improve the sensitivity of reaction, the optimization of reaction system, optimizing factors are preferentially carried out
For the addition of time of isothermal reaction and biosensor, (T-Hg-T quantity is the life of 5
Thing sensor sequence).
As shown in Figure 4, the isothermal duplication time is 2h to optimum results, and sensor is final concentration of
When 0.6 μM, reaction result reaches optimal.
The checking of 1.7 detection system quantitation capabilities
Owing to the sensor of mercury ion can realize nucleic acid signal in certain concentration range
Linear transfor.Therefore, we test in this section the range of linearity to our detection system and
Linearity test limit is verified.
The amplification hotspot graph of microdroplet PCR is as it is shown in figure 5, the standard of ER value and ion concentration of mercury
Curve chart and scatterplot are as shown in Figure 6.When ion concentration of mercury is at 40fmol to 40pmol,
ER is the most linear Y=0.963X+0.153, linear correlation system along with the concentration of mercury ion has
Number R2=0.992.This explanation, when ion concentration of mercury is positioned at 40fmol to 40pmol, ER
Present linear increase along with the increase of ion concentration of mercury, and in data ER value and hydrargyrum from
Sub-concentration identical (pmol is unit).
1.8 specific checkings
For actually detected method, specificity has considerable status.This detection bodies
System carries out verifying the specificity of this detection system, method by several frequently seen heavy metal ion
Same 1.1-1.4.
Ag+, Ni2+, Co2+, Cd2+, Fe2+, Cu2+, Zn2+, Pb2+, Fe3+And Cr6+With
Specificity verification in this detection system.The result is as it is shown in fig. 7, can from the result of Fig. 7
To find out, this research system is fine at the specificity of above several heavy metal ion, remaining weight
Almost without the generation of positive assay signal in metal ion.
The impact on detection by quantitative of 1.9 interfering ions
Have very in different heavy metal ion owing to experiment before demonstrates this research system
Strong specificity, so in order to reduce experimental cost, in this part, copper ion is disturbed
The research of ion.
Interfering ion confirmatory experiment is as shown in Figure 8.By testing result it can be seen that do the most at last
Disturb the suitable height of ion concentration (100 times), also detection by quantitative result will not be produced significantly
Impact.
The checking of 1.10 sensitivity
Use the method identical with 1.1-1.4, verify the sensitive of detection system by gradient dilution
Degree, testing result is as shown in table 1 below, as it can be seen from table 1 when mercury ion amount is at 10fmol
Time, detection group can produce significantly difference with feminine gender group.
Table 1
The checking of 1.11 actual samples
Actual sample has been done and has verified to determine the practicality of this detection system, method by this experiment
Same 1.1-1.4.Actually detected by blood serum sample and sewage sample, result such as table 2 below
Shown in, this detection system all has good quantitative effect for the mercury ion of different substrates.
Table 2
Although, the most with a general description of the specific embodiments the present invention has been made in detail
Most description, but on the basis of the present invention, it can be made some modifications or improvements, this is right
It is apparent from for those skilled in the art.Therefore, without departing from spirit of the present invention
On the basis of these modifications or improvements, belong to the scope of protection of present invention.
Claims (10)
1. the method for mercury ion in a quantitative detecting liquid sample, it is characterised in that described
Method comprises the following steps:
(1) with liquid sample as template solution, mercury ion biosensor is utilized to carry out
Isothermal PCR amplification obtains system after the amplification containing isothermal PCR amplified production；
(2) utilize ultra-pure water that system after described amplification is carried out 108Dilution again, it is thus achieved that final
Dilution after material, after described dilution, material is as template solution, utilizes microdroplet PCR to expand
Increase primer and probe carries out microdroplet PCR amplification, gather the fluorescence letter that microdroplet PCR amplification produces
Number, determine that fluorescence threshold is to obtain positive amplification hole count according to the fluorescence of negative hole；
(3) formula I is utilized to calculate after each amplification copying of isothermal pcr amplification product in system
Shellfish number, in formula I, A is the copy number of isothermal pcr amplification product in system after amplification,
N0For always expanding hole count, X is positive amplification hole count；
Formula I:A=-ln [(N0-X)/N0]×N0
(4) utilizing formula II to calculate the concentration of mercury ion in sample, in formula II, n makes a living
Can form the quantity of T-Hg-T structure in thing sensor, A is isothermal PCR in system after amplification
The copy number of amplified production, ER is ion concentration of mercury in fluid sample:
Formula II: ER=nA/4816.
Method the most according to claim 1, it is characterised in that isothermal in step (1)
The system of PCR amplification is:
Method the most according to claim 2, it is characterised in that isothermal PCR amplification
Step includes: first by liquid sample, mercury ion biosensor and ddH2O contact is mixed
After even, at 95 DEG C, temperature bath 4.5-5.5min obtains system after temperature bath, system after described temperature being bathed
After being cooled to 25 DEG C add Klenow large fragment isothermal duplication enzyme, isothermal PCR buffer and
DNTPs, obtains containing isothermal PCR amplified production at 37 DEG C of temperature bath 1.8-2.2h after mixing
System after amplification.
4. according to the method described in any one in claim 1-3, it is characterised in that micro-
The system dripping PCR amplification is:
Method the most according to claim 4, it is characterised in that microdroplet PCR amplification is anti-
The condition answered includes described microdroplet PCR amplification system at 50 DEG C of hot activation 300s, and 95 DEG C pre-
Degeneration 300s, 95 DEG C of degeneration 15s, 60 DEG C of annealing and extension 60s, totally 50 circulations, finally
Fluorescence signal is gathered at 60 DEG C.
6. according to the method described in any one in claim 1-3 and 5, it is characterised in that
Described mercury ion biosensor be T-Hg-T quantity be the biosensor of 5.
Method the most according to claim 6, it is characterised in that described mercury ion is biological
The nucleotide sequence of sensor is as shown in SEQ ID NO.1.
Method the most according to claim 7, it is characterised in that microdroplet pcr amplification primer
Thing and probe sequence be:
Forward primer Hg-F-5:CCCAACCCGCCCTACC；
Downstream primer Hg-R-5:TACCCGCTGAGGTTAAACAAC；
Probe Hg-P-5:FAM-GCTGAGGTTTTTCTTCCCCAGACCCTCTG-BQ1.
9. a mercury ion immue quantitative detection reagent box, it is characterised in that biological containing mercury ion
Sensor and microdroplet pcr amplification primer thing and probe:
Wherein, the nucleotide sequence such as SEQ ID NO.1 institute of described mercury ion biosensor
Show；
Microdroplet pcr amplification primer thing and probe sequence be:
Forward primer Hg-F-5:CCCAACCCGCCCTACC；
Downstream primer Hg-R-5:TACCCGCTGAGGTTAAACAAC；
Probe Hg-P-5:FAM-GCTGAGGTTTTTCTTCCCCAGACCCTCTG-BQ1.
Mercury ion immue quantitative detection reagent box the most according to claim 9 also includes
DNTPs, Taq archaeal dna polymerase, Klenow large fragment isothermal duplication enzyme, Mg2+、PCR
Reaction buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610251998.1A CN105886618B (en) | 2016-04-21 | 2016-04-21 | The method and kit of mercury ion in a kind of quantitative detecting liquid sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610251998.1A CN105886618B (en) | 2016-04-21 | 2016-04-21 | The method and kit of mercury ion in a kind of quantitative detecting liquid sample |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105886618A true CN105886618A (en) | 2016-08-24 |
| CN105886618B CN105886618B (en) | 2019-06-04 |
Family
ID=56704133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610251998.1A Active CN105886618B (en) | 2016-04-21 | 2016-04-21 | The method and kit of mercury ion in a kind of quantitative detecting liquid sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105886618B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108844951A (en) * | 2018-06-28 | 2018-11-20 | 中国农业大学 | A kind of mercury ion detecting product, method and smart phone Image analysis system |
| CN109632754A (en) * | 2019-01-15 | 2019-04-16 | 中国农业大学 | A kind of mercury ion colorimetric detection method based on copper nano-cluster |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103558202A (en) * | 2013-11-21 | 2014-02-05 | 常熟理工学院 | Method for determining concentration of mercury ions in sample |
| CN103969250A (en) * | 2014-05-23 | 2014-08-06 | 北京师范大学 | Method for detecting Hg<2+> with signal-off chemiluminescence method |
-
2016
- 2016-04-21 CN CN201610251998.1A patent/CN105886618B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103558202A (en) * | 2013-11-21 | 2014-02-05 | 常熟理工学院 | Method for determining concentration of mercury ions in sample |
| CN103969250A (en) * | 2014-05-23 | 2014-08-06 | 北京师范大学 | Method for detecting Hg<2+> with signal-off chemiluminescence method |
Non-Patent Citations (2)
| Title |
|---|
| 朱鹏宇: "利用微滴数字PCR定量检测食品或饲料样品", 《农业生物技术学报》 * |
| 邓大庆 等: "基于 DNA 发夹结构的新型汞离子生物传感器", 《化学试剂》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108844951A (en) * | 2018-06-28 | 2018-11-20 | 中国农业大学 | A kind of mercury ion detecting product, method and smart phone Image analysis system |
| CN109632754A (en) * | 2019-01-15 | 2019-04-16 | 中国农业大学 | A kind of mercury ion colorimetric detection method based on copper nano-cluster |
| CN109632754B (en) * | 2019-01-15 | 2020-10-02 | 中国农业大学 | Mercury ion colorimetric detection method based on copper nanocluster |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105886618B (en) | 2019-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504742A (en) | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology | |
| CN103097548A (en) | Biomarkers based on a multi-cancer invasion-associated mechanism | |
| CN102618646A (en) | Quantitative detection method for gene copy number | |
| CA2795554A1 (en) | Gene-expression profiling with reduced numbers of transcript measurements | |
| Annaratone et al. | Quantification of HER2 and estrogen receptor heterogeneity in breast cancer by single-molecule RNA fluorescence in situ hybridization | |
| JP2012523838A5 (en) | ||
| CN108315432A (en) | DdPCR technologies detect primer, kit and the detection method of IDH1 R132C genetic mutations | |
| Yu et al. | DNAzyme based three-way junction assay for antibody-free detection of locus-specific N6-methyladenosine modifications | |
| Lee et al. | OPENchip: An on-chip in situ molecular profiling platform for gene expression analysis and oncogenic mutation detection in single circulating tumour cells | |
| CN105886618A (en) | Method for quantitatively detecting mercury ions in liquid sample and kit | |
| CN101665833B (en) | Method for detecting HLA-B27 gene as well as special primer and kit thereof | |
| CN106868181A (en) | A kind of RPA primers of detection T NOS terminators, kit and detection method | |
| CN104769133A (en) | Method of improving microarray performance by strand elimination | |
| CN1699600A (en) | Primer sequence and kit for real-time PCR detection of transgenic rape (seeds) | |
| Simon | Advances in clinical trial designs for predictive biomarker discovery and validation | |
| CN105463077B (en) | A kind of biosensor based on Nano-Au probe combination genetic chip Visual retrieval microRNA | |
| CN104611336A (en) | Fusion gene TTTY15-USP9Y and application of fusion gene as prostate cancer marker | |
| CN104498591A (en) | Liquid chip-based quantitative determination method of Alu gene methylation level | |
| WO2021039777A1 (en) | Method for examining rheumatoid arthritis | |
| CN111286503B (en) | Aptamer and application thereof in PDGF-BB detection kit | |
| Zhao et al. | Application of the Ludox-QPS method for estimating ciliate diversity in soil and comparison with direct count and DNA fingerprinting | |
| CN104359957B (en) | A kind of electrochemical sensor and preparation and application thereof | |
| Chapel et al. | Microsatellite instability testing and therapy implications | |
| Portier et al. | From morphologic to molecular: established and emerging molecular diagnostics for breast carcinoma | |
| CN105063049A (en) | Tiny nucleotide sequence, probe and kit for prognosis evaluation of liver cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |