CN108456684B - Watermelon seed size gene and SNP molecular marker and application thereof - Google Patents
Watermelon seed size gene and SNP molecular marker and application thereof Download PDFInfo
- Publication number
- CN108456684B CN108456684B CN201810315311.5A CN201810315311A CN108456684B CN 108456684 B CN108456684 B CN 108456684B CN 201810315311 A CN201810315311 A CN 201810315311A CN 108456684 B CN108456684 B CN 108456684B
- Authority
- CN
- China
- Prior art keywords
- watermelon
- granules
- molecular marker
- leu
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention discloses a watermelon seed size gene and SNP molecular markers and application thereof. The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the sequence of the encoded protein is shown as SEQ ID NO. 2; also designs genes which have more than 90 percent of homology with the genes and encode proteins with the same functions; the SNP locus of the co-segregation of the watermelon seed size genes is determined, is positioned at 5418365bp of No. 6 chromosome of a watermelon genome, and the basic group of the SNP locus is mutated from G to A; designing dCAPs molecular markers of the SNP sites; the identification method of watermelon seed size genotype is designed, and the watermelon seed size gene or dCAPs molecular marker is applied to the auxiliary screening and breeding of the watermelon seed size molecular marker. Can provide a new means for identifying the size of watermelon seeds and accelerate the improvement process of the size character of the watermelon seeds.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a watermelon grain size gene and an SNP molecular marker and application thereof.
Background
The first use of watermelon is fresh food, the pulp is the edible part, the grain greatly affects the food, the consumer likes seedless or smaller watermelon, so the small grain variety is one of the breeding targets for cultivating watermelon. Another use of watermelon is seed, which is the main product of seed watermelon. Research shows that the seeds of the seed watermelons are high-quality protein and vegetable oil resources and contain abundant vitamin D, so that large-grain varieties are the main breeding target of the seed watermelons.
In the process of large-amount resource collection and data acquisition, the inventor finds that large-sized watermelons, watermelons with sticky seeds and local varieties are poor in quality; the granule is mostly common cultivated watermelon, the quality is better, and the size difference of seeds among different varieties is obvious, so the size of the seeds is also a main classification character of the watermelon.
The research on the size of watermelon seeds at home and abroad mainly focuses on the traditional genetic analysis of genes for controlling the size and the thousand seed weight of the seeds. Studies by Weetman (1937) and by shang kun et al (2015) indicate that grain weight is biased toward monogenically controlled quality traits. Studies of Populus tremula (2013) and the Zhongyanfeng (2014) all showed that grain weight was controlled by a pair of major genes. Pool et al (1941) found a pair of l and s alleles that control seed length, and studies by Kensler et al (1958) and Shimotsuma et al (1963) confirmed this result. Tanaka et al (1995) however found the gene Ti, which controls the granule, to be non-allelic with l and s. Zhang et al (1996) showed that the seed of tomato watermelon is controlled by the single recessive gene ts. Although the results obtained are not completely consistent even though the experimental materials and methods used are different, the studies have some common points that the seed size is considered to belong to the quality character, and the small-sized seeds are dominant over the large-sized seeds and are controlled by a single gene. Dianthus hainanensis et al (1995) on the other hand, two high-generation inbred lines of watermelons with significant difference in grain weightThe seed weight of the filial generation is researched for the parents, and the thousand seed weight of the watermelon seeds is characterized by quantitative trait inheritance. Prothro et al (2012) use of recombinant inbred lines and F2The size of grains is researched by a population, and the grain weight is a typical quantitative trait.
Traditional genetics have employed mathematical statistics to study only one or more genes controlling quality/quantitative traits as a whole, and have failed to determine the location and effect of individual quality/quantitative trait genes on chromosomes (xuyunbi, 1992).
With the development of molecular marker technology and the improvement of molecular quantitative genetics, in recent years, a batch of QTL positioning work (normmin et al, 2000; Hawkins et al, 2001; Yike, 2002; Prothro et al, 2012; Meru and McGregor, 2013) is carried out to disclose the genetic basis of watermelon grain size, but the research has a large positioning interval, many candidate genes and difficulty in screening, and none watermelon grain size gene is determined so far.
Disclosure of Invention
The invention aims to provide a watermelon seed size gene, and SNP molecular markers and application thereof, so as to reveal the genetic basis of watermelon seed size and determine the gene of watermelon seed size.
In order to solve the technical problems, the invention adopts the following technical scheme:
screening out a watermelon seed size gene, and naming asClamdtKThe nucleotide sequence is shown as SEQ ID NO.1, and the coded protein sequence is shown as SEQ ID NO. 2.
Designing a gene which has more than 90 percent of homology with the watermelon grain size gene and codes the protein with the same function.
The SNP locus co-separated from the watermelon grain size gene is located at 5418365bp of No. 6 chromosome of watermelon genome, and the basic group is mutated from G to A.
Designing a dCAPs molecular marker of the SNP site, wherein an upstream primer of the dCAPs molecular marker is named as dCAPs9_ S6F, and the nucleotide sequence of the dCAPs molecular marker is shown as SEQ ID NO. 3; the downstream primer is named dcaps9_ S6R, and the nucleotide sequence is shown inShown as SEQ ID NO.4, the restriction enzyme used in the primer enzyme digestion reaction isTagI。
The identification method for the watermelon grain size genotype comprises the following steps:
a. DNA extraction: extracting total DNA of watermelon plants by using a CTAB method;
b. and (3) PCR amplification:
the reaction system is as follows: 100 ng/. mu.L watermelon plant total DNA 1. mu. L, dcaps 9-S6F 1. mu. L, dcaps 9-S6R 1. mu.L, 2 XPower Taq PCR MasterMix 12.5. mu. L, ddH2O 9.5 μL；
The reaction procedure is as follows: 94 ℃ for 5 min, 35 cycles of 94 ℃ for 20 s, 55 ℃ for 1 min, 72 ℃ for 30 s, and 72 ℃ for 5 min;
c. enzyme digestion reaction system and procedure:
the reaction system is as follows: the PCR product was added in an amount of 5. mu.l,TagIrestriction enzyme 0.5. mu.l, 10Xbuffer 1.5. mu.l, ddH2O 8. mu.l.
The reaction procedure is as follows: the constant temperature treatment is carried out for 10 hours at 65 ℃.
d. Electrophoretic map analysis: and (3) performing polyacrylamide gel electrophoresis, developing, dyeing and band type interpretation on the enzyme digestion product to find a target band, determining the genotype according to the size and the position relationship of the band of the amplification product, wherein the band of 142bp represents the genotype of the large grain, and the band of 113bp represents the genotype of the small grain.
The watermelon seed size gene or the application of the gene in the cloning or expression of the watermelon seed size gene.
The gene, the SNP locus or the dCAPs molecular marker is applied to the auxiliary screening and breeding of watermelon grain size molecular markers.
The application comprises the following steps:
(1) to F2Each strain of the population is subjected to genotype identification by using the molecular marker;
(2) utilizing F in the above (1)2And classifying different individual plants according to the genotype of the molecular marker, and identifying and verifying by using the phenotype data of the grains according to the genotype identification result of the population.
Compared with the prior art, the invention has the beneficial technical effects that:
1. the invention discloses a watermelon multidrug resistance protein gene for the first time by utilizing a forward genetics methodClamdtKThe application of the compound in the function of regulating and controlling the size of seeds.
2. The invention designs a molecular marker for watermelon seed size gene coseparation, and the marker is applied to molecular marker-assisted selective breeding, so that the oriented genetic improvement of watermelon seed size can be more quickly and accurately carried out.
3. The method is applied to the breeding of the watermelon seed size, and can provide a new means for identifying the watermelon seed size, so that the improvement process of the watermelon seed size character is accelerated, and the breeding accuracy and the selection efficiency are improved.
Drawings
FIG. 1 shows RT-PCR verification of 6 differentially expressed genes;
FIG. 2 isClamdtKGene expression levels at different developmental stages in RIL _ L and RIL _ S;
FIG. 3 is a graph of the results of amplification in a portion of the F2 population of genomic DNA using primers with a grain size marker, dcaps9_ S6;
the strips in the box are the target strips of the parents, and the names are the last two/three bits of the variety name/code number.
Detailed Description
The following examples are intended to illustrate the present invention in detail and should not be construed as limiting the scope of the present invention in any way.
The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related reagents are all conventional reagents in the market, if not specifically indicated; the test methods involved are conventional methods unless otherwise specified.
The first embodiment is as follows: determination of watermelon seed size gene and development of molecular marker
1. Fine positioning of major QTL (quantitative trait locus) of watermelon grain size
Uses the large-grain female parent ZXG01478 of watermelon and the small-grain female parentHybridizing the male parent '14 CB 11' to obtain F2High-density genetic linkage map constructed by colony for male parent and female parent and F1And F2Carrying out visual identification on the sizes of seeds of 93 single melons in a population; combining genetic linkage maps with F2And (3) performing group phenotype identification result, performing QTL initial positioning by using an Rqtl-IM-binary method, identifying the major QTL of the grain size, wherein the LOD peak value is 46.94, explaining 26.16% of phenotype variation, and the confidence interval (2-LOD) is 3.68-31.67 cM.
2. Comparative transcriptomics analysis related to grain size
(1) The watermelon large-grain female parent 'ZXG 01478' and small-grain male parent '14 CB 11' are used for constructing Recombinant Inbred Lines (RILs), and seeds 7, 8, 9, 10, 11, 12 and 13 Days (DAF) after one part of large-grain (RIL _ L) and one part of small-grain (RIL _ S) flowers are screened for transcriptome sequencing. The basic information for sequencing of the 14 sample transcriptomes is shown in Table 1. Q30 was greater than 90% and the GC content was essentially identical to that of the watermelon reference genome.
TABLE 1 basic information for transcriptome sequencing
(2) RIL _ L and RIL _ S in different development stages are used for differential expression analysis, and 6 differential expression genes are randomly selected and verified by RT-PCR.
The results are shown in FIG. 1, and RT-PCR well verified the results of transcriptome analysis, indicating that the results of transcriptome sequencing and analysis are reliable.
(3) In the QTL region that has been identified, there is only one gene,ClamdtKthe coded multi-drug resistance protein has obvious differential expression in 7 different development stages, and the expression difference of other genes is not obvious. And isClamdtKThe gene expression level of RIL _ L is not basically expressed in different development stages of RIL _ L, and the gene expression level of RIL _ S is gradually reduced along with the prolongation of pollination time (as shown in a figure 2).
The grain size gene for controlling the major QTL is determined asClamdtKThe nucleotide sequence is shown as SEQID NO.1, and the coded protein sequence is shown in SEQ ID NO. 2.
3. The re-sequencing of "ZXG 01478" and "14 CB 11" is used for excavating SNP sites at the whole genome levelClamdtKAnd a SNP locus is discovered nearby, the locus is located at the base position 5418365 of No. 6 chromosome of the watermelon genome, and the base change is G and A.
4. A dCAPs molecular marker is developed according to the SNP locus, the upstream primer is named as dCAPs9_ S6F, the downstream primer is named as dCAPs9_ S6R, and the nucleotide sequence of the primer pair is as follows:
dcaps9_S6F：CTAAAAATACAGGATTAAAATTGTACATTC；
dcaps9_S6R：TGTAAAACACATATATAACG。
the restriction enzyme used isTagI。
Example two: watermelon F2Population molecular marker analysis
1. Extraction of watermelon F by CTAB method2The method comprises the following specific steps of total DNA of population leaves:
(1) putting 1 g of fresh leaves into a mortar, adding liquid nitrogen, grinding into powder, then transferring into a centrifuge tube added with 1 ml of CTAB extraction liquid, fully mixing the two, then placing in a constant temperature water bath at 65 ℃ for 60 min, and reversely mixing for 2-3 times;
(2) taking out from the water bath, and centrifuging at 8000 rpm for 1 min;
(3) taking the supernatant, placing the supernatant into another centrifuge tube, adding equal volume of chloroform: slightly inverting isoamyl alcohol to fully mix the isoamyl alcohol; wherein the volume ratio of chloroform to isoamyl alcohol is 24: 1;
(4) centrifuging at 10000 rpm for 5 min, and collecting supernatant;
(5) adding 0.7 times volume of pre-cooled isopropanol, mixing, freezing at-20 deg.C for no more than 30 min to precipitate DNA; taking out, centrifuging at 10000 rpm for 5 min, and leaving precipitate and removing supernatant;
(6) washing the precipitate with anhydrous ethanol for several times, pouring off the soaking solution, opening the cover of the centrifugal tube, and air drying;
(7) adding 200 mul of distilled water to dissolve the DNA; the DNA concentration was measured with an ultraviolet spectrophotometer and stored in a freezer at-20 ℃ for future use.
2. PCR reaction system and procedure
The reaction system is as follows:
1. mu.l of total DNA of watermelon leaves (100 ng/. mu.l), 1. mu.l of Forward primer (10. mu. mol/L), 1. mu.l of Reverse primer (10. mu. mol/L), 12.5. mu.l of 2 XPower Taq PCR MasterMix, ddH2O 9.5 μl。
The PCR reaction program is:
94 ℃ for 5 minutes, 35 cycles of 94 ℃ for 20 seconds, 55 ℃ for 1 minute, 72 ℃ for 30 seconds, and 72 ℃ for 5 minutes.
3. Enzyme digestion reaction system and program
The reaction system is as follows: the PCR product was added in an amount of 5. mu.l,TagIrestriction enzyme 0.5. mu.l, 10XBuffer 1.5. mu.l, ddH2O 8 μl。
The constant temperature treatment is carried out for 10 hours at 65 ℃.
4. The PCR product was subjected to 8% polyacrylamide gel electrophoresis, development, staining and band pattern interpretation.
(1) Preparing a reagent:
A．5×TBE ：
53.9 g of Tris-base, 3.72 g of EDTA and 27.5 g of boric acid are taken, and the volume is adjusted to 1 liter by using distilled water.
B. 40% polyacrylamide solution:
193.34 g of polyacrylamide and 6.66 g of methylene bisacrylamide are taken, and distilled water is used for fixing the volume to 500 ml.
C. 8% polyacrylamide gel:
10 ml of 40% polyacrylamide solution, 5 ml of 5 XTBE, 200. mu.l of 10% Ammonium Persulfate (APS), 80. mu.l of Tetramethylethylenediamine (TEMED) and 22 ml of distilled water.
D. Silver staining solution:
1 g of silver nitrate, 5 ml of glacial acetic acid and 50 ml of absolute ethyl alcohol are taken, and deionized water is used for fixing the volume to 500 ml.
E. Developing solution:
15 g of sodium hydroxide and 2.5 ml of formaldehyde (37%) are taken and are made into a volume of 500 ml by deionized water.
(2) Preparing a gel plate:
the glass plate was washed with distilled water, air-dried, wiped with absorbent cotton balls soaked with absolute ethanol, and air-dried. The concave plate and the flat plate are tightly overlapped and then are put into a glue maker to be tightly pressed, and the clamps at the two sides of the concave plate and the flat plate are well buckled. Preparing 8% polyacrylamide gel solution in a wash bottle, mixing uniformly, quickly injecting into a gap between the two plates, and inserting into a comb with teeth after the gap is filled; if the liquid level drops, the liquid level can be replenished by pipetting the unsolidified solution. Wait for the solution to solidify sufficiently.
(3) Electrophoresis:
taking down the support of the gel maker from the base, directly putting the support into a matched electrophoresis tank, and pouring a proper amount of 1 xTBE buffer solution into the bottom of the electrophoresis tank and the middle of two glass plates on the support. Adding 6 XDNA Loading Buffer with 0.2 times volume into the PCR product, mixing uniformly, adding 0.8 microliter into the sample application hole, and carrying out electrophoresis at 260V for 35 minutes.
(4) Dyeing and developing:
after electrophoresis is finished, taking out the glass plate from the electrophoresis tank, prying off the concave plate, attaching the gel to the flat plate, putting the flat plate into the silver staining solution with the gel surface facing upwards, placing the flat plate on a decoloring shaking table, and shaking gently for 15 minutes to ensure that the gel can automatically fall off; after silver staining is finished, taking out the gel, and putting the gel into deionized water for washing for 10 seconds; and after the washing is finished, transferring the gel into a developing solution, slightly shaking a shaking table, taking out the gel after the strips are clear, placing the gel on a film reader, observing the position difference of the strips by naked eyes, and taking a picture for storage.
(5) And (3) band type interpretation:
and (3) placing the developed and naturally dried glass plate on a reading table, and observing the position difference of the two parent strips by naked eyes.
Molecular tagging at F using dcaps9_ S62The genotype identification results in the population are shown in FIG. 3, the names are the last two or three bits of the variety name/code, the band in the parent's frame is the target band, the size of the female parent target fragment is 142bp, and the size of the male parent target fragment is 113 bp.
Example three: f2Group genotype analysis
The molecular markers of dcaps9_ S6 produced in example two are shown in the general formulas "ZXG 01478" and"14 CB 11" construction F2After genotyping in the population, two genotypes were examined for the dcaps9_ S6 molecular markers at 93F2Distribution in the population, the genotype of dcaps9_ S6 was found to be completely co-segregating with the kernel size phenotype. The results are shown in Table 2, where A represents the maternal banding pattern, B represents the paternal banding pattern, and H represents the heterozygous genotype.
Genotype of molecular marker dcaps9_ S6 in 69 small grain (thousand kernel weight <37 g) lines 24 parts are B (113 bp) and 44 parts are H. And all were A (142 bp) in 24 large grain lines.
The 24 lines with genotype A of the molecular marker InDel14_ S6 are all large-grain lines, and the 24 lines with genotype B are all small-grain lines. The accuracy of genotype identification is 100%.
TABLE 2 dcaps9_ S6 at F2Identification and validation in a population
| Name/code of breed | dcaps9_S6 | Thousand Kernel weight (g) | Classification |
| Female parent | A | 93.5 | Big grain |
| Male parent | B | 20.8 | Granules |
| F1 | H | 30.1 | Granules |
| 13QB135-001 | H | 30.3 | Granules |
| 13QB135-002 | H | 26.3 | Granules |
| 13QB135-003 | H | 29 | Granules |
| 13QB135-004 | H | 29.2 | Granules |
| 13QB135-005 | A | 110.6 | Big grain |
| 13QB135-006 | A | 141.7 | Big grain |
| 13QB135-007 | A | 86.8 | Big grain |
| 13QB135-008 | B | 16.8 | Granules |
| 13QB135-009 | H | 32 | Granules |
| 13QB135-010 | H | 32.9 | Granules |
| 13QB135-011 | H | 28.8 | Granules |
| 13QB135-013 | A | 90.4 | Big grain |
| 13QB135-014 | A | 101.2 | Big grain |
| 13QB135-015 | H | 29 | Granules |
| 13QB135-016 | B | 19.5 | Granules |
| 13QB135-017 | H | 24.8 | Granules |
| 13QB135-018 | H | 25.4 | Granules |
| 13QB135-019 | B | 16.6 | Granules |
| 13QB135-020 | H | 27.4 | Granules |
| 13QB135-021 | H | 24.5 | Granules |
| 13QB135-022 | H | 27.8 | Granules |
| 13QB135-023 | B | 18.2 | Granules |
| 13QB135-024 | A | 116 | Big grain |
| 13QB135-025 | B | 18.8 | Granules |
| 13QB135-026 | A | 95.6 | Big grain |
| 13QB135-027 | B | 23.5 | Granules |
| 13QB135-028 | H | 31.6 | Granules |
| 13QB135-029 | H | 20 | Granules |
| 13QB135-030 | A | 113.2 | Big grain |
| 13QB135-031 | B | 20.3 | Granules |
| 13QB135-032 | H | 28.9 | Granules |
| 13QB135-033 | H | 33.3 | Granules |
| 13QB135-034 | B | 23 | Granules |
| 13QB135-035 | B | 19.7 | Granules |
| 13QB135-036 | H | 28.8 | Granules |
| 13QB135-037 | H | 32.2 | Granules |
| 13QB135-038 | H | 25.4 | Granules |
| 13QB135-040 | H | 21.5 | Granules |
| 13QB135-041 | A | 97.9 | Big grain |
| 13QB135-042 | H | 26.8 | Granules |
| 13QB135-043 | A | 118.9 | Big grain |
| 13QB135-044 | H | 29.3 | Granules |
| 13QB135-045 | B | 20.8 | Granules |
| 13QB135-046 | B | 20.2 | Granules |
| 13QB135-047 | A | 90.3 | Big grain |
| 13QB135-048 | H | 27 | Granules |
| 13QB135-049 | A | 99.3 | Big grain |
| 13QB135-050 | H | 25.5 | Granules |
| 13QB135-051 | B | 23.1 | Granules |
| 13QB135-052 | B | 22.4 | Granules |
| 13QB135-053 | B | 17.8 | Granules |
| 13QB135-054 | H | 31.8 | Granules |
| 13QB135-055 | H | 29.9 | Granules |
| 13QB135-056 | B | 18.8 | Granules |
| 13QB135-057 | B | 20.9 | Granules |
| 13QB135-058 | H | 27.1 | Granules |
| 13QB135-059 | H | 30.3 | Granules |
| 13QB135-060 | H | 30.4 | Granules |
| 13QB135-061 | H | 31.2 | Granules |
| 13QB135-062 | H | 27.6 | Granules |
| 13QB135-064 | A | 93.7 | Big grain |
| 13QB135-066 | H | 25.8 | Granules |
| 13QB135-067 | B | 20.4 | Granules |
| 13QB135-068 | B | 18.6 | Granules |
| 13QB135-069 | A | 111.6 | Big grain |
| 13QB135-071 | A | 129.4 | Big grain |
| 13QB135-075 | B | 23.5 | Granules |
| 13QB135-076 | B | 17 | Granules |
| 13QB135-078 | H | 27.4 | Granules |
| 13QB135-079 | H | 27.5 | Granules |
| 13QB135-080 | H | 28.9 | Granules |
| 13QB135-081 | A | 123.6 | Big grain |
| 13QB135-083 | H | 25 | Granules |
| 13QB135-086 | H | 31.2 | Granules |
| 13QB135-087 | B | 21.8 | Granules |
| 13QB135-090 | H | 28.6 | Granules |
| 13QB135-094 | H | 33.6 | Granules |
| 13QB135-095 | A | 98.7 | Big grain |
| 13QB135-097 | A | 100.6 | Big grain |
| 13QB135-099 | H | 24 | Granules |
| 13QB135-100 | A | 122.8 | Big grain |
| 13QB135-101 | H | 26.9 | Granules |
| 13QB135-103 | A | 92.6 | Big grain |
| 13QB135-104 | A | 108.8 | Big grain |
| 13QB135-105 | B | 18.6 | Granules |
| 13QB135-106 | H | 31.1 | Granules |
| 13QB135-107 | B | 23.7 | Granules |
| 13QB135-109 | B | 18.3 | Granules |
| 13QB135-111 | H | 35.5 | Granules |
| 13QB135-113 | A | 100 | Big grain |
| 13QB135-115 | B | 20.4 | Granules |
| 13QB135-118 | A | 105.4 | Big grain |
| 13QB135-122 | A | 97.8 | Big grain |
While the present invention has been described in detail with reference to the drawings and the embodiments, those skilled in the art will understand that various specific parameters in the above embodiments can be changed without departing from the spirit of the present invention, and a plurality of specific embodiments are formed, which are common variation ranges of the present invention, and will not be described in detail herein.
SEQUENCE LISTING
<110> Zhengzhou fruit tree institute of Chinese academy of agricultural sciences
<120> watermelon seed size gene and SNP molecular marker and application thereof
<130> 2018
<160> 4
<170> PatentIn version 3.2
<210> 1
<211> 1533
<212> DNA
<213> watermelon
<400> 1
atgcttgcag aagagaagtc ccaaaagtac ccgacaatgc cagaggtcct tgaagagctg 60
aagcaaatgg ctgacattgg tttccctgtt ttggcaatgg gcttagtggg ttatctcaaa 120
aatatgatct ctgttatttg catgggcaga cttggaactc ttcatctcgc tgctggttct 180
ttggccattg gtttcactaa tatcactggc tattcagttc tttcaggctt ggctatgggc 240
atggagccac tctgtagtca agcttttggt tctcataatt cttccattgc ctttctcact 300
ttgcaaagaa cggttcttat tttgcttttt gctactattc ccattgggtt tctttggcta 360
aatttggagc ctcttatgtt ggttctacat cagaacccag aaatcactag aattgcaact 420
gtttattgcc gttttgcagt tcctgatttg gtattgaata gccttttaca tcctttgcgt 480
atttacctta gaaacaaagg caccacgtgg attgtcatgt ggtgcaattt gttggctatt 540
ctcctacatg ttcccatcgc tattttcttg acttttcctc ttgatcttgg aatccgtggg 600
attgctatct ccaattttat agctaatttc aatacccttt tcttcctttt actctatttg 660
atattctgta ctcgtactac tttttcctcc tcttcttcta aggaggctaa tctgtttgtg 720
ccactgaaaa gcagcaccgt ggttagcgcc gctacggttg gggaggaatg gggaatgctg 780
atcaagttgg ccattcctag ctgtcttgga gtttgcttgg aatggtggtg gtatgagttc 840
atgaccattc tcactggcta cctttataac ccgcggattg cactcgccac ttcaggcatt 900
gtaatccaaa caacttcact aatgtacaca ttaccaatgg ctctcagtgc cgctgtctcg 960
actagagttg gtcacgagct cggcgctggt cggcccaaaa aggctcgact agcggcggtg 1020
gtggcgatag gattggcctt ggtgggctca ttgatgggac tctcactaac caccattggc 1080
agaaggacat ggggaagagt tttcacaaaa gatgaggaaa ttctagagct gacaatggcg 1140
gttctgccca taatcgggct gtgcgagcta gcaaattgcc cgcaaacaac aagctgcggg 1200
attctgaggg gaagtgcaag gccggggatc ggagcaggaa taaacttctg ttcattttac 1260
atggtggggg cgccgatggc cgtcttgtcg gcgtttgttt ggaaatctgg gttcgtgggt 1320
ctttgctacg ggcttttggc agcccagatg gcatgtgtgg tctcaatctt aatagtggtc 1380
ttcaacacag attgggaaat ggagtcaatc aaagccgaag acttagtagg caaaaacacc 1440
aataacgtct ttgcacatgc aatccacaca gccatacgtg aggaaggtcc tgaattcctc 1500
aaagaatcac ctgttgaaag acaagacaca taa 1533
<210> 2
<211> 510
<212> PRT
<213> watermelon
<400> 2
Met Leu Ala Glu Glu Lys Ser Gln Lys Tyr Pro Thr Met Pro Glu Val
1 5 10 15
Leu Glu Glu Leu Lys Gln Met Ala Asp Ile Gly Phe Pro Val Leu Ala
20 25 30
Met Gly Leu Val Gly Tyr Leu Lys Asn Met Ile Ser Val Ile Cys Met
35 40 45
Gly Arg Leu Gly Thr Leu His Leu Ala Ala Gly Ser Leu Ala Ile Gly
50 55 60
Phe Thr Asn Ile Thr Gly Tyr Ser Val Leu Ser Gly Leu Ala Met Gly
65 70 75 80
Met Glu Pro Leu Cys Ser Gln Ala Phe Gly Ser His Asn Ser Ser Ile
85 90 95
Ala Phe Leu Thr Leu Gln Arg Thr Val Leu Ile Leu Leu Phe Ala Thr
100 105 110
Ile Pro Ile Gly Phe Leu Trp Leu Asn Leu Glu Pro Leu Met Leu Val
115 120 125
Leu His Gln Asn Pro Glu Ile Thr Arg Ile Ala Thr Val Tyr Cys Arg
130 135 140
Phe Ala Val Pro Asp Leu Val Leu Asn Ser Leu Leu His Pro Leu Arg
145 150 155 160
Ile Tyr Leu Arg Asn Lys Gly Thr Thr Trp Ile Val Met Trp Cys Asn
165 170 175
Leu Leu Ala Ile Leu Leu His Val Pro Ile Ala Ile Phe Leu Thr Phe
180 185 190
Pro Leu Asp Leu Gly Ile Arg Gly Ile Ala Ile Ser Asn Phe Ile Ala
195 200 205
Asn Phe Asn Thr Leu Phe Phe Leu Leu Leu Tyr Leu Ile Phe Cys Thr
210 215 220
Arg Thr Thr Phe Ser Ser Ser Ser Ser Lys Glu Ala Asn Leu Phe Val
225 230 235 240
Pro Leu Lys Ser Ser Thr Val Val Ser Ala Ala Thr Val Gly Glu Glu
245 250 255
Trp Gly Met Leu Ile Lys Leu Ala Ile Pro Ser Cys Leu Gly Val Cys
260 265 270
Leu Glu Trp Trp Trp Tyr Glu Phe Met Thr Ile Leu Thr Gly Tyr Leu
275 280 285
Tyr Asn Pro Arg Ile Ala Leu Ala Thr Ser Gly Ile Val Ile Gln Thr
290 295 300
Thr Ser Leu Met Tyr Thr Leu Pro Met Ala Leu Ser Ala Ala Val Ser
305 310 315 320
Thr Arg Val Gly His Glu Leu Gly Ala Gly Arg Pro Lys Lys Ala Arg
325 330 335
Leu Ala Ala Val Val Ala Ile Gly Leu Ala Leu Val Gly Ser Leu Met
340 345 350
Gly Leu Ser Leu Thr Thr Ile Gly Arg Arg Thr Trp Gly Arg Val Phe
355 360 365
Thr Lys Asp Glu Glu Ile Leu Glu Leu Thr Met Ala Val Leu Pro Ile
370 375 380
Ile Gly Leu Cys Glu Leu Ala Asn Cys Pro Gln Thr Thr Ser Cys Gly
385 390 395 400
Ile Leu Arg Gly Ser Ala Arg Pro Gly Ile Gly Ala Gly Ile Asn Phe
405 410 415
Cys Ser Phe Tyr Met Val Gly Ala Pro Met Ala Val Leu Ser Ala Phe
420 425 430
Val Trp Lys Ser Gly Phe Val Gly Leu Cys Tyr Gly Leu Leu Ala Ala
435 440 445
Gln Met Ala Cys Val Val Ser Ile Leu Ile Val Val Phe Asn Thr Asp
450 455 460
Trp Glu Met Glu Ser Ile Lys Ala Glu Asp Leu Val Gly Lys Asn Thr
465 470 475 480
Asn Asn Val Phe Ala His Ala Ile His Thr Ala Ile Arg Glu Glu Gly
485 490 495
Pro Glu Phe Leu Lys Glu Ser Pro Val Glu Arg Gln Asp Thr
500 505 510
<210> 3
<211> 30
<212> DNA
<213> Artificial Synthesis
<400> 3
ctaaaaatac aggattaaaa ttgtacattc 30
<210> 4
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 4
Claims (5)
1. A dCAPs molecular marker of SNP sites related to watermelon grain size is characterized in that the nucleotide sequence of an upstream primer is shown as SEQ ID NO.3, and the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 4.
2. The dCAPs molecular marker for SNP site according to claim 1, wherein the restriction enzyme used for the primer digestion reaction isTagI。
3. The method for identifying the watermelon grain size genotype is characterized by comprising the following steps of:
a. DNA extraction: extracting total DNA of watermelon plants by using a CTAB method;
b. and (3) PCR amplification:
the reaction system is as follows: 100 ng/mu L watermelon plant total DNA 1 mu L, 1 mu L upstream primer of claim 1, 1 mu L downstream primer of claim 1, 2 x Power Taq PCR MasterMix 12.5 mu L, ddH2O 9.5 μL；
The reaction procedure is as follows: 94 ℃ for 5 min, 35 cycles of 94 ℃ for 20 s, 55 ℃ for 1 min, 72 ℃ for 30 s, and 72 ℃ for 5 min;
c. enzyme digestion reaction system and procedure:
the reaction system is as follows: the PCR product was added in an amount of 5. mu.l,TagIrestriction enzyme 0.5. mu.l, 10XBuffer 1.5. mu.l, ddH2O 8 μl；
The reaction procedure is as follows: constant temperature treatment at 65 ℃ for 10 hours;
d. electrophoretic map analysis: and (3) performing polyacrylamide gel electrophoresis, developing, dyeing and band type interpretation on the enzyme digestion product to find a target band, determining the genotype according to the size and the position relationship of the band of the amplification product, wherein the band of 142bp represents the genotype of the large grain, and the band of 113bp represents the genotype of the small grain.
4. The application of the dCAPs molecular marker of claim 1 in auxiliary screening and breeding of watermelon grain size.
5. Use according to claim 4, characterized in that it comprises the following steps:
(1) to F2Genotyping each strain of the population using the dCAPs molecular marker of claim 1;
(2) utilizing F in the above (1)2And classifying different individual plants according to the genotype of the molecular marker, and identifying and verifying by using the phenotype data of the grains according to the genotype identification result of the population.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810315311.5A CN108456684B (en) | 2018-04-10 | 2018-04-10 | Watermelon seed size gene and SNP molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810315311.5A CN108456684B (en) | 2018-04-10 | 2018-04-10 | Watermelon seed size gene and SNP molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108456684A CN108456684A (en) | 2018-08-28 |
| CN108456684B true CN108456684B (en) | 2021-07-09 |
Family
ID=63235425
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810315311.5A Active CN108456684B (en) | 2018-04-10 | 2018-04-10 | Watermelon seed size gene and SNP molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108456684B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109679971A (en) * | 2019-01-14 | 2019-04-26 | 浙江大学 | The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon |
| CN110904264B (en) * | 2019-12-19 | 2022-04-26 | 中国农业科学院郑州果树研究所 | InDel molecular marker co-separated from watermelon minimal seed gene ts, primers and application thereof |
| CN111549172B (en) * | 2020-06-12 | 2023-02-28 | 中国农业科学院郑州果树研究所 | Watermelon leaf posterior green gene linkage site and CAPS marker |
| CN116103428B (en) * | 2022-10-27 | 2023-08-18 | 黑龙江省农业科学院园艺分院 | dCAPS molecular marker related to watermelon seed size and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713971A (en) * | 2016-03-16 | 2016-06-29 | 中国农业科学院郑州果树研究所 | InDel molecular marker for identifying watermelon seed size and primers and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10470385B2 (en) * | 2012-08-06 | 2019-11-12 | Seminis Vegetable Seeds, Inc. | Methods and compositions for producing watermelon plants with selected seed sizes |
-
2018
- 2018-04-10 CN CN201810315311.5A patent/CN108456684B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713971A (en) * | 2016-03-16 | 2016-06-29 | 中国农业科学院郑州果树研究所 | InDel molecular marker for identifying watermelon seed size and primers and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Cla009291 [mRNA] locus=Chr6:5397214:5398885:+;CuGenDB;《CuGenDB》;20120302;第1-5页 * |
| Construction of a high-density genetic map for watermelon (Citrullus lanatus L.) based on large-scale SNP discovery by specific length amplified fragment sequencing (SLAF-seq);Jianli Shang et al.;《Scientia Horticulturae》;20160319;第203卷;第38-46页 * |
| Fine mapping and discovery of candidate genes for seed size in watermelon by genome survey sequencing;Na Li et al.;《scientific reports》;20181214;第8卷;第1-11页 * |
| 基于基因组重测序的西瓜SNP分子标记的开发;高鹏 等;《园艺学报》;20131231;第40卷(第S期);第2697页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108456684A (en) | 2018-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wu et al. | A single-nucleotide polymorphism causes smaller grain size and loss of seed shattering during African rice domestication | |
| CN108456684B (en) | Watermelon seed size gene and SNP molecular marker and application thereof | |
| Zhu et al. | Multilocus analysis of nucleotide variation of Oryza sativa and its wild relatives: severe bottleneck during domestication of rice | |
| Gady et al. | Implementation of two high through-put techniques in a novel application: detecting point mutations in large EMS mutated plant populations | |
| Tuberosa et al. | Genomics-based approaches to improve drought tolerance of crops | |
| Sandal et al. | A genetic linkage map of the model legume Lotus japonicus and strategies for fast mapping of new loci | |
| Zhang et al. | TOND1 confers tolerance to nitrogen deficiency in rice | |
| Shapter et al. | High-throughput sequencing and mutagenesis to accelerate the domestication of Microlaena stipoides as a new food crop | |
| CN110157831B (en) | Molecular marker coseparated with watermelon short vine gene Cldw1 | |
| CN105713971A (en) | InDel molecular marker for identifying watermelon seed size and primers and application thereof | |
| US20220010325A1 (en) | Quantitative trait loci (qtl) associated with shattering-resistant capsules in sesame and uses thereof | |
| CN109402291B (en) | InDel molecular marker for identifying bearing part of female flowers of muskmelon as well as primer and application thereof | |
| CN109055395A (en) | A kind of photoperiod insensitiveness Hd1 allele and its molecular labeling and application | |
| CN110938706B (en) | Molecular marker closely linked with watermelon plant non-tendril gene Clnt and application thereof | |
| CN113322345B (en) | Molecular marker co-separated from watermelon peel grain covering gene ClGS and application | |
| CN105087768A (en) | Molecular marker assisted method for selectively breeding bruchid-resistant mung bean varieties | |
| CN111719012A (en) | dCAPS molecular marker primer pair for identifying dehydration rate genotype of corn kernel and application | |
| Zhang et al. | Identification and development of a KASP functional marker of TaTAP46‐5A associated with kernel weight in wheat (Triticum aestivum) | |
| CN109722486B (en) | Watermelon seed navel spot character major gene, molecular marker for detecting major gene and application | |
| CN110055348A (en) | The Functional marker of rice grain shape gene GL3 and its application | |
| CN105925718B (en) | A kind of method and molecular labeling for cultivating high protein content japonica rice | |
| Francki et al. | Wheat functional genomics and engineering crop improvement | |
| CN108359738A (en) | A kind of Chinese torreya EST-SSR primers and Variety fingerprinting construction method | |
| KR20160095212A (en) | DNA marker for selecting Jubilee-type stripe pattern of watermelon | |
| Alhasnawi et al. | Application of inter simple sequence repeat (ISSR) for detecting genetic analysis in rice (Oryza sativa L.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |