CN108452322A - BCL2 gene inhibitors based on long-chain non-coding RNA - Google Patents
BCL2 gene inhibitors based on long-chain non-coding RNA Download PDFInfo
- Publication number
- CN108452322A CN108452322A CN201810152400.2A CN201810152400A CN108452322A CN 108452322 A CN108452322 A CN 108452322A CN 201810152400 A CN201810152400 A CN 201810152400A CN 108452322 A CN108452322 A CN 108452322A
- Authority
- CN
- China
- Prior art keywords
- long
- coding rna
- chain non
- bcl2
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
Abstract
The invention discloses the BCL2 gene inhibitors based on long-chain non-coding RNA, have SEQ ID NO:1 sequence；Can interact with BCL2, can effectively inhibit BCL2 gene expressions, GAPDH expression it is similar under the conditions of, H22954 high expression stabilization plant shape at transplantable tumor in, BCL2 expression quantity be significantly lower than empty vector control group；So as to inhibit the growth and transfer of tumour, patient is made to benefit in the therapeutic process of tumour.
Description
Technical field
The invention belongs to genomic medicine technologies, and in particular to the BCL2 gene inhibitors based on long-chain non-coding RNA.
Background technology
BCL2 is the gene of an inhibition apoptosis.It is the pernicious of the tumours such as leukaemia in acute myeloid leukemia, acute leaching
Unconventionality expression in cell, to enable these tumour cells to obtain growth vigor, and fight body system of defense and some
The effect of anticancer drug.The expression of more and more research report inhibition BCL2 genes can inhibit the growth and transfer of tumour,
Patient is set to benefit in the therapeutic process of tumour；But opposite, the drug of tumour can be inhibited almost to inhibit to BCL2 genes
In vain.Therefore it needs to research and develop new drug to inhibit the expression of BCL2 genes.
Invention content
The invention discloses a kind of expression inhibiting agent of new BCL2 genes, can effectively inhibit its expression, so as to
To inhibit the growth and transfer of tumour, patient is made to benefit in the therapeutic process of tumour.
The present invention adopts the following technical scheme that：
Application of the long-chain non-coding RNA in preparing BCL2 gene inhibitors or inhibiting BCL2 genes；The long-chain non-coding
The sequence of RNA is SEQ ID NO:1.
Long-chain non-coding RNA application in preparation of anti-tumor drugs；The sequence of the long-chain non-coding RNA is SEQ ID
NO:1。
A kind of BCL2 gene inhibitors are long-chain non-coding RNA, and the sequence of the long-chain non-coding RNA is SEQ ID
NO:1。
A kind of antitumor drug and preparation method thereof, is transferred to plasmid vector by long-chain non-coding RNA, obtains antineoplastic
Object；The sequence of the long-chain non-coding RNA is SEQ ID NO:1.
In the present invention, SEQ ID NO:1 sequence is as follows：
GGTGATGGGAAATTTCAGACTTTGATTTGGGCCTTGGAAAACAGGTTCAGTTTCAGTAGATGGAGGTAAAAGG
AGGCAAAGAGCGACCTTACGTAAATCCAAGGCTGAAGGAAGGAGGCTCTAAGGGGTGTGTGGGTGATTAGGAGTAAA
GTATCTTGTCTGAAATGAAGAGTTTCTATACAGCATGCTTATTTGGAGTCATGCCTAACAAGATTACTTTGGGTCTA
ATTTTGGAAGCTTGGTACTCCAGGGAGCTTGGACATGAATTTAAAGACAATGGGAACTCACATTTAAGTTTCTGAAA
CAGCCAGGCGTGGTGGCTCATGCCTGTAATCCCAGCACTTCGGGAGGCTGAGGCAGGTGGATCACCTGAGATCAGGA
GTTTGAGACCAGTCTAACCAACATGGAGAAACCCCATCTCTACTTAAAAG
The present invention identifies a new long-chain non-coding RNA that can inhibit BCL2 gene expressions, has SEQ ID NO:1 sequence
Row, can interact with BCL2, can effectively inhibit BCL2 gene expressions, so as to inhibit the growth of tumour and turn
It moves, patient is made to benefit in the therapeutic process of tumour.
Description of the drawings
Fig. 1 is the expression of BCL2 albumen in the malignant myeloid cell lines K562 for stablize high expression H22954；
Fig. 2 is the expression of BCL2 albumen in mouse K562 cell transplantation tumors；
Fig. 3 is the measurement of luciferase reporter gene；
Fig. 4 purifies for RNA antisenses（RAP）It measures.
Specific implementation mode
Embodiment one
The invention discloses the new long-chain non-coding RNAs that one can inhibit BCL2 gene expressions（Referred to as H22954）, there is SEQ
ID NO:1 sequence is as follows：
GGTGATGGGAAATTTCAGACTTTGATTTGGGCCTTGGAAAACAGGTTCAGTTTCAGTAGATGGAGGTAAAAGG
AGGCAAAGAGCGACCTTACGTAAATCCAAGGCTGAAGGAAGGAGGCTCTAAGGGGTGTGTGGGTGATTAGGAGTAAA
GTATCTTGTCTGAAATGAAGAGTTTCTATACAGCATGCTTATTTGGAGTCATGCCTAACAAGATTACTTTGGGTCTA
ATTTTGGAAGCTTGGTACTCCAGGGAGCTTGGACATGAATTTAAAGACAATGGGAACTCACATTTAAGTTTCTGAAA
CAGCCAGGCGTGGTGGCTCATGCCTGTAATCCCAGCACTTCGGGAGGCTGAGGCAGGTGGATCACCTGAGATCAGGA
GTTTGAGACCAGTCTAACCAACATGGAGAAACCCCATCTCTACTTAAAAG
Embodiment two
Cell transfecting and Western blotting.Use Lipofectamine 2000（Invitrogen）With long-chain non-coding RNA
（SEQ ID NO:1）Plasmid transfection K562 cells.By cell culture 24-48 hours, and containing 50mmol/L Tris-HCl
（pH8.0）, 150mmol/L NaCl, 1%（v/v）Triton X-100 and protease inhibitor cocktail（1:100 dilutions,
Sigma）.Pass through SDS-PAGE and Western blot analysis protein.Use ECL reagents（Denville Scientific）
Film is set to be developed and exposed to X-ray film.
The malignant myeloid cell lines K562 for stablizing high expression H22954 of culture, carries out protein electrophoresis analysis, with Fei Gaobiao after cracking
Cell ratio, BCL2 is decreased obviously, and sees attached drawing 1.1,2,3 be empty carrier（Vector）For 3 stable strain controls, 4,5,6 be 3
The K562 of Expression of Plant Height H22954 stablizes strain.GAPDH is loading control.Under the conditions of GAPDH expression is similar, H22954 high tables
In the stabilization strain reached, BCL2 expression quantity is significantly lower than empty vector control group.
In mouse subcutaneous transplanting tumor animal model, the transplantable tumor of height expression H22954, BCL2 declines, and sees attached drawing 2.Vector
For empty carrier group, K562 that H22954 is high expression H22954 stablize plant shape at transplantable tumor.GAPDH is loading control.
GAPDH expression it is similar under the conditions of, H22954 high expression stabilization plant shape at transplantable tumor in, BCL2 expression quantity significantly lower than sky
Vehicle Control group.
Embodiment three
Luciferase assay.293 cells, 2000 reagents of Lipofectamine（Invitrogen）With 1 μ g long-chain non-codings
RNA（SEQ ID NO:1）Expression plasmid or control vector（Empty carrier PGL3 and with gene PGL3-s of the H22954 without interaction
Control）It is transfected with together with 1 μ g luciferase reporter gene carriers.In order to make the transfection efficiency standardization in transfecting every time,
The pRLTK plasmids of 50ng are used in each hole（Promega）.Pass through luciferase reporter gene detecting system（Promega）
Measure luciferase activity.
1ug carries long-chain non-coding RNA（SEQ ID NO:1）Plasmid or control empty carrier plasmid are transferred to by liposome
In 293 cells, and it is transferred to the luciferase reporter gene plasmid for carrying BCL2 simultaneously, after 24-48 hours, observes fluorescence intensity,
Turn long-chain non-coding RNA（SEQ ID NO:1）Plasmid group fluorescence obviously weakens, and sees attached drawing 3.293 cell Lipofectamine
2000 reagents（Invitrogen）With 1 μ g long-chain non-coding RNAs（SEQ ID NO:1）Expression plasmid or control vector（Empty carrier
PGL3 and with gene PGL3-Controls of the H22954 without interaction）It is transfected with together with 1 μ g luciferase reporter gene carriers.
After 24-48 hours, observation fluorescence intensity turns long-chain non-coding RNA with the genetic comparison of empty carrier and H22954 without interaction
（SEQ ID NO:1）Plasmid group fluorescence obviously weakens.
Example IV
RNA antisenses purify（RAP）It measures.In short, will be with target RNA（SEQ ID NO:1）With the thermal denaturation of 5'- biotin complementaries
Biotinylation DNA oligonucleotide probe is with pretreated segment in GuSCN hybridization buffers（20mM Tris-HCl（pH
7.5）, 7 mM EDTA, 3mM EGTA, 150mM LiCl, 1%NP-40,0.2%N- Hamposyl Ls, 0.1% deoxidation born of the same parents
Sour sodium, 3M guanidine thiocyanates and 2.5mM TCEP）In in 37 DEG C be incubated 2 hours, intermittent oscillation, the streptavidin washed in advance
Albumen magnetic bead is added and is incubated 30 minutes at 37 DEG C, then shakes and washs.It is eluted by magnetic bead Magneto separate and with RNase H
Buffer solution（50mM Tris-HCl（pH 7.5）, 75mM NaCl, 3mM MgCl2, 0.125%N- Hamposyl Ls,
0.025% NaTDC and 2.5mM TCEP）Washing.RNA compounds are eluted and carry out qPCR measurement（95 ° 10 minutes
Afterwards, 40 cycles, 95 ° 30 ", 60 ° 1 '）With quantitative RNA yield and enrichment.
Long-chain non-coding RNA is separately added into hybridization solution（SEQ ID NO:1）Segment, BCL2 segments, and biotin is added
The probe of label, 37 degree reaction 2 hours after, be added streptomysin label magnetic bead, 37 degree 30 minutes, be put into magnetic field sorting, wash
Row qPCR afterwards（95 ° after ten minutes, 40 cycles, 95 ° 30 ", 60 ° 1 '）.It can be seen that the probe of H22954 is being combined with H22954
It can also be combined simultaneously with BCL2, the probe of BCL2 can also be combined with H22954, see attached drawing 4.Left figure is the knot of H22954 quantitative PCRs
Fruit after 3 ' the UTR segments of H22954 and BCL2 are added in reaction system, then adds wherein the first column is reaction system positive control
Entering can be in conjunction with the probe of H22954.Row quantitative PCR after purification.Second column is experimental group, be added in reaction system H22954 and
After 3 ' the UTR segments of BCL2, adding can be in conjunction with the probe of BCL2.Row quantitative PCR after purification.Three or four column is PCR system pair
According to being directly added respective segments in final eluent, carry out quantitative PCR.Right figure is H22954 quantitative PCRs as a result, wherein
First column is experimental group, and after 3 ' the UTR segments of H22954 and BCL2 are added in reaction system, adding can be in conjunction with the spy of H22954
Needle.Row quantitative PCR after purification.Second column is reaction system positive control, and the 3 ' UTR of H22954 and BCL2 are added in reaction system
After segment, adding can be in conjunction with the probe of BCL2.Row quantitative PCR after purification.Three or four column compares for PCR system, directly most
Respective segments are added in whole eluent, carry out quantitative PCR.As a result as it can be seen that H22954 probes can incite somebody to action while purifying itself
BCL2 is purified, and the probe of BCL2 also can be by H22954 fragment purifications.Illustrate that H22954 and BCL2 can be combined with each other.
Sequence table
<110>University Of Suzhou
<120>BCL2 gene inhibitors based on long-chain non-coding RNA
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 431
<212> DNA
<213>Artificial sequence (Artificial)
<400> 1
ggtgatggga aatttcagac tttgatttgg gccttggaaa acaggttcag tttcagtaga 60
tggaggtaaa aggaggcaaa gagcgacctt acgtaaatcc aaggctgaag gaaggaggct 120
ctaaggggtg tgtgggtgat taggagtaaa gtatcttgtc tgaaatgaag agtttctata 180
cagcatgctt atttggagtc atgcctaaca agattacttt gggtctaatt ttggaagctt 240
ggtactccag ggagcttgga catgaattta aagacaatgg gaactcacat ttaagtttct 300
gaaacagcca ggcgtggtgg ctcatgcctg taatcccagc acttcgggag gctgaggcag 360
gtggatcacc tgagatcagg agtttgagac cagtctaacc aacatggaga aaccccatct 420
ctacttaaaa g 431
Claims (8)
1. application of the long-chain non-coding RNA in preparing BCL2 gene inhibitors；The sequence of the long-chain non-coding RNA is SEQ
ID NO:1。
2. application of the long-chain non-coding RNA in inhibiting BCL2 genes；The sequence of the long-chain non-coding RNA is SEQ ID NO:
1。
3. long-chain non-coding RNA application in preparation of anti-tumor drugs；The sequence of the long-chain non-coding RNA is SEQ ID
NO:1。
4. a kind of BCL2 gene inhibitors are long-chain non-coding RNA, the sequence of the long-chain non-coding RNA is SEQ ID NO:
1。
5. long-chain non-coding RNA is transferred to plasmid vector, obtains antitumor drug by a kind of preparation method of antitumor drug；Institute
The sequence for stating long-chain non-coding RNA is SEQ ID NO:1.
6. the preparation method of antitumor drug according to claim 5, which is characterized in that the tumour includes that acute myeloid is white
Blood disease, acute leaching are leukaemia.
7. a kind of antitumor drug, which is characterized in that the antitumor drug is the plasmid vector for loading long-chain non-coding RNA；
The sequence of the long-chain non-coding RNA is SEQ ID NO:1.
8. antitumor drug according to claim 7, which is characterized in that the tumour includes acute myeloid leukemia, acute
Leaching is leukaemia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810152400.2A CN108452322B (en) | 2018-02-14 | 2018-02-14 | BCL2 gene inhibitor based on long-chain non-coding RNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810152400.2A CN108452322B (en) | 2018-02-14 | 2018-02-14 | BCL2 gene inhibitor based on long-chain non-coding RNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108452322A true CN108452322A (en) | 2018-08-28 |
| CN108452322B CN108452322B (en) | 2019-11-26 |
Family
ID=63216428
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810152400.2A Active CN108452322B (en) | 2018-02-14 | 2018-02-14 | BCL2 gene inhibitor based on long-chain non-coding RNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108452322B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108359671A (en) * | 2018-05-14 | 2018-08-03 | 苏州大学 | Tumour cell Sugar intake inhibitor and its application |
| CN110123829A (en) * | 2019-05-26 | 2019-08-16 | 苏州大学 | Long-chain non-coding RNA is preparing the application in Tumor angiogenesis inhibitor |
| WO2019165584A1 (en) * | 2018-02-27 | 2019-09-06 | 苏州大学张家港工业技术研究院 | Long-chain non-coding rna based bcl2 gene inhibitor |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107090452A (en) * | 2016-02-17 | 2017-08-25 | 张劲松 | A kind of long-chain non-coding RNA ENSMUST00000139055 and its application |
| CN104673797B (en) * | 2015-02-09 | 2018-02-02 | 苏州大学 | Participate in long-chain non-coding RNA and its application of human body cell ionising radiation stress reaction |
-
2018
- 2018-02-14 CN CN201810152400.2A patent/CN108452322B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673797B (en) * | 2015-02-09 | 2018-02-02 | 苏州大学 | Participate in long-chain non-coding RNA and its application of human body cell ionising radiation stress reaction |
| CN107090452A (en) * | 2016-02-17 | 2017-08-25 | 张劲松 | A kind of long-chain non-coding RNA ENSMUST00000139055 and its application |
Non-Patent Citations (2)
| Title |
|---|
| SENALDI,H: "Homo sapiens FOSMID clone ABC12-47837700F15 from chromosome 8, complete sequence", 《GENBANK:AC246783.1》 * |
| STEPHAN M. TANNER，ET AL.: "BAALC, the human member of a novel mammalian neuroectoderm gene lineage, is implicated in hematopoiesis and acute leukemia", 《PNAS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019165584A1 (en) * | 2018-02-27 | 2019-09-06 | 苏州大学张家港工业技术研究院 | Long-chain non-coding rna based bcl2 gene inhibitor |
| CN108359671A (en) * | 2018-05-14 | 2018-08-03 | 苏州大学 | Tumour cell Sugar intake inhibitor and its application |
| CN108359671B (en) * | 2018-05-14 | 2021-08-27 | 苏州大学 | Tumor cell sugar uptake inhibitor and application thereof |
| CN110123829A (en) * | 2019-05-26 | 2019-08-16 | 苏州大学 | Long-chain non-coding RNA is preparing the application in Tumor angiogenesis inhibitor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108452322B (en) | 2019-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107454843B (en) | Pharmaceutical composition for treating cancer comprising microribonucleic acid as active ingredient | |
| EA015570B1 (en) | Pharmaceutical composition | |
| CN108452322B (en) | BCL2 gene inhibitor based on long-chain non-coding RNA | |
| CN113249380B (en) | Antisense oligonucleotide targeting COVID-19 novel coronavirus, NATAC chimeric molecule and application thereof | |
| TW200808820A (en) | Sense oligonucleotide having suppressing effect on iNOS expression and composition comprising the same | |
| CN113151261A (en) | Antisense oligonucleotides as inhibitors of TGF-R signaling | |
| CN109929841B (en) | siRNA for inhibiting circ _0006033 expression and application thereof | |
| CN111733158B (en) | siRNA for inhibiting expression of hsa _ circ _0003599 and application thereof | |
| WO2004069148A2 (en) | Snornai-small nucleolar rna degradation by rna interference in trypanosomatids | |
| CN110551722B (en) | Nucleic acid compound and preparation method and application thereof | |
| CN109825504B (en) | siRNA for inhibiting circ _0001016 expression and application thereof | |
| CN109825502B (en) | siRNA for inhibiting circ _0054853 expression and application thereof | |
| US20200392514A1 (en) | Long-chain non-coding rna based bcl2 gene inhibitor | |
| JP6819907B2 (en) | Modified Anti-MIR-138 Oligonucleotide | |
| US20230129651A1 (en) | Hairpin structure nucleic acid molecules capable of modulating target gene expression and uses thereof | |
| WO2018152414A1 (en) | Small molecule inhibition of micro-rna-210 reprograms an oncogenic hypoxic circuit | |
| CN102145181B (en) | siRNA for inhibiting tumor growth and oligomeric nucleic acid combination and application of siRNA | |
| Pin-On et al. | Targeting high transcriptional control activity of long mononucleotide AT repeats in cancer by Argonaute 1 | |
| CN108642176B (en) | Application of PART1 as breast cancer diagnosis, treatment and prognosis marker | |
| CN112359115A (en) | miR-517a-3p related to cisplatin resistance of tumor cells and application thereof | |
| CN114574496A (en) | Aptamer sgc8 modified by nucleoside derivative | |
| CN114574495A (en) | Aptamer R50 modified by nucleoside derivative | |
| CN111575281A (en) | Nucleic acid molecule for regulating CDIP1 gene expression, regulating method and use | |
| CN110042121B (en) | Method for promoting leukemia cell differentiation and application thereof | |
| CN111647598B (en) | siRNA for inhibiting expression of hsa _ circ _0027477 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |