CN108410966B - Method for detecting insertion and deletion of ACE gene - Google Patents

Abstract

The invention discloses a method for detecting insertion and deletion of an ACE gene, which comprises the following steps: step S10, adding a probe with HEX mark and 1 pair of primers into a sample to be tested for reagent preparation; step S20, carrying out allelic PCR amplification on the reagent; in step S30, a dissolution curve is performed by means of the LC480 platform and the corresponding fluorescence signal is collected. The invention has the advantages that mature fluorescent quantitative PCR technology is utilized, only 1 HEX-labeled probe and 1 pair of common primers are needed, common unequal PCR is firstly carried out, then melting curves are operated on various fluorescent quantitative PCR instruments, and 3 genotypes of ACE gene polymorphism II, ID and DD can be completed in about 90 minutes. The method has the advantages of simple operation, rapid detection, clear and accurate interpretation, low cost, wide application in various instruments, high flux and the like.

Description

Method for detecting insertion and deletion of ACE gene

Technical Field

The invention relates to the technical field of gene detection, in particular to a fluorescence quantitative PCR detection method combining unequal PCR and a dissolution curve, which is used for detecting insertion and deletion of ACE genes.

Background

Introduction of ACE and its gene:

ACE is angiotensin converting enzyme, a single-chain acidic glycoprotein with a length of 20 peptides, a zinc-containing metallohydrolase, widely present in various tissues throughout the body, and mainly distributed in vascular endothelial cells (especially common in pulmonary circulation), renal epithelial cells, and the like.

It regulates blood pressure, the balance of aqueous electrolytes in vivo, and vascular endothelial development via the renin-angiotensin system (RAS) and kallikrein-kinin systems. Bradykinin is a natural substrate for ACE, inhibiting its biological activity by cleaving two hydroxy-terminal dipeptides. At the same time it catalyzes the conversion of the decapeptide angiotensin i (Ang i) to the octapeptide angiotensin II (Ang II), the ACE level determining the amount of Ang II produced in the RAS. ACE is a key enzyme in the RAS enzyme/substrate chain reaction system. RAS includes Angiotensinogen (AO), Ang I, Ang II, renin, ACE and angiotensin II receptor (AT). RAS has a marked role in the cardiovascular system, such as regulation of blood pressure, blood volume, vascular tone, and causing thickening of the vessel wall or hypertrophy of cardiomyocytes and proliferation of non-cardiomyocytes. Wherein AngII is an effector peptide in RAS, and causes myocardial and vascular contraction, regulates electrolyte balance, and causes cell proliferation and proliferation through its receptor AT. Ang II has direct and transient effects on the heart, including increasing heart rate and enhancing contractility of the myocardium; at the same time Ang II also has long-term effects on the heart affecting its structure, mainly by causing hypertrophy of cardiomyocytes and stimulation of collagen and connective tissue production by fibroblasts.

Numerous studies have demonstrated that the ACE gene is the major gene determining ACE levels, and that polymorphisms in the ACE gene control differences in ACE levels in individuals, which are shown in: the ACE level is stable at an individual level, the measurement repeatability is good, and environmental metabolism and hormone factors have little influence on the ACE level, wherein the ACE level of a female is slightly lower than that of a male, the ACE level of an adult is not different with age, but the ACE level of a child before puberty is obviously higher than that of an adult; the second expression is: ACE levels vary significantly from individual to individual by as much as 5-fold.

The ACE gene is located in 3 rd sub-band (17q23.3) of long arm 2 region of chromosome 17, has the total length of 21Kb, and has 26 exons, 25 introns and two promoters. The internal structure of the ACE gene has certain symmetry, and the lengths of exon 4 to exon 11 and exon 17 to exon 24 are very similar to those of a coding sequence, wherein the homology between exon 7 and exon 20 is 70%, and the homology between exon 8 and exon 21 is 68%, thus indicating the possibility of gene replication.

Significance of ACE polymorphism detection:

the ACE gene is highly polymorphic, and 6 polymorphic markers are found in the ACE gene at present, but the Alu insertion (I) and/or deletion (D) fragment of 287bp present in the 16 th intron are most studied, and thus, the ACE gene can be classified into three different genotypes, DD type (homozygote), ID type (heterozygote), and II type (homozygote), at this polymorphic site. DNA polymorphism refers to the difference in nucleotide arrangement among chromosomal alleles, and alleles (or fragments) in a DNA region exist in two or more forms, which can be classified into sequence polymorphism and sequence length polymorphism. Wherein the sequence length polymorphism appears as a tandem repeat of a repetitive sequence with respective core sequences or is scattered on a chromosome in a low distribution, and forms a polymorphism (e.g., Alu repeat) in an insertion/deletion manner, which is one of the most valuable genetic markers at present.

It has been shown that there may be an enhancer in this insert that promotes transcription of ACE. Family researches show that the I/D polymorphism is dominant inheritance, and the frequency distribution of the polymorphism has obvious difference in different ethnic groups. Research shows that the 14bp sequence contained at the beginning of the inserted 287bp sequence is identical with the 14bp sequence following at the terminal end of the inserted sequence, and the structure of the repeated sequence can generate the origin of ACE gene polymorphism deletion, so that a deletion type structure with the 287bp sequence excluded is caused, and the nature of the ACE gene polymorphism is deletion instead of insertion.

Present research evidence suggests that ACE functional polymorphisms linked to I/D polymorphisms affect the pathophysiological state of the body through both RAS and kallikrein-kinin systems. The results mainly include the following two main aspects: (1) the research on the relation between the ACE gene I/D polymorphism and various diseases relates to a plurality of fields, including the aspects of occurrence, development, symptoms, prognosis and reaction to medicines of the diseases, the research on the ACE gene polymorphism widens a wide field for the genetic research of cardiovascular diseases, and most of the research tends to support the correlation between the ACE level and the I/D polymorphism of the ACE gene and the onset of hypertension. For the relation between the ACE gene polymorphism and coronary heart disease and myocardial infarction, scholars at home and abroad think that the ACE gene polymorphism is related to coronary heart disease and myocardial infarction, and more research reports also prove that the ACE gene polymorphism is related to diseases such as left ventricular hypertrophy, type II diabetes, atherosclerotic diseases, diabetic nephropathy, stroke and the like. (2) The I/D polymorphism of the ACE gene has certain correlation with diseases such as hypertension and the like, is also related to the human body movement ability, is mainly closely related to endurance quality, and particularly has close relation with aerobic endurance. Studies have shown that in excellent mountaineers, rowing athletes and other athletes with some excellent endurance type programs, which have good aerobic endurance, they all share some common features, namely, those who possess at least one I allele are more robust than individuals with two D genotypes, and thus it is speculated that the I allele enhances the ability to absorb oxygen, contributing to the enhancement of the aerobic endurance of the individual. The current research considers that the circulatory system is a main factor for limiting the aerobic endurance of human beings, so that the ACE gene mainly influences the heart and lung functions of the human bodies, thereby influencing the aerobic endurance quality of the human bodies.

Comparison of the current site detection techniques:

the reported I/D typing of ACE gene polymorphism is conventionally performed by a Sanger sequencing method, a fluorescent quantitative PCR method, denaturing high performance liquid chromatography (dHPLC), restriction fragment length polymorphism analysis (RFLP), and the like. Sanger sequencing is considered as the gold standard for detection, but the method is long in cycle and high in cost since PCR amplification is carried out and then the method is sent to a professional company for sequencing. RFLP realizes the purpose of genotyping by identifying a specific site through restriction enzyme, selectively cutting a target region and finally checking the size of a fragment through electrophoresis. The method is complicated in electrophoretic operation, cannot be used for detection without a new enzyme cutting site, and is relatively limited. In addition, Sanger sequencing and RFLP flux are low, and the requirement of practical application is difficult to meet. The denaturing high performance liquid chromatography combines the methods of single-strand conformation polymorphism (SSCP) and Denaturing Gradient Gel Electrophoresis (DGGE), and can automatically detect single-base substitution and insertion or deletion of small fragment nucleotides. However, the cost of the technical platform and the detection cost are high, and the universal application is difficult. Recently, the ACE gene polymorphism I/D typing is a method for detecting by utilizing fluorescence quantitative PCR, and detection is carried out by designing a modified primer and a plurality of probes, so that the operation is complicated and the cost is high.

Disclosure of Invention

The invention mainly aims to provide a method for detecting insertion and deletion of ACE genes, which has the advantages of simple operation, rapid detection, clear and accurate interpretation, low cost, suitability for various instruments, universal application, high flux and the like.

In order to achieve the above object, the present invention provides a method for detecting insertion and deletion of ACE gene, comprising the steps of:

step S10, adding a probe with HEX mark and 1 pair of primers into a sample to be tested for reagent preparation;

step S20, carrying out allelic PCR amplification on the reagent;

in step S30, a dissolution curve is performed by means of the LC480 platform and the corresponding fluorescence signal is collected.

Preferably, the sequence of the probe comprises at least 5'-HEX-TTACAGGCGTGATACAGTCACTTTTATG-3' -BHQ 1.

Preferably, the probe sequence may have 5' added bases in the insert.

Preferably, in the probe sequence, bases in several deletion fragments can be added at the 3' end.

Preferably, the 1 pair of primers are a forward sequence and a reverse sequence; wherein, the forward sequence is ACTCCCATCCTTTCTCCCATT, and the reverse sequence is CTTAGCTCACCTCTGCTTGTAA.

Preferably, the amount of primer for the forward sequence: primer amount for reverse sequence: the amount of probe used was 5:1: 2.

Preferably, the step S20 specifically includes:

step S201, continuously treating the reagent for 5 minutes at the temperature of 95 ℃;

step S202, continuously treating the reagent for 15 seconds at the temperature of 95 ℃;

step S203, continuously treating the reagent for 20 seconds at the environment of 58 ℃;

step S204, continuously treating the reagent at 72 ℃ for 25 seconds;

in step S205, the process returns to step S202, and the loop is performed 50 times in steps S202 to S204.

Preferably, the step S30 specifically includes:

step S301, continuously reacting for 1 minute at the temperature of 95 ℃;

step S302, continuously reacting for 4 minutes at the temperature of 45 ℃;

step S303, heating from 45 ℃ to 85 ℃, and collecting fluorescence signals at the same time;

and step S304, reacting for 10 seconds in an environment at 50 ℃.

Preferably, the unequal PCR system is an 8. mu.L system.

The invention has the advantages that mature fluorescent quantitative PCR technology is utilized, only 1 HEX-labeled probe and 1 pair of common primers are needed, common unequal PCR is firstly carried out, then melting curves are operated on various fluorescent quantitative PCR instruments, and 3 genotypes of ACE gene polymorphism II, ID and DD can be completed in about 90 minutes. The method has the advantages of simple operation, rapid detection, clear and accurate interpretation, low cost, wide application in various instruments, high flux and the like.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the structures shown in the drawings without creative efforts.

FIG. 1 shows the principle of ACE insertion and deletion fragment primer and probe design;

FIG. 2 shows the results of high throughput sequencing of sample A;

FIG. 3 shows the results of high throughput sequencing of sample B;

FIG. 4 is the high throughput sequencing results for sample C;

FIG. 5 is a screenshot of the rs 46994Sanger sequencing insert 50-100 at site;

FIG. 6 is a screenshot of the rs 46994Sanger sequencing insert 100-150 at site;

FIG. 7 is a screenshot of a site rs4646994Sanger sequencing insert 150-200;

FIG. 8 is a screenshot of the rs 46994Sanger sequencing insert 200-250 at site;

FIG. 9 is a screenshot of a site rs4646994Sanger sequencing insert 250-300;

FIG. 10 is a screenshot of a site rs4646994Sanger sequencing insert 300-350;

FIG. 11 shows the results of agarose gel run-out at site rs4646994 of sample A, B, C;

FIG. 12 shows the results of the detection of sample A with 1 probe and 1 pair of primers according to the present invention;

FIG. 13 shows the results of the detection of sample B with 1 probe and 1 pair of primers according to the present invention;

FIG. 14 shows the results of detection of sample C using 1 probe and 1 pair of primers of the present invention.

The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The invention provides a method for detecting insertion and deletion of an ACE gene, which comprises the following steps:

step S10, adding a probe with HEX mark and 1 pair of primers into a sample to be tested for reagent preparation;

step S20, carrying out allelic PCR amplification on the reagent;

in step S30, a dissolution curve is performed by means of the LC480 platform and the corresponding fluorescence signal is collected.

The reagent is prepared as follows:

in this example, the forward primer and the reverse primer constitute 1 pair of primers. The probe is a probe having a HEX label, and the reagent is prepared as listed above.

Further, the sequence of the probe at least comprises 5'-HEX-TTACAGGCGTGATACAGTCACTTTTATG-3' -BHQ 1. As shown in the attached figure 1 of the specification, when analyzing the insertion and deletion fragments of the ACE gene in the attached figure 1, 1 probe needs to be designed to detect the insertion and deletion of the ACE gene, so that the designed probe region needs to cover the fragments which are specific to the insertion and deletion simultaneously. Sequencing analysis of ACE gene insertion and deletion fragments, which contain a common fragment a, 10 bases ATACAGTCAC and a fragment b, 4 bases TTTT, in either deletion or insertion. Therefore, when detecting the insertion fragment of the ACE gene, the length of the designed probe needs to be longer than ATACAGTCAC + TTTT. To increase the specificity of the probe for detecting the insert, the probe was designed to contain the unique sequence c, 11 bases TTACAGGCGTG in the insert, so that the probe combination was TTACAGGCGTG + ATACAGTCAC + TTTT. The probe has a sequence c that only perfectly matches the insert, ensuring that the insert is detected. The designed probe TTACAGGCGTG + ATACAGTCAC + TTTT can detect the insertion fragment of the ACE gene, and when the fragment is inserted, 25 bases of the probe are completely complementary. However, when the ACE gene is deleted, the probe has a mismatched sequence c, TTACAGGCGTG, so that when the probe is hybridized, a plurality of base mismatches exist, the hybridization may fail, a fluorescent signal cannot be detected or the Tm value of a curve peak diagram after the hybridization passes through a dissolution curve is very low, so that the detection range is not in the set program. In order to solve the problems and increase the specificity of the probe for detecting the deletion sequence, the tail part of the probe is added with the d sequence and 3 base ATG in the deletion fragment, thereby improving the specificity of the probe for detecting the deletion fragment and the Tm value after hybridization. In consideration of the above situation, the designed probe region combination is c + a + b + d in FIG. 1, i.e. TTACAGGCGTG + ATACAGTCAC + TTTT + ATG, and can simultaneously detect the insertion and deletion genotypes of the ACE gene. Probe TTACAGGCGTG + ATACAGTCAC + TTTT + ATG, with flexibility, can be modified by further design. The probe sequence is 5 'added with a plurality of bases in the inserted segment, such as adding base A, or 3' added with a plurality of bases in the deleted segment, such as adding T, TG, and the like, and the probe sequence belongs to the scope of the patent. In this embodiment, based on the original probe, the probes 5 'and 3' can additionally add bases in the insertion fragment e and the deletion fragment f, respectively, to increase the specificity of probe detection. Such as A + TTACAGGCGTG + ATACAGTCAC + TTTT + ATG + T.

With respect to the primers: the 1 pair of primers is a forward sequence and a reverse sequence; wherein, the forward sequence is ACTCCCATCCTTTCTCCCATT, and the reverse sequence is CTTAGCTCACCTCTGCTTGTAA. Because the ACE gene has an inserted segment 289bp, when the ACE gene is deleted, the segments amplified by the designed primers (F and R in figure 1) need to be shorter, so that when the segments are inserted, the segments amplified by the primers are suddenly increased by 289bp on the original basis, and the amplification efficiency is not influenced. When the ACE gene fragment is deleted, the designed primer amplification fragment is only 110-130 bp. Preferably, the primer amplified fragment is 120 bp. Even if the ACE gene is inserted into a 289bp fragment, the length of the amplified fragment is at most about 410bp, and the amplification in the set PCR program is satisfied. And the amplified fragment runs the gel to confirm that the strip is single, so that the influence of a non-specific strip on the experimental result is avoided. Primer usage for forward sequence: primer amount for reverse sequence: the amount of probe used was 5:1: 2.

In this example, three samples were selected for sequencing validation, the three samples being: A. b, C, the value of DNA OD260/OD280 should be 1.8-2.0, the concentration should be above 5 ng/. mu.L, the effect is better, and the NanoDrop 2000 has good peak diagram when detecting the DNA concentration. By means of the LC480 platform, 50 cycles of allelic PCR are first performed, and then the melting curve is operated, so that the purpose of genotyping is achieved. It should be noted that the unequal PCR system was an 8. mu.L system.

Table 1: primer and probe sequence of locus rs4646994

For step S20, the reagents were subjected to allelic PCR amplification. The step S20 specifically includes:

step S201, continuously treating the reagent for 5 minutes at the temperature of 95 ℃;

step S202, continuously treating the reagent for 15 seconds at the temperature of 95 ℃;

step S203, continuously treating the reagent for 20 seconds at the environment of 58 ℃;

step S204, continuously treating the reagent at 72 ℃ for 25 seconds;

in step S205, the process returns to step S202, and the loop is performed 50 times in steps S202 to S204.

With respect to step S30, a dissolution curve was performed by means of the LC480 platform and the corresponding fluorescence signal was collected. Step S30 specifically includes:

step S301, continuously reacting for 1 minute at the temperature of 95 ℃;

step S302, continuously reacting for 4 minutes at the temperature of 45 ℃;

step S303, heating from 45 ℃ to 85 ℃, and collecting fluorescence signals at the same time;

and step S304, reacting for 10 seconds in an environment at 50 ℃.

Through steps S10-S30, sample A, B, C respectively obtained the sequencing results shown in table 2;

TABLE 2

Sample name	120bp sequencing	Sequencing at 420bp	Genotype(s)
				A	Failure of	Successful	II
B	Successful	Successful	ID
				C	Successful	Failure of	DD

Referring to FIG. 11, the sample A, B, C site rs 46994 agarose gel run results (sample A only has bands around 420, sample B has bands around 120 and 420, and sample C has bands around 120).

The principle of the detection method of the invention is as follows: when the sample is in genotype II, as shown in FIG. 12, the designed probe is completely complementary to the fragment, so that the melting curve analysis has a single peak pattern at high temperature. When genotype ID is present in the sample, as shown in FIG. 13, the probe is completely matched and incompletely matched, so that peaks at 2 different temperatures appear. When the sample is of genotype DD, as shown in FIG. 14, the first 11 bases of the probe are not completely matched, so that the probe is unstable after hybridization, and the dissolution curve analysis has a single peak pattern at low temperature. The experimental results are completely consistent through high-throughput sequencing (detailed in figures 2-4), Sanger sequencing and agarose gel verification, and the detection method is proved to be reliable. It should be noted that the rs4646994Sanger sequencing insert is shown in FIGS. 5-10, wherein FIGS. 5-10 are continuous interfaces, which are broken down into FIGS. 5-10 due to space limitations.

The invention has the advantages that mature fluorescent quantitative PCR technology is utilized, only 1 HEX-labeled probe and 1 pair of common primers are needed, common unequal PCR is firstly carried out, then melting curves are operated on various fluorescent quantitative PCR instruments, and 3 genotypes of ACE gene polymorphism II, ID and DD can be completed in about 90 minutes. The method has the advantages of simple operation, rapid detection, clear and accurate interpretation, low cost, wide application in various instruments, high flux and the like.

The above description is only a preferred embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes, which are made by using the contents of the present specification and the accompanying drawings, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.

Claims (6)

1. A method for the non-diagnostic purpose of detecting ACE gene insertions and deletions comprising the steps of:

step S10, adding a probe with HEX mark and 1 pair of primers into a sample to be tested for reagent preparation; wherein the sequence of the probe at least comprises 5'-HEX-TTACAGGCGTGATACAGTCACTTTTATG-3' -BHQ 1; the 1 pair of primers is a forward sequence and a reverse sequence; wherein, the forward sequence is ACTCCCATCCTTTCTCCCATT, and the reverse sequence is CTTAGCTCACCTCTGCTTGTAA; and, the amount of primer for the forward sequence: primer amount for reverse sequence: the probe dosage is 5:1: 2;

step S20, carrying out allelic PCR amplification on the reagent;

in step S30, a dissolution curve is performed by means of the LC480 platform and the corresponding fluorescence signal is collected.

2. The method for detecting ACE gene insertions and deletions for non-diagnostic purposes as claimed in claim 1, wherein the probe sequence is increased 5' of the bases in the insertion.

3. The method for detecting ACE gene insertion and deletion for non-diagnostic purposes as claimed in claim 1 wherein the probe sequence is augmented 3' with bases from several of the deleted fragments.

4. The method for detecting ACE gene insertions and deletions for non-diagnostic purposes as claimed in claim 1, wherein step S20 specifically comprises:

step S201, continuously treating the reagent for 5 minutes at the temperature of 95 ℃;

step S202, continuously treating the reagent for 15 seconds at the temperature of 95 ℃;

step S203, continuously treating the reagent for 20 seconds at the environment of 58 ℃;

step S204, continuously treating the reagent at 72 ℃ for 25 seconds;

in step S205, the process returns to step S202, and the loop is performed 50 times in steps S202 to S204.

5. The method for detecting ACE gene insertions and deletions for non-diagnostic purposes as claimed in claim 1, wherein step S30 specifically comprises:

step S301, continuously reacting for 1 minute at the temperature of 95 ℃;

step S302, continuously reacting for 4 minutes at the temperature of 45 ℃;

step S303, heating from 45 ℃ to 85 ℃, and collecting fluorescence signals at the same time;

and step S304, reacting for 10 seconds in an environment at 50 ℃.

6. The method for the non-diagnostic purpose of detecting ACE gene insertion and deletion according to any one of claims 1 to 5 wherein the anisotopic PCR system is an 8 μ L system.

Images