CN108410908B - Method for regulating cell pathway by using plant hormone GA and small molecular substance PAC - Google Patents

Abstract

The invention provides a method for regulating a cell pathway by utilizing a plant hormone GA and a small molecular substance PAC, which realizes the regulation and control of a signal pathway in a human cell. GA receptor proteins GID1 and GAI in arabidopsis thaliana are constructed on a human cell expression vector, then are transferred into HEK293T cells together, GA is added to induce the interaction of the two proteins, and the interaction degree is weakened after inhibitor PAC is added. In this way, key proteins in the human cell signaling pathway are expressed in fusion with these two receptor proteins, which interact under GA induction, resulting in the fused signaling pathway also being induced by GA. The invention selects the key protein LRP6 on the human Wnt pathway. After the GA receptor and LRP6 are expressed by fusion, LRP6 is aggregated under the induction of GA, thereby promoting the production of beta-catenin, opening a signal path in cells, and after PAC inhibition is added, the production amount of beta-catenin is reduced, and the cell path is closed.

Description

Method for regulating cell pathway by using plant hormone GA and small molecular substance PAC

Technical Field

The invention relates to the field of biological methods, in particular to a method for regulating a cell pathway by using a plant hormone GA and a small molecular substance PAC.

Background

Optogenetics is a new technology combining optocontrol technology with genetics to conduct cell biology research, namely, expressing light-sensitive ion channel protein on excitable target cells or target organs, activating the light-sensitive channel by using illumination with corresponding wavelength to realize fine regulation and control on physiological functions of cells, tissues, organs and animals, and so far, a plurality of photoreceptors are improved and used for fusing key proteins on signal paths to regulate and control a plurality of paths in organisms, such as a receptor tyrosine kinase Ras-MAPK signal path, a PI3K-Akt signal path and a Wnt signal path. At the gene level, researchers have utilized elements such as CRY2-CIB1, FKF1-GI, UVR8-COP1, and LOV proteins to regulate transcriptional expression of specific genes in mammalian cells. The arabidopsis blue light receptor CRY2 is expressed by fusion with LRP6 protein in Wnt signal path, and experiments prove that CRY2 aggregation under blue light induction also leads to fusion expression of LRP 6. Thereby regulating and controlling a downstream beta-catenin signal channel.

The Zhang Feng laboratory at Mazhou engineering university uses the immunosuppressive factor Rapamycin (Rapamycin) to control its receptor protein and forms a transcriptional activation system with dCas 9. The Zhang Feng fuses and expresses a receptor protein FKBP with the C terminal of dCas9 and a transcription activator VP 64; FRB is expressed by fusion with the N-terminus of dCas 9. The two vectors and the sgRNA are co-transferred into cells, and transcription of a target gene is activated after rapamycin treatment. However, both this method and optogenetics have certain limitations. Rapamycin is an immunosuppressive agent, and has certain damage to the immune system; optogenetic systems are not suitable for the regulation of light signaling pathways in cells.

Inspired by optogenetics (optogenetics) to utilize light receptors to regulate relevant cell signaling pathways, we hypothesized to utilize the chemical small molecule substance phytohormone GA to induce receptor protein interactions to regulate cell signaling.

The status of Gibberellin (GA) as a plant hormone was established in the 50 s of the 20 th century. The typical physiological role of GA is to significantly promote the elongation growth of plant stem nodes and play an important role in various physiological activities of plants from seed germination to flowering and fruiting. GA is a diterpene acid compound, has no toxicity, and does not cause any harm to human health. On the contrary, it has been reported that a proper amount of gibberellin is administered to treat diseases such as gastric ulcer and gastric mucosa injury. The GA signaling pathway dependent transduction requires the receptor protein GID1 (GA INSENSITIVE DWARF 1), GA binding to GID1 promotes the change of the conformation at the GID1N end, and the GA-GID1 complex can bind to the DELLA protein family, the GA signaling inhibitor. Promote degradation of DELLA protein by 26s proteasome to activate GA signaling pathway. GAI is a member of the DELLA proteins. Paclobutrazol (Paclobutrazol) PAC is a plant growth inhibitor and can antagonize GA by inhibiting the biological activity of GA.

By utilizing the characteristics of GA induction of GID1 and GAI protein interaction and PAC inhibition of the process and the principle of optogenetics, we tried to develop a system for regulating and controlling intracellular signal pathways by using nonhazardous natural phytohormones as inducers.

Disclosure of Invention

The invention aims to provide a method for regulating a cell pathway by using a plant hormone GA and a small molecule substance PAC.

In order to achieve the purpose, the invention adopts the following technical scheme:

a method of modulating a cellular pathway using the plant hormone GA and the small molecule substance PAC, comprising the steps of:

(1) designing and constructing a vector:

firstly, amplifying each gene segment by using the primer and using arabidopsis thaliana cDNA and HEK293T cell cDNA as templates and using PCR technology, and then performing overlap PCR by using two segments as templates and using the corresponding primer; at this time, Arabidopsis thaliana DELLA protein GAI and GA receptor GID1 are fused with the C end of key protein LRP6 in Wnt signal pathway, PCR products such as GAI, GID1, GAI-LRP6C and GID1-LRP6C are recovered by agarose gel, linearized pCI 4xmyc, pCI egfp and pCI mcerry vectors are double-digested by endonuclease XbaI XmaI, and are connected by Infusion method, DH5a is transformed, colony PCR is verified, clones are picked and sequenced, and correctly sequenced bacteria are preserved; by using the above operation, animal expression vectors pCI-neo egfp GAI, pCI-neo 4xMYC GID1, pCI-neo mcherry GID-LRP6C, pCI-neo 4xMYC GID-LRP6C, and pCI-neo egfp GAI-LRP6C were constructed;

(2) culture and transfection of animal cells:

taking out frozen HEK293T cells from liquid nitrogen, rapidly recovering the cells in a water bath at 37 ℃, then putting the cells into a centrifuge, centrifuging for 5min at 800g, removing supernatant, adding 1ml of DMEM high-glucose cell culture solution to resuspend the cells, adding the cell suspension into a cell culture bottle containing preheated 10ml of DMEM culture medium, replacing the culture medium after 24h until the growth rate of the cells reaches 90%, resuspending the cells and transferring the cells into a 6-well plate, performing calcium phosphate cell transfection after 24h of transfer, and transfecting 2 micrograms of two plasmids pCI-neo egfp GAI and pCI-neo 4xMYC GID or two plasmids pCI-neo 4xMYC GID-6C and pCI-neo egfp GAI-LRP6C in each hole of a six-well plate;

(3) administration of GA and PAC

24h after transfection, GA was added to a final concentration of 10. mu.M, and the cells were incubated at 37 ℃ with 5% CO₂Incubating for 12h, adding inhibitor PAC with final concentration of 100nM, and incubating for 3 h; after incubation, cells were resuspended, lysed with cell lysate and detected with Western blot.

The construction method of the pci 4xmyc and the pci mcherry vector comprises the following steps: PCR primers were designed as follows:

Myc F :ctagcctcgagaattcatggggttaattaacggtg；

Myc R: TACCACGCGTGAATTCGCTACCGTTCAAGTCTTCC；

mcherry F： ctagcctcgagaattcatggtgagcaagggcgagg；

mcherry R： TACCACGCGTGAATTCCTACTTGTACAGCTCGTCCA；

and (2) amplifying myc and mcherry fragments by using 4xmyc (SEQ ID NO. 19) and mcherry (SEQ ID NO. 20) as templates, and then, carrying out single enzyme digestion on the pci neo vector by using EcoRI enzyme, and respectively connecting the pci neo vector with a linearized vector to construct the pci 4xmyc and the pci mcherry.

Pci Egfp vector: the Egfp primers were designed as follows:

Egfp F‘ cagcctcgagaattcatggtgagcaagggcgagga

Egfp R‘：TACCACGCGTGAATTCCTTGTACAGCTCGTCCATG

the pcr amplified egfp product, then connected with EcoRI linearized PCI (neo) vector to construct the pci egfp vector.

The invention has the advantages that: the plant hormone is a safe, non-toxic and economical compound, so that the plant hormone is used for regulating the pathway in human cells and the GA gibberellin is an important plant hormone, so that the interaction of GA receptors GID1 and DELLA protein GAI when GA is applied can be used for guiding the proteins which can only function through the interaction in the pathway of the human cells to form an effective switch for regulating the downstream of the proteins. Thus, the function of the gene can be analyzed by inducing the expression of the gene by GA.

Drawings

FIG. 1 pCI-neo 4xMYC GID1 related vector design.

FIG. 2 pCI-neo egfp GAI related vector design.

FIG. 3 pCI-neo 4xMYC GID1-LRP6C related vector design.

FIG. 4 pCI-neo egfp GAI-LRP6C related vector design.

FIG. 5 graph of the receptor protein CoIP, where GAI was added after transfection of cells with GID1 (final concentration 10 μ M), after 12h the inhibitor PAC (final concentration 100nM) and after 3h the protein was detected by wenston, and GA was found to promote the interaction between GAI and GID1 in 293T cells with reduced interaction after the addition of the inhibitor.

FIG. 6 is a BiFC graph of the receptor proteins, in which GAI and GID1 were linked to the two parts CYFP and NYFP of the fluorescent protein YFP, respectively, and after transfection of 293T cells, GA and PAC treatments were followed by BiFC experiments and fluorescence intensity was measured by fluorescence inverted microscopy.

FIG. 7 is a graph of CoIP fusion expressed proteins, in which GAI was fusion expressed with GID1 and LRP6C and co-transferred into HEK293T cells, and the GAI and GID1 were treated and then subjected to a CoIP test, and it was found that the fusion proteins were equally able to interact under GA induction, while inhibitors could reduce the interaction.

FIG. 8 BiFC map of fusion expression proteins, in which GFP-GAI-LRP6C and mcherry-GID1-LRP6C were co-transferred into HEK293T cells, and after GA and PAC treatment, fluorescence was observed in a fluorescence inverted microscope. GAI-LRP6C aggregated with GID1-LRP6C under GA induction, whereas aggregation was reduced upon addition of inhibitor.

Detailed Description

Example 1

A method of modulating a cellular pathway using the plant hormone GA and the small molecule substance PAC, comprising the steps of:

(1) designing and constructing a vector:

firstly, amplifying each gene segment by using the primer and using arabidopsis thaliana cDNA and HEK293T cell cDNA as templates and using PCR technology, and then performing overlap PCR by using two segments as templates and using the corresponding primer; at this time, Arabidopsis thaliana DELLA protein GAI and GA receptor GID1 are fused with the C end of key protein LRP6 in Wnt signal pathway, PCR products such as GAI, GID1, GAI-LRP6C and GID1-LRP6C are recovered by agarose gel, linearized pCI 4xmyc, pCI egfp and pCI mcerry vectors are double-digested by endonuclease XbaI XmaI, and are connected by Infusion method, DH5a is transformed, colony PCR is verified, clones are picked and sequenced, and correctly sequenced bacteria are preserved; by using the above operation, animal expression vectors pCI-neo egfp GAI, pCI-neo 4xMYC GID1, pCI-neo mcherry GID-LRP6C, pCI-neo 4xMYC GID-LRP6C, and pCI-neo egfp GAI-LRP6C were constructed;

(4) culture and transfection of animal cells:

taking out frozen HEK293T cells from liquid nitrogen, rapidly recovering the cells in a water bath at 37 ℃, then putting the cells into a centrifuge, centrifuging for 5min at 800g, removing the supernatant, adding 1ml of DMEM high-glucose cell culture solution for resuspending the cells, adding the cell suspension into a cell culture bottle containing preheated 10ml of DMEM culture medium, replacing the culture medium after 24h, resuspending the cells until the growth rate of the cells reaches 90%, transferring the cells into a 6-well plate, performing calcium phosphate cell transfection after 24h of transfer, and transfecting 2 micrograms of two plasmids of pCI-neo egfp GAI and pCI-neo 4xMYC GID in each hole of a six-well plate;

(3) administration of GA and PAC

24h after transfection, GA was added to a final concentration of 10. mu.M, and the cells were incubated at 37 ℃ with 5% CO₂Incubating for 12h, adding inhibitor PAC with final concentration of 100nM, and incubating for 3 h; after incubation, cells were resuspended, lysed with cell lysate and detected with Western blot.

The construction method of the pci 4xmyc and the pci mcherry vector comprises the following steps: PCR primers were designed as follows:

Myc F :ctagcctcgagaattcatggggttaattaacggtg；

Myc R: TACCACGCGTGAATTCGCTACCGTTCAAGTCTTCC；

mcherry F： ctagcctcgagaattcatggtgagcaagggcgagg；

mcherry R： TACCACGCGTGAATTCCTACTTGTACAGCTCGTCCA；

and (2) amplifying myc and mcherry fragments by using 4xmyc (SEQ ID NO. 19) and mcherry (SEQ ID NO. 20) as templates, and then, carrying out single enzyme digestion on the pci neo vector by using EcoRI enzyme, and respectively connecting the pci neo vector with a linearized vector to construct the pci 4xmyc and the pci mcherry.

Pci Egfp vector: the Egfp primers were designed as follows:

Egfp F‘ cagcctcgagaattcatggtgagcaagggcgagga

Egfp R‘：TACCACGCGTGAATTCCTTGTACAGCTCGTCCATG

the pcr amplified egfp product, then connected with EcoRI linearized PCI (neo) vector to construct the pci egfp vector.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Jilin university

<120> a method for regulating cell pathway by using plant hormone GA and small molecule substance PAC

<130> 20

<160> 20

<170> PatentIn version 3.3

<210> 1

<211> 36

<212> DNA

<213> Artificial sequence

<400> 1

gcgtggtacc tctagaatgg ctgcgagcga tgaagt 36

<210> 2

<211> 36

<212> DNA

<213> Artificial sequence

<400> 2

gaagcggccg cccgggttaa cattccgcgt ttacaa 36

<210> 3

<211> 36

<212> DNA

<213> Artificial sequence

<400> 3

gcgtggtacc tctagaatgg ctgcgagcga tgaagt 36

<210> 4

<211> 46

<212> DNA

<213> Artificial sequence

<400> 4

cccgagccac cgccggaacc gccaccttaa cattccgcgt ttacaa 46

<210> 5

<211> 44

<212> DNA

<213> Artificial sequence

<400> 5

ggcggtggct cgggaggtgg ctcaaggatg ttgtgtccac gtat 44

<210> 6

<211> 36

<212> DNA

<213> Artificial sequence

<400> 6

gaagcggccg cccgggtcag gaggagtctg tacagg 36

<210> 7

<211> 36

<212> DNA

<213> Artificial sequence

<400> 7

gcgtggtacc tctagaatga agagagatca tcatca 36

<210> 8

<211> 36

<212> DNA

<213> Artificial sequence

<400> 8

gaagcggccg cccgggattg gtggagagtt tccaag 36

<210> 9

<211> 36

<212> DNA

<213> Artificial sequence

<400> 9

gcgtggtacc tctagaatga agagagatca tcatca 36

<210> 10

<211> 46

<212> DNA

<213> Artificial sequence

<400> 10

cccgagccac cgccggaacc gccaccattg gtggagagtt tccaag 46

<210> 11

<211> 44

<212> DNA

<213> Artificial sequence

<400> 11

ggcggtggct cgggaggtgg ctcaaggatg ttgtgtccac gtat 44

<210> 12

<211> 36

<212> DNA

<213> Artificial sequence

<400> 12

gaagcggccg cccgggtcag gaggagtctg tacagg 36

<210> 13

<211> 35

<212> DNA

<213> Artificial sequence

<400> 13

ctagcctcga gaattcatgg ggttaattaa cggtg 35

<210> 14

<211> 35

<212> DNA

<213> Artificial sequence

<400> 14

taccacgcgt gaattcgcta ccgttcaagt cttcc 35

<210> 15

<211> 35

<212> DNA

<213> Artificial sequence

<400> 15

ctagcctcga gaattcatgg tgagcaaggg cgagg 35

<210> 16

<211> 36

<212> DNA

<213> Artificial sequence

<400> 16

taccacgcgt gaattcctac ttgtacagct cgtcca 36

<210> 17

<211> 35

<212> DNA

<213> Artificial sequence

<400> 17

cagcctcgag aattcatggt gagcaagggc gagga 35

<210> 18

<211> 35

<212> DNA

<213> Artificial sequence

<400> 18

taccacgcgt gaattccttg tacagctcgt ccatg 35

<210> 19

<211> 174

<212> DNA

<213> 4xmyc

<400> 19

atggggttaa ttaacggtga acaaaagcta atctccgagg aagacttgaa cggtgaacaa 60

aaattaatct cagaagaaga cttgaacgga ctcgacggtg aacaaaagtt gatttctgaa 120

gaagatttga acggtgaaca aaagctaatc tccgaggaag acttgaacgg tagc 174

<210> 20

<211> 708

<212> DNA

<213> mcherry

<400> 20

atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60

gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120

cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180

ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240

cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300

gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360

ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420

atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480

gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540

gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600

aacatcaagt tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 660

cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaag 708

Claims (1)

1. A method for regulating a cell pathway by using a plant hormone GA and a small molecule substance PAC, which is characterized by comprising the following steps: the following primers were used:

GID1-F：GCGTGGTACCTCTAGAATGGCTGCGAGCGATGAAGT，

GID1-R：GAAGCGGCCGCCCGGGTTAACATTCCGCGTTTACAA；

GID1-F：GCGTGGTACCTCTAGAATGGCTGCGAGCGATGAAGT，

GID1-LRP6C-R：CCCGAGCCACCGCCGGAACCGCCACCTTAACATTCCGCGTTTACAA；

LRP6C-F：GGCGGTGGCTCGGGAGGTGGCTCAAGGATGTTGTGTCCACGTAT，

LRP6C-R：GAAGCGGCCGCCCGGGTCAGGAGGAGTCTGTACAGG；

GAI-F：GCGTGGTACCTCTAGAATGAAGAGAGATCATCATCA，

GAI-R：GAAGCGGCCGCCCGGGATTGGTGGAGAGTTTCCAAG；

GAI-F：GCGTGGTACCTCTAGAATGAAGAGAGATCATCATCA，

GAI-LRP6C-R：CCCGAGCCACCGCCGGAACCGCCACCATTGGTGGAGAGTTTCCAAG；

LRP6C-F：GGCGGTGGCTCGGGAGGTGGCTCAAGGATGTTGTGTCCACGTAT，

LRP6C-R：GAAGCGGCCGCCCGGGTCAGGAGGAGTCTGTACAGG；

the method comprises the following steps:

(1) designing and constructing a vector:

firstly, amplifying each gene fragment by using the primers and cDNA reverse transcribed by arabidopsis thaliana and HEK293T cells as templates and using PCR technology, then using corresponding primers and using two fragments as templates to perform overlap PCR, fusing the GAI and GA receptor GID1 of arabidopsis thaliana DELLA proteins and the C end of LRP6 which is a key protein in a Wnt signal path together, recovering PCR products GAI, GID1, GAI-LRP6C and GID1-LRP6C by using agarose gel, using endonuclease XbaI XmaI to double-enzyme-cut linearized pCI 4xmyc, pCI egfp and pCI mcerry vectors, connecting by using an Infussion method, transforming pcDH 5a, verifying colony by colony, picking, sequencing and correctly preserving bacteria; by using the above procedures, animal expression vectors pCI-neo egfp GAI, pCI-neo 4xMYC GID, pCI-neo mcerry GID-LRP6C, pCI-neo 4xMYC GID-LRP6C, and pCI-neo egfp GAI-LRP6C were constructed;

(2) culture and transfection of animal cells:

taking out frozen HEK293T cells from liquid nitrogen, rapidly recovering the cells in a water bath at 37 ℃, then putting the cells into a centrifuge, centrifuging for 5min at 800g, removing supernatant, adding 1ml of DMEM high-glucose cell culture solution to resuspend the cells, adding the cell suspension into a cell culture bottle containing preheated 10ml of DMEM culture medium, replacing the culture medium after 24h until the growth rate of the cells reaches 90%, resuspending the cells and transferring the cells into a 6-well plate, performing calcium phosphate cell transfection after 24h of transfer, and transfecting 2 micrograms of two plasmids of pCI-neo egfp GAI and pCI-neo 4xMYC GID or two plasmids of pCI-neo 4xMYC GID-6C and pCI-neo egfp GAI-LRP6C in each hole of a six-well plate;

(3) administration of GA and PAC

24h after transfection, GA was added to a final concentration of 10. mu.M, and the cells were incubated at 37 ℃ with 5% CO₂Incubating for 12h, adding inhibitor PAC with final concentration of 100nM, and incubating for 3 h; after incubation, cells were resuspended, lysed with cell lysate and detected with Western blot.

Images