CN108410850B - L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose - Google Patents

L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose Download PDF

Info

Publication number
CN108410850B
CN108410850B CN201810209650.5A CN201810209650A CN108410850B CN 108410850 B CN108410850 B CN 108410850B CN 201810209650 A CN201810209650 A CN 201810209650A CN 108410850 B CN108410850 B CN 108410850B
Authority
CN
China
Prior art keywords
mutant
rhad
site
rhamnose
phosphate aldolase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810209650.5A
Other languages
Chinese (zh)
Other versions
CN108410850A (en
Inventor
高晓冬
李子杰
汪马燕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN201810209650.5A priority Critical patent/CN108410850B/en
Publication of CN108410850A publication Critical patent/CN108410850A/en
Application granted granted Critical
Publication of CN108410850B publication Critical patent/CN108410850B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/02—Aldehyde-lyases (4.1.2)
    • C12Y401/02019—Rhamnulose-1-phosphate aldolase (4.1.2.19)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses L-rhamnogum-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose, wherein the gene sequence of the L-rhamnogum-1-phosphate aldolase is that the wild type L-rhamnogum-1-phosphate aldolase coded by SEQ ID NO.1 is subjected to saturation site-specific mutation at the amino acid positions 115, 116, 148, 188 or 152 respectively. According to the invention, through carrying out site-directed mutagenesis on the RhaD amino acid site, the defect that the D-sorbose synthesized by wild RhaD catalysis does not have stereoselectivity is overcome, the stereoselectivity when the D-glyceraldehyde is used as an aldehyde receptor to synthesize the D-sorbose is realized, the D-sorbose is mainly used as a catalytic reaction product, and the enzyme activity of the mutated RhaD is high. The D-sorbose prepared by the site-directed mutagenesis RhaD prepared by the method has the advantages of high synthesis efficiency, simple process, cost saving and highest D-sorbose stereoselective catalytic efficiency of 91.7%.

Description

L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose
Technical Field
The invention belongs to the technical field of biology, and particularly relates to L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose.
Background
Rare sugars are contained in a very small amount in nature and play important physiological functions in the fields of diet, health care, medicine, and the like. D-sorbose (D-sorbose) is a rare sugar and plays a very important role in reducing hyperglycemia, hypertension, hyperlipidemia and the like.
D-sorbose has very little content in nature and is difficult to synthesize by a chemical route, and the D-sorbose is mainly produced by an enzyme immobilization conversion method, namely cloning and expressing an enzyme and separating and refining a product at present. However, D-sorbose in the crude product tends to be mixed with other sugars, not only the yield is reduced, but also the physicochemical properties of D-sorbose and the mixed sugars thereof are almost the same, so that it is difficult to refine and purify the D-sorbose. In order to optimize the current D-sorbose synthesis system, the ratio of D-sorbose in the product must be increased. Previous studies have shown that L-rhamnose-1-phosphate aldolase (RhaD) belonging to the family of dihydroxyacetone phosphate (DHAP) -dependent aldolase loses stereoselectivity for an aldehyde receptor when D-glyceraldehyde is used as the aldehyde receptor, and two rare sugars, namely D-psicose and D-sorbose, are generated at a ratio close to 1: 1.
disclosure of Invention
This section is for the purpose of summarizing some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. In this section, as well as in the abstract and the title of the invention of this application, simplifications or omissions may be made to avoid obscuring the purpose of the section, the abstract and the title, and such simplifications or omissions are not intended to limit the scope of the invention.
The present invention has been made in view of the above-mentioned technical drawbacks.
Therefore, the invention overcomes the defects in the prior art and provides site-directed mutant L-rhamnose-1-phosphate aldolase.
In order to solve the technical problems, the invention provides the following technical scheme: site-directed mutagenesis of L-rhamnose-1-phosphate aldolase, wherein: the site-directed mutant L-rhamnose-1-phosphate aldolase is a mutant produced by the site-directed mutation of the wild type L-rhamnose-1-phosphate aldolase with the gene sequence of SEQ ID NO.1 through the saturation of amino acid sites 115, 116, 148, 188 or 152.
As a preferred embodiment of the site-directed mutagenesis L-rhamnose-1-phosphate aldolase of the present invention, wherein: the mutant produced by the site-directed mutation of the amino acid position 115, 116, 148, 188 or 152 comprises mutant Y152W, mutant Y152Q, mutant Y152N, mutant P188Y, mutant T115A, mutant S116A and mutant I148A of the L-rhamnose gum-1-phosphate aldolase.
As a preferred embodiment of the site-directed mutagenesis L-rhamnose-1-phosphate aldolase of the present invention, wherein: the wild type L-rhamnose-1-phosphate aldolase coded by the SEQ ID NO.1 is derived from an Escherichia coli MG1655 strain.
As another aspect of the present invention, the present invention overcomes the deficiencies of the prior art and provides DNA molecules.
In order to solve the technical problems, the invention provides the following technical scheme: a DNA molecule encoding the site-directed mutant L-rhamnose-1-phosphate aldolase of claim 2.
As another aspect of the present invention, the present invention overcomes the disadvantages of the prior art and provides a plasmid vector.
In order to solve the technical problems, the invention provides the following technical scheme: a plasmid vector, wherein: the plasmid vector is loaded with the DNA molecule of claim 4.
As a preferred embodiment of the plasmid vector of the present invention, wherein: the plasmid vector is pET-28a vector loaded with the DNA molecule of claim 4.
As another aspect of the invention, the invention overcomes the defects in the prior art and provides the application of the site-directed mutant L-rhamnose gum sugar-1-phosphate aldolase in the catalytic synthesis of rare sugar D-sorbose.
As another aspect of the invention, the invention overcomes the defects in the prior art and provides a preparation method of site-directed mutagenesis L-rhamnose-1-phosphate aldolase.
In order to solve the technical problems, the invention provides the following technical scheme: a method for preparing site-directed mutagenesis L-rhamnose-1-phosphate aldolase comprises the following steps,
constructing mutant strain recombinant plasmid: connecting a wild type L-rhamnose-1-phosphate aldolase gene fragment to a plasmid vector to obtain a wild type L-rhamnose-1-phosphate aldolase gene recombinant plasmid, and performing amino acid saturation site-specific mutagenesis on coded amino acids of the L-rhamnose-1-phosphate aldolase gene by taking the wild type L-rhamnose-1-phosphate aldolase gene recombinant plasmid as a template to respectively obtain mutant strain recombinant plasmids;
mutant strain expression: transforming the mutant strain recombinant plasmid into escherichia coli, selecting a single colony for inoculation, and carrying out IPTG 16 ℃ induced expression of site-directed mutant L-rhamnose-1-phosphate aldolase.
As a preferred embodiment of the preparation method of the site-directed mutant L-rhamnose-1-phosphate aldolase, the method further comprises the following steps: purifying the L-rhamnose gum sugar-1-phosphate aldolase which is expressed by the mutant strain and subjected to site-directed mutagenesis.
As a preferred embodiment of the method for preparing the site-directed mutant L-rhamnose-1-phosphate aldolase of the present invention, the method comprises: the plasmid vector is a pET-28a vector, the mutant recombinant plasmid comprises pET28a-rhaDT115A, pET28a-rhaDS116A, pET28a-rhaDI148A, pET28a-rhaDP188Y, pET28a-rhaDY152W, pET28a-rhaDY152Q and pET28a-rhaDY152N, and the mutant recombinant plasmid is transformed into escherichia coli to transform an escherichia coli BL21 strain.
The invention has the beneficial effects that: the invention overcomes the defects that the wild RhaD generates D-psicose by site-directed mutagenesis on the amino acid locus of RhaD, wherein D-sorbose is 1:1, namely the defect of stereoselectivity is avoided, the stereoselectivity of the RhaD in the process of catalyzing D-glyceraldehyde to be an aldehyde receptor to synthesize D-sorbose is realized, the catalytic reaction product mainly comprises D-sorbose, and the mutated RhaD has high enzyme activity. The D-sorbose prepared by the site-directed mutagenesis RhaD prepared by the method has the advantages of high synthesis efficiency, simple process and cost saving, and the stereoselective catalytic efficiency of the D-sorbose can reach 91.7% to the maximum (namely the product D-sorbose: D-psicose is 11: 1).
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a schematic diagram of HPLC (high performance liquid chromatography) pattern analysis of site-directed mutant L-rhamnose gum-1-phosphate aldolase mutants T115A, S116A, I148A, P188Y, Y152N, Y152Q, Y152W and wild-type L-rhamnose gum-1-phosphate aldolase catalyzed D-sorbose synthesis.
FIG. 2 is a schematic diagram of HPLC chromatogram analysis of the site-directed mutant L-rhamnose gum-1-phosphate aldolase mutants F211C, F170A, F263A and N29A-Y152A in the catalytic synthesis of D-sorbose.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
For convenience in describing the invention, conventional and non-conventional abbreviations for the various amino acid residues are used. These abbreviations are familiar to those skilled in the art, but are listed below for clarity:
asp ═ D ═ aspartic acid; ala ═ a ═ alanine; arg ═ R ═ arginine;
asn ═ N ═ asparagine; gly ═ G ═ glycine; glu ═ E ═ glutamic acid;
gln ═ Q ═ glutamine; his ═ H ═ histidine; ile ═ I ═ isoleucine;
leu ═ L ═ leucine; lys ═ K ═ lysine; met ═ M ═ methionine;
phe ═ F ═ phenylalanine; pro ═ P ═ proline; ser ═ S ═ serine;
thr ═ T ═ threonine; trp ═ W ═ tryptophan; tyr ═ Y ═ tyrosine;
val ═ V ═ valine; cys ═ C ═ cysteine.
The mutants described herein are named according to the nomenclature customary to those skilled in the art, for example: mutant Y152N shows that tyrosine (Y) at position 152 of amino acid of L-rhamnose gum-1-phosphate aldolase (RhaD) is mutated into asparagine (N) through saturation and fixed point mutation.
In the present invention, Escherichia coli MG 1655-derived L-Rhamnulose-1-phosphate Aldolase (RhaD) was encoded by 825 genes (EMBL accession No. AAC 76884.1; NCBI accession No. AIZ93318.1), the gene sequence was optimized, and the RhaD-encoding gene was inserted into expression vector pET-28a to obtain recombinant expression plasmid pET-28 a-rhaD. The plasmid pET-28a-rhaD is used as a template, saturation site-directed mutagenesis is carried out on the active region site of L-rhamnose-1-phosphate aldolase RhaD respectively, and combined site mutagenesis of more than two RhaD active region sites is carried out, and the wild RhaD recombinant expression plasmid pET-28a-rhaD is used as a blank control in the research. The Escherichia coli MG1655 is a deposited strain in the laboratory (key laboratory of department of biochemistry and biotechnology education of biological engineering college of south Jiang university).
The wild type, the monoclonal antibody subjected to saturation site-directed mutagenesis of the RhaD active region or the combined site-directed mutagenesis were individually selected, inoculated into LB liquid medium (50. mu.g/mL kanamycin), and cultured overnight. 2mL of the culture broth was aspirated and transferred to TB liquid medium (50. mu.g/mL kanamycin) for culture. When OD600 was 0.6 to 0.8, IPTG (final concentration: 0.2mM) was added, and after induction at 16 ℃ for 22 hours, the culture was stopped, and the cells were collected by centrifugation, and the supernatant was discarded. And (3) carrying out ultrasonic disruption on the thalli, centrifuging the disruption solution at a high speed, and purifying the obtained supernatant by using an Avant 25 protein purifier to obtain the target protein. First, Ni was equilibrated with equilibration buffer2+Carrying out balance (10CV) on the affinity chromatography column, then loading, and then using balance buffer solution to carry out Ni2+Equilibration (5CV) with an affinity column; eluting the desired egg with a wash bufferWhite and collected, and the eluate was concentrated and desalted with an ultrafiltration tube.
Example 1:
the RhaD coding gene is inserted into an expression vector pET-28a by BamHI and SacI double digestion to obtain a recombinant expression plasmid pET-28 a-rhaD. And (3) carrying out saturation site-directed mutagenesis on the active region site of the L-rhamnose gum-1-phosphate aldolase RhaD by taking the plasmid pET-28a-rhaD as a template. The gene sequence of the wild type L-rhamnose-1-phosphate aldolase is shown in SEQ ID NO. 1.
The primer sequences are respectively as follows:
wild-type rhaD amplification primers:
upstream primer rhaD-F GCGCGGATCCATGCAAAACATTACTCAG (underlined sequence is BamHI cleavage site);
downstream primer rhaD-RGCGCGAGCTCTTACAGCGCCAGCGCACTG (the underlined sequence is the SacI cleavage site).
And carrying out combined site mutation of more than two RhaD active region sites, wherein the wild RhaD recombinant expression plasmid pET-28a-rhaD is used as a blank control in the research. And respectively selecting the sites of the saturated site-directed mutagenesis: and (3) carrying out combined site mutation on the 115 th, 116 th, 148 th, 188 th, 152 th, 170 th, 211 th or 263 th amino acid sites of RhaD, namely combining the single mutation sites two by two respectively, and selecting 152&188 amino acid combined site mutation, 152&263 amino acid combined site mutation and 29&152 amino acid combined site mutation.
Respectively picking out the recombinant plasmid containing pET28a-rhaDT115A、pET28a-rhaDS116A、pET28a-rhaDI148A、pET28a-rhaDP188Y、pET28a-rhaDY152W、pET28a-rhaDY152Q、pET28a-rhaDY152N、pET28a-rhaDT170A、pET28a-rhaDF211C、pET28a-rhaDF263AOr pET28a-rhaDN29A-Y152AThe single clone (2) was inoculated into 5mL of LB liquid medium (50. mu.g/mL kanamycin), cultured at 37 ℃ and 220rpm overnight. 2mL of the culture was aspirated and transferred to 200mL of liquid medium (50. mu.g/mL kanamycin) at 37 ℃ and 220 rpm. When OD600 is 0.6-0.8, IPTG (final concentration 0.2mM) is added, after induction at 16 ℃ for 22h, the culture is stopped, and centrifugation is carried outThe cells were collected (8000g, 3min, 4 ℃ C.) and the supernatant was discarded. The thalli is subjected to ultrasonic disruption, the disruption solution is subjected to high-speed centrifugation (12000g, 30min, 4 ℃), and the obtained supernatant is purified by an Avant 25 protein purifier. Firstly, the Ni2+ affinity chromatography column is balanced by using an equilibrium buffer solution 50mM Tris-HCl (pH7.5) (10CV) and then is loaded, and after the loading is finished, the Ni2+ affinity chromatography column is balanced by using the equilibrium buffer solution 50mM Tris-HCl (pH7.5) (5 CV); the lower adsorption capacity of the column was washed off with a washing buffer (50mM Tris-HCl (pH7.5),25mM NaCl, 60mM imidazole), and the target protein was finally eluted with an elution buffer (50mM Tris-HCl (pH7.5),25mM NaCl,500mM imidazole) and collected, and the eluate was concentrated and desalted with an ultrafiltration tube.
The primer sequences involved in carrying out site-directed mutagenesis on the RhaD recombinant expression plasmid are as follows:
mutant T115A upstream primer: 5' -cgaagccgtccccgcttccgaacttcc-3' (the underlined sequence is the mutation site),
mutant T115A downstream primer: 3' -gcttcggcaggggcgaaggcttgaagg-5' (underlined sequence is the mutation site).
Mutant S116A upstream primer: 5' -gaagccgtccccactgccgaacttccg-3' (the underlined sequence is the mutation site),
mutant S116A downstream primer: 3' -cttcggcaggggtgacggcttgaaggc-5' (underlined sequence is the mutation site).
Mutant I148A upstream primer: 5' -cacgccaccaacctggccgccctcacctatgt-3' (the underlined sequence is the mutation site),
mutant I148A downstream primer: 3' -gtgcggtggttggaccggcgggagtggataca-5' (underlined sequence is the mutation site).
Mutant P188Y upstream primer: 5' -attttgccgtggatggtgtatggcacggacgaaatcggc-3' (the underlined sequence is the mutation site),
mutant P188Y downstream primer: 3' -taaaacggcacctaccacataccgtgcctgctttagccg-5' (underlined sequence is the mutation site).
Mutant Y152W upstream primer: 5' -acctgatcgccctcacctgggtacttgaaaacgacacc-3' (the underlined sequence is the mutation site)，
Mutant Y152W downstream primer: 3' -tggactagcgggagtggacccatgaacttttgctgtgg-5' (underlined sequence is the mutation site).
Mutant Y152Q upstream primer: 5' -aacctgatcgccctcacccaggtacttgaaaacgacacc-3' (the underlined sequence is the mutation site),
mutant Y152Q downstream primer: 3' -ttggactagcgggagtgggtccatgaacttttgctgtgg-5' (underlined sequence is the mutation site).
Mutant Y152N upstream primer: 5' -cctgatcgccctcaccaatgtacttgaaaacgac-3' (the underlined sequence is the mutation site),
mutant Y152N downstream primer: 3' -ggactagcgggagtggttacatgaacttttgctg-5' (underlined sequence is the mutation site).
Example 2:
and (3) detecting the enzyme activity of the wild type RhaD aldolase and the mutant:
to determine enzyme activity, a total volume of 50 μ L of the reaction system was as follows: DHAP (0.2M, 5. mu.L, 0.02M); d-glyceraldehyde (0.5M, 2. mu.L, 0.02M), aldolase RhaD wild type or mutant (10mg/mL, 2.5. mu.L, 0.5mg/mL) was supplemented with 50mM Tris-HCl (pH8.0) to a volume of 50. mu.L. The reaction was allowed to stand at 30 ℃ overnight, and after adjusting the pH to 5 with 3M HCl, 0.25. mu.L of acid phosphatase AP was added and allowed to stand at 30 ℃ overnight. At the end of the reaction, pH was adjusted to 7 using 3M NaOH to terminate the reaction, and then the supernatant was collected by centrifugation at 15000g for 10 min. HPLC detection is shown in FIG. 1 and FIG. 2.
The chromatographic conditions of the invention are as follows: hitachi differential detector (HITACHI RI), chromatographic column Bio-Rad Aminex HPX-87H, mobile phase 5mmol/L dilute sulfuric acid water solution, flow rate of 0.5mL/min, sample size of 20. mu.L. The standard curves for D-psicose and D-sorbose were plotted using the same conditions.
As can be seen from FIG. 1, standards for both sugars were determined under the same HPLC detection system (i.e., the complete standard curve has the concentration of sugar as the abscissa and the peak area as the ordinate). HPLC (high performance liquid chromatography) map result analysis shows that wild RhaD-WT catalyzes D-glyceraldehyde, the rare sugars D-psicose (the peak time is about 12.5) and D-sorbose (the peak time is about 11.23) which are finally generated after the reaction is terminated are D-psicose, and the ratio of the two produced rare monosaccharides is kept to be 1: about 1. Meanwhile, researches find that the results of HPLC (high performance liquid chromatography) maps show that RhaD mutants Y152W, Y152Q and Y152N show that the D-sorbose yield is obviously higher than that of D-psicose, namely the RhaD mutated at the three sites shows excellent stereoselectivity for catalytic synthesis of D-sorbose, the D-psicose yield is very low, and the enzyme activity of the mutated RhaD is high; the RhaD mutants P188Y, T115A, S116A and I148A also show better stereoselectivity for catalyzing the generation of D-sorbose by RhaD. Among them, mutant Y152W catalyzed the highest yield of D-sorbose.
However, as can be seen from fig. 2, the RhaD mutants T170A and F211C have no enzymatic activity, i.e., the mutation of T170A or F211C causes the loss of the enzymatic activity of RhaD; the RhaD mutants F263A and F263A can produce a small amount of D-sorbose, but have low enzyme activity and unstable protein. The fact that the mutation of the T170A, F211C or F263A site can not realize the stereoselectivity of the RhaD catalytic synthesis of D-sorbose is demonstrated.
The inventors also investigated the effect of the combined mutation at two positions on the stereoselectivity of RhaD-catalyzed D-sorbose production, and as can be seen from FIG. 2, the combined position mutation of N29A-Y152A produced D-sorbose while the corresponding D-psicose was produced, so that the combined position mutation of N29A-Y152A was less stereoselective than the single position mutation in RhaD-catalyzed D-sorbose production.
Example 3:
stereoselective analysis of RhaD aldolase:
this study found that Escherichia coli MG 1655-derived dihydroxyacetone phosphate (DHAP) -dependent aldolase family of L-rhamnose-1-phosphate aldolase (RhaD) catalyzed reaction substrates were two: the first is dihydroxyacetone phosphate (DHAP) and the second is an aldehyde. When D-glyceraldehyde is used as an aldehyde receptor, the stereoselectivity of the aldehyde receptor is lost, and two rare sugars, namely D-psicose and D-sorbose, are generated, wherein the ratio of the two rare sugars is close to 1: 1. and when the site-directed mutants Y152W, Y152Q, Y152N, P188Y, T115A, S116A and I148A of MG1655 RhaD use DHAP and D-glyceraldehyde as substrates, D-sorbose is mainly generated, and the specific experimental results are shown in Table 1.
In the research, site-specific saturation mutation is carried out on a plurality of possible amino acid residue positions of RhaD, including amino acid positions 115, 116, 148, 188, 152, 170, 211 or 263, and HPLC enzyme activity analysis of mutants Y152W, Y152Q, Y152N, P188Y, T115A, S116A and I148A obtained by screening shows that D-sorbose tends to be synthesized. As can be seen from Table 1, the amino acids 115, 116, 148, 188 and 152 of the amino acids encoded by the L-rhamnose gum-1-phosphate aldolase (RhaD) gene were subjected to saturation site-directed mutagenesis to obtain the mutant recombinant plasmid pET28a-rhaDT115A、pET28a-rhaDS116A、pET28a-rhaDI148A、pET28a-rhaDP188Y、pET28a-rhaDY152W、pET28a-rhaDY152Q、pET28a-rhaDY152NThe protein encoding translation reacts with the catalytic substrate aldehyde to synthesize D-sorbose: the ratio of D-psicose compared to wild type (1: 1) was 4.3:1, 5.5:1, 4.5:1, 4.75:1, 10.8:1, 8:1, 10:1, respectively. The catalytic efficiency of the same mutation site is greatly different by mutating the site to different amino acids, for example, the mutant Y152W catalyzes synthesized D-sorbose: d-psicose 11:1, while the same site mutant Y152Q catalyzes the synthesis of D-sorbose: d-psicose-8: 1; yet another study by the inventors shows that mutant Y152A is mainly used for synthesizing D-psicose, and mutant Y152A catalyzes synthesized D-sorbose: d-psicose 1: 8.
TABLE 1 ratio of D-sorbose to D-psicose production by RhaD at different mutation sites
Type (B) D-sorbose: d-psicose
WT 1：1
RhaDY152W 11：1
RhaDY152Q 8：1
RhaDY152N 10：1
RhaDP188Y 4.75：1
RhaDT115A 4.3：1
RhaDS116A 5.5：1
RhaDI148A 4.5：1
The invention overcomes the defects that the wild RhaD generates D-psicose by site-directed mutagenesis on the amino acid locus of RhaD, wherein D-sorbose is 1:1, namely the defect of stereoselectivity is avoided, the stereoselectivity of the RhaD in the process of catalyzing D-glyceraldehyde to be an aldehyde receptor to synthesize D-sorbose is realized, the catalytic reaction product mainly comprises D-sorbose, and the mutated RhaD has high enzyme activity. The D-sorbose prepared by the site-directed mutagenesis RhaD prepared by the method has the advantages of high synthesis efficiency, simple process and cost saving, and the stereoselective catalytic efficiency of the D-sorbose can reach 91.7% to the maximum (namely the product D-sorbose: D-psicose is 11: 1).
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> university of south of the Yangtze river
<120> L-rhamnogum-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 825
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgcaaaaca ttactcagtc ctggtttgtc cagggaatga tcaaagccac caccgacgcc 60
tggctgaaag gctgggatga gcgcaacggc ggcaacctga cgctacgcct ggatgacgcc 120
gatatcgcac catatcacga caatttccac caacaaccgc gctatatccc gctcagccag 180
cccatgcctt tactggcaaa tacaccgttt attgtcaccg gctcgggcaa attcttccgt 240
aacgtccagc ttgatcctgc ggctaactta ggcatcgtaa aagtcgacag cgacggcgcg 300
ggctaccaca ttctttgggg gttaaccaac gaagccgtcc ccacttccga acttccggct 360
cacttccttt cccactgcga gcgcattaaa gccaccaacg gcaaagatcg ggtgatcatg 420
cactgccacg ccaccaacct gatcgccctc acctatgtac ttgaaaacga caccgcggtc 480
ttcactcgcc aactgtggga aggcagcacc gagtgtctgg tggtattccc ggatggcgtt 540
ggcattttgc cgtggatggt gcccggcacg gacgaaatcg gccaggcgac cgcacaagag 600
atgcaaaaac attcgctggt gttgtggccc ttccacggcg tcttcggcag cggaccgacg 660
ctggatgaaa ccttcggttt aatcgacacc gcagaaaaat cagcacaagt attagtgaag 720
gtttattcga tgggcggcat gaaacagacc atcagccgtg aagagttgat agcgctcggc 780
aagcgtttcg gcgttacgcc actcgccagt gcgctggcgc tgtaa 825

Claims (9)

1. Site-directed mutagenesis of L-rhamnose-1-phosphate aldolase, characterized in that: the site-directed mutant L-rhamnose gum-1-phosphate aldolase is a mutant generated by performing site-directed mutation on wild type L-rhamnose gum-1-phosphate aldolase coded by a gene sequence SEQ ID NO.1 through saturation of amino acid positions 115, 116, 148, 188 or 152 respectively, wherein the mutant is mutant Y152W, mutant Y152Q, mutant Y152N, mutant P188Y, mutant T115A, mutant S116A and mutant I148A of the L-rhamnose gum-1-phosphate aldolase.
2. The site-directed mutant L-rhamnose-1-phosphate aldolase of claim 1, characterized in that: the wild type L-rhamnose-1-phosphate aldolase coded by the SEQ ID NO.1 is derived from an Escherichia coli MG1655 strain.
A DNA molecule characterized by: the DNA molecule encodes the site-directed mutant L-rhamnose-1-phosphate aldolase of claim 1.
4. A plasmid vector characterized by: the plasmid vector is loaded with the DNA molecule of claim 3.
5. The plasmid vector of claim 4, wherein: the plasmid vector is pET-28a vector loaded with the DNA molecule of claim 3.
6. The use of the site-directed mutant L-rhamnose-1-phosphate aldolase of claim 1 or 2 for the catalytic synthesis of the rare sugar D-sorbose.
7. The method for preparing site-directed mutant L-rhamnose-1-phosphate aldolase according to claim 1 or 2, wherein: comprises the steps of (a) preparing a mixture of a plurality of raw materials,
constructing mutant strain recombinant plasmid: connecting a wild type L-rhamnose-1-phosphate aldolase gene fragment to a plasmid vector to obtain a wild type L-rhamnose-1-phosphate aldolase gene recombinant plasmid, and performing amino acid saturation site-specific mutagenesis on coded amino acids of the L-rhamnose-1-phosphate aldolase gene by taking the wild type L-rhamnose-1-phosphate aldolase gene recombinant plasmid as a template to respectively obtain mutant strain recombinant plasmids;
mutant strain expression: transforming the mutant strain recombinant plasmid into escherichia coli, selecting a single colony for inoculation, and carrying out IPTG 16 ℃ induced expression of site-directed mutant L-rhamnose-1-phosphate aldolase.
8. The method of claim 7, wherein: also comprises the following steps of (1) preparing,
protein purification: purifying the L-rhamnose gum sugar-1-phosphate aldolase which is expressed by the mutant strain and subjected to site-directed mutagenesis.
9. The method of claim 7 or 8, wherein: the plasmid vector is pET-28a vector, and the mutant strain recombinant plasmid comprises pET28a-rhaDT115A、pET28a-rhaDS116A、pET28a-rhaDI148A、pET28a-rhaDP188Y、pET28a-rhaDY152W、pET28a-rhaDY152Q、pET28a-rhaDY152NThe mutant strain recombinant plasmid is transformed into escherichia coli, and the transformed escherichia coli BL21 strain is obtained.
CN201810209650.5A 2018-03-14 2018-03-14 L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose Active CN108410850B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810209650.5A CN108410850B (en) 2018-03-14 2018-03-14 L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810209650.5A CN108410850B (en) 2018-03-14 2018-03-14 L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose

Publications (2)

Publication Number Publication Date
CN108410850A CN108410850A (en) 2018-08-17
CN108410850B true CN108410850B (en) 2021-05-18

Family

ID=63131420

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810209650.5A Active CN108410850B (en) 2018-03-14 2018-03-14 L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose

Country Status (1)

Country Link
CN (1) CN108410850B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111088301B (en) * 2020-01-07 2022-05-03 江南大学 Preparation method of L-type rare hexulose

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105219756A (en) * 2015-07-17 2016-01-06 江南大学 A kind of L-rhamnulose-1-phosphate aldolase is catalyzing and synthesizing the application in rare sugar

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105219756A (en) * 2015-07-17 2016-01-06 江南大学 A kind of L-rhamnulose-1-phosphate aldolase is catalyzing and synthesizing the application in rare sugar

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Markus Kroemer等.Structure and catalytic mechanism of L-rhamnulose-1-phosphate aldolase.《Biochemistry》.2003,第42卷(第36期), *
Zijie Li等.Enzymatic synthesis of D-sorbose and D-psicose with aldolase RhaD: effect of acceptor configuration on enzyme stereoselectivity.《Bioorg Med Chem Lett》.2011,第21卷(第23期), *
高雅慧等.基于RhaD醛缩酶的"一锅四酶法"合成D-山梨糖和D-阿洛酮糖.《食品工业科技》.2013,(第21期), *

Also Published As

Publication number Publication date
CN108410850A (en) 2018-08-17

Similar Documents

Publication Publication Date Title
CN108018278B (en) D-psicose 3-epimerase mutant with improved catalytic efficiency
CN108546690B (en) Short-chain dehydrogenase and mutant thereof, and preparation and application of gene
KR101455624B1 (en) Novel D-psicose-3-epimerase from Clostridium bolteae having production of functional rare sugar D-psicose and production method of D-psicose using thereof
CN108823179A (en) A kind of transaminase from actinomyces, mutant, recombinant bacterium and application
CN109504645B (en) Isoleucine dioxygenase, mutant and application in synthesis of 4-hydroxyisoleucine
CN110551701A (en) carbonyl reductase mutant and application thereof in reduction of cyclopentadione compounds
CN108410850B (en) L-rhamnose gum sugar-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-sorbose
CN108048494B (en) Method for synthesizing 1, 3-propylene glycol by using biological enzyme
JP2023506154A (en) Allulose epimerization enzyme mutant, method for producing the same, and method for producing allulose using the same
CN108251406B (en) L-rhamnose-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-psicose
CN111454918B (en) Enol reductase mutant and application thereof in preparation of (R) -citronellal
CN110423787B (en) Preparation method of uniform brown algae trisaccharide
CN112746061A (en) Meso-diaminopimelate dehydrogenase mutants and uses thereof
CN110592035B (en) Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol
CN114703158B (en) Sucrose phosphorylase mutant, coding gene and application thereof
CN112831532B (en) Method for enzymatic synthesis of D-leucine
CN110904062A (en) Strain capable of producing L-alanine at high yield
CN114591940A (en) Fusion protein for catalyzing glucose to synthesize D-psicose and construction method thereof
CN113122525B (en) Formaldehyde conversion protein and application thereof
CN114657160A (en) Glycosyl transferase mutant and application thereof
CN110964705A (en) Novel application of (R) -omega-transaminase mutant
JP2517861B2 (en) Method for producing immobilized enzyme
CN115261366B (en) High-temperature-resistant cellobiose epimerase mutant, engineering bacterium and application thereof
CN108624571B (en) Enzyme with function of catalyzing DHAP or D-G3P to synthesize acrylic acid and application thereof
CN115011569B (en) Bose NemR-PS mutant and application thereof in preparation of (S) -citronellol

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant