CN108410785B

CN108410785B - Method for preparing bacterial ghost

Info

Publication number: CN108410785B
Application number: CN201810139232.3A
Authority: CN
Inventors: 王春来; 刘思国; 于申业; 李刚
Original assignee: HARBIN WEIKE BIOTECHNOLOGY DEVELOPMENT CO LTD; Harbin Veterinary Research Institute of CAAS
Current assignee: Harbin Weike Biotechnology Co., Ltd; Harbin Veterinary Research Institute of CAAS
Priority date: 2018-02-09
Filing date: 2018-02-09
Publication date: 2021-11-02
Anticipated expiration: 2038-02-09
Also published as: CN108410785A

Abstract

The invention relates to a method for preparing bacterial ghost and a genetic engineering subunit vaccine, which comprises the steps of cloning an INP signal sequence, an exogenous gene and a lysis box gene E-lysine to the same expression vector to transform bacteria, wherein the INP signal sequence is SEQ ID NO:1, and the sequence of the lysis cassette gene E-lysine is SEQ ID NO:2 and the application of the recombinant bacterial ghost expressing the foreign gene in the preparation of vaccines.

Description

Method for preparing bacterial ghost

Technical Field

The invention relates to a bacterial surface display technology, namely, a signal sequence INP is used as a guide sequence of foreign antigen protein, and the foreign antigen protein is positioned on the surface of bacteria; the invention also relates to a bacterial ghost preparation technology, which combines the bacterial surface display technology and the bacterial ghost preparation technology together to establish a bacterial ghost surface display technology platform. Belongs to the field of genetic engineering vaccines.

Background

Bacterial ghost (Bacterial ghost) is an empty Bacterial body without cytoplasm and nucleic acids. The PhiX174 phage E perforation gene is expressed in bacteria, the gene coding protein can form perforation pore canals on the bacterial cell membrane and cell wall, the thalli are ruptured under the action of osmotic pressure, and the intracellular cytoplasm and nucleic acid components of the bacteria are discharged through the pore canals to form an empty bacterial shell, namely the bacterial ghost. The bacterial ghost is composed of an inner membrane (cytoplasmic membrane), a cytoplasmic space (periplasmic space) and an outer membrane (outer membrane), and thus the cell wall is largely intact. There is also a layer of S-layer on the outer membrane of some strains, which also becomes one of the components of the bacterial ghost. The bacterial ghost itself can be a good vaccine because it retains the bacterial cell membrane structure and associated antigenic proteins as live bacteria, while the outer membrane contains the highly conserved PAMPs (pathogenic-associated molecular patterns) that are recognized by natural immune cells via pattern recognition receptors, such as lipopolysaccharides, peptidoglycans, CPG, OmpA, pili, etc., and can be efficiently phagocytosed by DCs and macrophages. At present, the bacterial ghost achieves good immune protection effect in animal models such as mice, rabbits, pigs and the like through the routes of intravenous, subcutaneous, gas and the like. Cholera bacterial ghost (VCG) subcutaneous injection of mice induced serum production of high levels of anti-cholera specific IgG antibodies. It was also shown that antibodies against VCG were sufficient to protect newborn mice from infection with vibrio cholerae.

In addition, bacterial ghosts can be used as an excellent delivery system by artificially modifying the outer membrane of bacteria prior to lysis of the bacteria to anchor other components such as foreign antigens, nucleic acids or drugs to the inside, outside, or to fill the periplasm of the cell. The recombinant bacterial ghost prepared in this way has a perfect and natural outer membrane structure of bacteria, and can stimulate humoral and cellular immune responses simultaneously. The surface adhesion structure of the pilus and the like enables the pilus and the like to be adhered to specific tissues such as the mucous membrane surfaces of gastrointestinal tracts and respiratory tracts in a targeted manner, and then the pilus and the like are easy to be recognized and captured by phagocytes of organisms such as M cells of PP (peer's Patches), so that the vaccine antigen can be effectively delivered to the mucous membrane surfaces and relevant mucous membrane immune response can be induced. Eko et al, the clinical experiment is being carried out, wherein Chlamydia trachomatis (C. trachomatis) antigen is expressed in the inner membrane of cholera bacteria, and then the Th1 type immune response of genital tract mucosa is effectively stimulated by the recombinant bacterial ghost (VCG) prepared by splitting. Compared with the traditional prokaryotic system expression protein, the recombinant bacterial ghost has several advantages: (1) the recombinant protein is integrated in a highly immunogenic environment; (2) the size of the protein is required in a wide range, but the molecular weight of the protein is preferably between 2000 and 200,000 Da; (3) the recombinant protein is directly expressed and integrated on a bacterial membrane, and can be directly used for immunizing animals after being cracked without separating and purifying the recombinant protein as in the prior preparation of immunogen; (4) the recombinant protein integrated in the cell wall has a native conformation, so that it retains its native active form. However, the protein of general gene recombination is mostly expressed in the form of inclusion body by prokaryotic system, and the activity of the protein can be recovered to a certain extent only by denaturation and renaturation methods. (5) The preparation of the bacterial ghost is relatively simple and can be obtained by a fermentation technology without carrying out complicated purification work; can be stored at room temperature in lyophilized form.

Disclosure of Invention

The invention aims to establish a brand-new surface display technology platform based on bacterial ghost, opens up a new field for the development of genetic engineering vaccines and provides a powerful tool.

The above purpose of the invention is realized by the following technical scheme:

a signal sequence INP whose nucleotide sequence is SEQ ID NO:1 is shown in the specification; a lysis cassette gene E-lysine having the nucleotide sequence of SEQ ID NO:2, respectively.

In one aspect of the present invention, there is provided a method for preparing bacterial ghost, comprising cloning INP signal sequence and lysis cassette gene E-lysine into the same expression vector, transforming bacteria, wherein the signal sequence of INP is SEQ ID NO:1, and the sequence of the lysis cassette gene E-lysine is SEQ ID NO:2, or a sequence represented by 2.

In one embodiment, the method further comprises cloning a foreign antigen gene immediately downstream of the INP signal sequence.

In one embodiment, the method further comprises inducing expression of the lytic cassette gene E-lysis by raising the culture temperature from 37 ℃ to above 42 ℃ after inducing expression of the foreign antigen gene.

In one embodiment, the foreign antigen gene is selected from foreign antigen genes derived from bacteria, viruses or fungi, preferably the Cap protein gene of porcine circovirus PCV2, more preferably the Cap protein gene sequence is SEQ ID NO:3, and (b) is the sequence shown in the specification.

In one embodiment, the expression vector is a prokaryotic expression vector, preferably pET-28 a.

In one embodiment, the bacterium is escherichia coli.

In another aspect of the present invention, there is provided an expression vector comprising an INP signal sequence, a foreign antigen gene and a cleavage cassette gene E-lysine, wherein the INP signal sequence is SEQ ID NO:1, and the sequence of the lysis cassette gene E-lysine is SEQ ID NO:2, and the foreign antigen gene is immediately downstream of the INP signal sequence.

In another aspect of the present invention, there is provided a bacterial ghost comprising the above-described expression vector.

In one embodiment, the bacterium is escherichia coli.

In another aspect of the invention, there is provided the use of said bacterial ghost in the manufacture of a vaccine.

Specifically, a foreign protein gene (in one embodiment, a Cap protein gene of a circovirus) is cloned downstream of an INP signal sequence on a prokaryotic expression vector (in one embodiment, pET-28a), and then a lytic cassette gene E-lysine is co-cloned on the same expression vector to construct a recombinant plasmid (in one embodiment, pET-28a-Cap-E) presenting and expressing the Cap protein. Transforming the recombinant plasmid into Escherichia coli (such as BL-21(DE3)) to construct recombinant bacteria, and culturing the recombinant bacteria containing the recombinant plasmid to OD₆₀₀When the concentration is 0.4, adding inducer IPTG (1mM) induces the expression of INP-Cap fusion protein, and the INP signal sequence can guide Cap protein to be positioned on the outer membrane of Escherichia coli. After the expression of the Cap protein is induced for 1 hour, the culture temperature is increased from 37 ℃ to 42 ℃, the expression of the lysis cassette gene E-lysis is induced for 3.5 to 4 hours, and the bacterial ghost of the escherichia coli is prepared. Thereafter, the bacterial ghosts were harvested by centrifugation, washed with PBS and resuspended. Thus, the recombinant Cap protein was anchored to the outer membrane of the obtained E.coli ghost.

The invention takes the recombinant Escherichia coli bacterial ghost presenting and expressing Cap protein as a subunit vaccine of porcine circovirus genetic engineering to immunize pigs. The safety test result shows that the porcine circovirus genetic engineering subunit vaccine prepared by the invention has good safety, and the inoculated pig has no adverse reaction.

The immunoprotection test result shows that after the porcine circovirus genetic engineering subunit vaccine is inoculated, the immunized pigs can be remarkably stimulated to generate high-titer antibodies, each immunized pig can be effectively protected against the attack of porcine circovirus type 2 virulent strains, and the antibody titer, viremia, lymph node virus load and daily gain are far better than those of a control group. The porcine circovirus genetic engineering subunit vaccine has good immune protection effect.

Drawings

FIG. 1 shows SDS-PAGE detection (A) and Western blot identification (B) of Cap proteins.

FIG. 2 shows indirect immunofluorescence detection of Cap protein expression in recombinant E.coli ghosts.

FIG. 3 shows the expression of Cap protein and the localization of recombinant Escherichia coli by immunoelectron microscopy.

FIG. 4 shows the results of the serum antibody level measurements.

FIG. 5 is a diagram showing the results of viremia test.

Figure 6 inguinal lymph node viral load results.

FIG. 7 relative daily gain results.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Test materials

Bacterial strains, plasmids and reagents

Coli DH 5. alpha. and BL21(DE3) competent cells were purchased from Kyoto Kogyo gold Biotechnology Ltd, and pMD19T-vector (simple) from TaKaRa. pET-28a was purchased from Novagen. Restriction enzymes were purchased from Thermo scientific; ex Taq DNA polymerase, DNAker from TaKaRa; the DNA recovery kit and the plasmid extraction kit are purchased from OMEGA company; HRP-labeled goat anti-mouse IgG (IgG-HRP) was purchased from OMEGA: LB liquid medium and solid medium were purchased from a biological organism.

EXAMPLE 1 construction of pET-28a-INP recombinant plasmid

First, according to SEQ ID NO:1, then, taking the synthesized INP sequence as a template, carrying out PCR amplification on the INP gene, introducing NdeI and XhoI enzyme cutting sites at the 5' end respectively, wherein the primer sequence of the INP gene is as follows: INP-F: 5' GCGCATATGGCACTGGAT-3’ (SEQ ID NO：4)，INP-R：5’GCTCTCGAGGGTCTGCAGATT-3' (SEQ ID NO: 5), the introduced cleavage sites are underlined. And (3) PCR reaction conditions: 5min at 95 ℃, 30s at 94 ℃, 30s at 55 ℃, 30s at 72 ℃ and 30 cycles at 72 ℃ for 7 min.

Then, pET-28a was double-digested with NdeI and XhoI, the INP PCR product was double-digested as such, mixed with the digested pET-28a, and then subjected to T4 ligase in a water bath at 16 ℃ for 30min to transform E.coli DH5 α competent cells, which were then spread on a Carna-resistant LB plate. The next day, single clone on the plate was picked for PCR and enzyme digestion identification, and the correct clone was identified and named pET-28a-INP vector plasmid.

EXAMPLE 2 construction of pMD-28a-INP recombinant plasmid

The region containing the promoter region and the INP sequence on the recombinant plasmid pET-28a-INP is expressed by using a primer pET-28 a-INP-F: 5'-ATACCGCGGATCCGGATATAGTTCC-3' (SEQ ID NO: 6) and pET-28 a-inp-R: 5'-AATGAGCTCTCACTGCCCGCTTT-3' (SEQ ID NO: 7) were subjected to PCR amplification. The PCR reaction conditions are as follows: 5min at 95 ℃, 30s at 94 ℃, 30s at 52 ℃ and 40s at 72 ℃ for 30 cycles, and 10min at 72 ℃. The PCR product was then cloned into a pMD-19T (simple) plasmid vector, transformed into E.coli DH 5. alpha. competent cells, and plated onto ampicillin-resistant LB plates. The next day, single clone on the plate was picked for PCR and enzyme digestion identification, and the correct clone was identified and named pMD-28a-INP recombinant plasmid.

EXAMPLE 3 construction of pMD-28a-INP-cap recombinant plasmid

According to SEQ ID NO:3, and taking the sequence as a template and utilizing a primer cap-F: 5'-ACACATATGACGTATCCAAGGAGGC-3' (SEQ ID NO: 8) and cap-R: 5'-ACTCTCGAGTTAGGGTTTAAGTGGG-3' (SEQ ID NO: 9) was used for PCR amplification of the cap gene. The PCR reaction conditions are as follows: 5min at 95 ℃, 30s at 94 ℃, 30s at 52 ℃ and 10s at 72 ℃ for 30 cycles, and 10min at 72 ℃. Then pMD-28a-INP and cap gene PCR products were double digested with Nde I and Xho I, the digested products were subjected to T4 ligase in a water bath at 16 ℃ for 30min to transform E.coli DH 5. alpha. competent cells, which were then plated on ampicillin-resistant LB plates. The next day, single clone on the plate was picked for PCR and enzyme digestion identification, and the correct clone was identified and named pMD-28a-INP-Cap vector plasmid.

EXAMPLE 4 construction of pMD-28a-INP-Cap-E recombinant plasmid

According to SEQ ID NO:2, then, taking the synthesized sequence as a template, carrying out PCR amplification on the lyses-E lysis cassette gene, respectively introducing SacII and BamHI enzyme cutting sites at the 5' end, wherein the primer sequence of the lyses-E lysis cassette gene is as follows: lysis-E-F: 5' -TCCATACCGCGGTCAGCCAAACGTCTCTTCAG-3’(SEQ ID NO：10)， lysis-E-R：5’CGCGGATCCTCACTCCTTCCGCACGTAAT-3' (SEQ ID NO: 11). And (3) PCR reaction conditions: 5min at 95 ℃, 30s at 94 ℃, 30s at 58 ℃ and 90s at 72 ℃ for 30 cycles, and 10min at 72 ℃. The lysis-E PCR product and pMD-28a-INP-Cap recombinant plasmid were digested simultaneously with SacII and BamHI, and then digested with T4 ligase in a water bath at 16 deg.CColi DH 5. alpha. competent cells were transformed after 30min and plated on ampicillin-resistant LB plates. The next day, single clone on the plate was picked for PCR and enzyme digestion identification, and the correct clone was identified and named pMD-28a-INP-Cap-E vector plasmid.

Example 5 prokaryotic expression and identification of Cap proteins

The pMD-28a-INP-Cap-E with correct sequencing is transferred into E.coli BL21(DE3) competence, and positive recombinant bacteria are screened and preserved for subsequent experiments. When the positive recombinant strain was grown to OD 0.3, expression was induced at 37 ℃ with 1mM IPTG, and when OD 0.7 or so, expression of E gene was induced at 42 ℃. After 4 hours of expression, the pellet was suspended in PBS and directly cooked for SDS-PAGE and Western blot.

The SDS-PAGE and Western blot identification results of the Cap protein are shown in figure 1.

Example 6 Indirect immunofluorescence detection of Cap protein expression

(1) 1m1 of the recombinant E.coli bacterial ghost prepared in example 5 was centrifuged at 8000rpm for 5min, the supernatant was discarded, and then the bacterial ghost was resuspended in PBS, mixed, 10. mu.l of the mixture was applied to a polylysine-treated slide glass and fixed at room temperature for 30 min.

(2) Gently washing with PBS for three times, soaking in 4 deg.C precooled pure methanol for 20min, and air drying

(3) PBS washing three times, each for 5min

(4) Adding 1: rabbit anti-Cap polyclonal antibody (abcam) diluted 2000 times, incubated at 37 deg.C for 5-7 hr, washed three times with PBS, each for 5min

(5) Adding 1: 50-fold dilution of green fluorescently labeled anti-rabbit IgG (abcam), incubation at 37 ℃ for 30min, three washes with PBS

(6) Observed by an inverted fluorescence microscope. The indirect immunofluorescence results are shown in figure 2 (the hollow green fluorescent ghost cells are the bacterial ghosts of the Escherichia coli expressing the Cap protein, as shown by the arrow).

Example 7 Observation of Cap protein localization by immunoElectron microscopy

BL21 expression bacteria transferred into expression plasmid pMD-28a-INP-Cap-E are picked and shaken overnight. The next day, the cells were transferred to a fresh LB medium at a ratio of 1: 100, and when the OD reached 0.3, 1mM IPTG was added to induce Cap protein expression, after 4 hours of induction, the cells were harvested by centrifugation at 10000rpm for 5 minutes, and the cells were precipitated on the bottom of an EP tube.

(1) Adding 2% glutaraldehyde and fixing for 2 hr at normal temperature on shaking table

(2) The glutaraldehyde is discarded and then 0.5-1% osmic acid is added gently to continue the fixation at room temperature overnight

(3) F2 was discarded and 50%, 70%, 90% Dimethylformamide (DMF) was added sequentially and allowed to react at room temperature for 15 min. Adding 100% DMF, and allowing to act for 2 times each for 10min

(4) The cells were applied to the mixture of resin and DMF at 1: 2 on a shaker at 4 ℃ for 30 min. Then using a mixed solution of resin and DMF (2: 1) to act on a shaking table at 4 ℃ for 30min

(5) Pure resin acts on thallus and stays overnight at 4 DEG C

(6) Slicing the sample

(7) 3% BSA, incubation of sections for 30min at RT

(8) 1% BSA diluted 1: 100 in 200ul primary anti-rabbit anti-Cap protein polyclonal antibody (abcam), blotted to dryness, and primary antibody incubated at room temperature for 40min

(9) Washing with water three times for 3 min each time, and then blotting

(10) The colloidal-gold goat anti-rabbit secondary antibody (abcam) diluted 1: 100 with 1% BSA was incubated for 40min at room temperature

(11) Washing with water for three times, each for 3 minutes

(12) Staining uranium for 10min, and observing by electron microscope

The observation result of the electron microscope is shown in figure 3 (the black particles shown by the arrow are the Cap protein which is presented to the outer membrane of the bacterial ghost of the Escherichia coli).

Example 8 preparation of presentation of Cap protein expressing E.coli ghost as a subunit vaccine for porcine circovirus

His-tagged Cap protein presented on the outer membrane of the bacterial ghost and 0.2mg/ml His-tagged CdtB protein (Haemophilus parasuis cytology latent Toxin indexes Cell Cycle and p53-dependent Apoptosis, PLoS ONE, 2017, 12 (5): e0177199.) were used as Westem blot, and then grayscale detection was carried out by using Image J Launcher, thereby indirectly estimating the Cap protein content in the bacterial ghost. On the basis of Cap protein quantification, BL21(pMD-28a-INP-Cap-E) containing 500. mu.g of Cap protein is mixed and emulsified with Montanide ISA201 adjuvant from Seppic company in a weight ratio of 1: 1 to prepare the porcine circovirus subunit vaccine.

Test example 1 Immunopotentiality test of porcine circovirus subunit vaccine

1. Test grouping

Selecting 10 healthy weaned piglets with 4-6 weeks old and porcine circovirus seronegative, randomly dividing into 2 groups, and 5 piglets in each group. Is divided into a porcine circovirus subunit vaccine immunization group and a control group.

2. Test method

The immunized group was injected intramuscularly with 1mL of the porcine circovirus subunit vaccine prepared in example 7 (containing 500 μ g of Cap protein), and the control group was injected with an equal amount of an emulsion of PBS and ISA201 adjuvant. Blood was collected before immunization and weekly after immunization. After three weeks of secondary immunization, the porcine circovirus type 2 virulent strain LG strain (Liuchangming; Critical Wu, Luyuanhua, Huangliping, Wuhongli, Zhangxia, Wensgang, Jianfengjuan; development and application of porcine circovirus type 2 inactivated vaccine (LG strain) [ A ], the animal husbandry and veterinary biotechnology division of the Chinese animal husbandry and veterinary society of the Chinese immunization society, the eighth academic seminar proceedings of the eighth academic seminar conference of the Chinese immunization society [ C ], 2010) is used for virus attack, and four weeks of virus attack are dissected to observe pathological changes. And weighed before challenge and before killing.

3. Evaluation index

The evaluation indexes include 4 aspects, namely, the serum antibody level (porcine circovirus type 2 ELISA antibody detection kit, Beijing Jinobent technologies, Inc.), the viremia (PCR), the inguinal lymph node virus load (qRT-PCR) and the relative daily gain (4 weeks after the virus attack-the weight before the virus attack, and the calculation formula is that (daily gain of an immune group-the daily gain of a control group)/the daily gain of the control group is x 100%)

4. Test results

1) Serum antibody levels

The result shows that the porcine circovirus subunit vaccine immunization group can detect the antibody after one week of immunization, the antibody turns positive within two weeks of immunization, and the antibody level is higher all the way along with the secondary immunization and is far higher than that of the control group. The results of antibody level measurements two weeks after the two-week immunization are shown in FIG. 4.

2) Viremia outcome

Blood is collected every week after virus challenge, and viremia is detected by using a PCR method. Nucleic acids in serum were extracted using Tiangen DNA extraction kit (Tiangen, Beijing). Then, using this as a template, the pcr was performed using a circovirus-specific primer P1: 5'-CCCATGCCCTGAATTTCCATA-3' (SEQ ID NO: 12), P2: 5'-TAAACTACTCCTCCCGCCATAC-3' (SEQ ID NO: 13) A nucleic acid sequence of 353bp in length of circovirus (SEQ ID NO: 14) was amplified. The analysis was performed by nucleic acid electrophoresis, and the results are shown in FIG. 5. The PCR reaction system was 20ul, where 10 ul of Premix Taq (Ex Taq version), 1 ul of each of the upstream and downstream primers, 2 ul of the template, and 7 ul of sterile water. The reaction conditions are as follows: 5min at 95 ℃, 30s at 94 ℃, 30s at 52 ℃ and 40s at 72 ℃ for 30 cycles, and 10min at 72 ℃. In the control group viremia began to appear two weeks after challenge, and as time passed, the number of pigs showing viremia gradually increased, and viremia appeared all at 4 weeks after challenge. And none of the porcine circovirus subunit vaccine immunization groups had viremia. The results are shown in Table 1.

TABLE 1

3) Inguinal lymph node viral load results

And (3) killing pigs in four weeks after the challenge, aseptically collecting inguinal lymph nodes, extracting genomes by using a Tiangen DNA extraction kit, and detecting the virus load in the lymph nodes by using fluorescent quantitative PCR (qPCR). Primers were designed for the conserved region of PCV2, P1 (5'-CCCATGCCCTGAATTTCCATA-3', SEQ ID NO: 12)), P2 (5'-TAAACTACTCCTCCCGCCATAC-3', SEQ ID NO: 13). The TaqMan probe primer sequence is 5 '-FAMATGTATGTACAATTCAGAGAATTTATAMRA-3', SEQ ID NO: 15, (1087-. The fluorescent quantitative PCR reaction conditions are as follows: 10min at 95 ℃, 5s at 95 ℃, 15s at 61 ℃ and 40 cycles, and 20s at 72 ℃. The results show that the viral load of the control group is much higher than that of the immune group, and the difference between the two groups is at least more than 100 times. The results are shown in FIG. 6.

4) Relative daily gain results

The pigs were weighed before challenge and before killing and the daily gain was calculated. The relative daily gain results show that the pig weight gain of the control group after the virus attack is slow, and the weight gain difference of the porcine circovirus subunit vaccine immune group relative to the control group is obvious. The results are shown in FIG. 7.

Sequence listing

SEQ ID NO：1

Sequence of INP

ATGGCACTGGATAAAGCACTGGTTCTGCGTACCTGTGCAAATAATAT GGCAGATCATTGTGGTCTGATTTGGCCGGCAAG

CGGTACCGTTGAAAGCCGTTATTGGCAGAGCACCCGTCGTCATGAA AATGGTCTGGTTGGTCTGCTGTGGGGTGCAGGTA

CCAGCGCATTTCTGAGCGTTCATGCAGATGCACGTTGGATTGTTTGT GAAGTTGCAGTTGCAGATATTATTAGCCTGGAA

GAACCGGGTATGGTTAAATTTCCGCGTGCAGAAGTTGTTCATGTTG GTGATCGTATTAGCGCAAGCCATTTTATTAGCGC

ACGTCAGGCAGATCCGGCAAGCACCAGCACCAGCACCAGCACCAG CACCCTGACCCCGATGCCGACCGCAATTCCGACCC

CGATGCCGGCAGTTGCAAGCGTTACCCTGCCGGTTGCAGAACAGG CACGTCATGAAGTTTTTGATGTTGCAAGCGTTAGC

GCAGCAGCAGCACCGGTTAATACCCTGCCGGTTACCACCCCGCAG AATCTGCAGACC

SEQ ID NO：2

Sequences of E-lysine

TCAGCCAAACGTCTCTTCAGGCCACTGACTAGCGATAACTTTCCCC ACAACGGAACAACTCTCATTGCATGGGATCATTG

GGTACTGTGGGTTTAGTGGTTGTAAAAACACCTGACCGCTATCCCT GATCAGTTTCTTGAAGGTAAACTCATCACCCCCA

AGTCTGGCTATGCAGAAATCACCTGGCTCAACAGCCTGCTCAGGGT CAACGAGAATTAACATTCCGTCAGGAAAGCTTGG

CTTGGAGCCTGTTGGTGCGGTCATGGAATTACCTTCAACCTCAAGC CAGAATGCAGAATCACTGGCTTTTTTGGTTGTGC

TTACCCATCTCTCCGCATCACCTTTGGTAAAGGTTCTAAGCTTAGGT GAGAACATCCCTGCCTGAACATGAGAAAAAACA

GGGTACTCATACTCACTTCTAAGTGACGGCTGCATACTAACCGCTTC ATACATCTCGTAGATTTCTCTGGCGATTGAAGG

GCTAAATTCTTCAACGCTAACTTTGAGAATTTTTGTAAGCAATGCGG CGTTATAAGCATTTAATGCATTGATGCCATTAA

ATAAAGCACCAACGCCTGACTGCCCCATCCCCATCTTGTCTGCGAC AGATTCCTGGGATAAGCCAAGTTCATTTTTCTTT

TTTTCATAAATTGCTTTAAGGCGACGTGCGTCCTCAAGCTGCTCTTG TGTTAATGGTTTCTTTTTTGTGCTCATACGTTA

AATCTATCACCGCAAGGGATAAATATCTAACACCGCGCGTGTTGACT ATTTTACCTCTGGCGGTGATAATGGTTGCATGT

ACTAAGGAGGTTGTATGGAACAACGCATAACCCTGAAAGATTATGC AATGCGCTTTGGGCAAACCAAGACAGCTAAAGAT

CCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCGAATTCTCATTC AGGCTTCTGCCGTTTTGGATTTAACCGAAGATG

ATTTCGATTTTCCGACGAGTAACAAAGTTTGGATTGCTACTGACCG CTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTT

TATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGT TGAGTTTATTGCTGCCGTCATTGCTTATTATGT

TCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCT GAATTTACGGAAAACATTATTAATGGCGTCGAGC

GTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACG CGCAGGAAACACTGACGTTCTTACTGACGCAGAA

GAAAACGTGCGTCAAAAATTACGTGCGGAAGGAGTGA

SEQ ID NO：3

Sequence of Cap

ATGACGTATCCAAGGAGGCGTTTcCGCAGACGAAGACACCGCCCCC GCAGCCATCTTGGCCTGATCCTCCGCCGCCGCCC

CTGGCTCGTCCACCCCCGCCACCGTTACCGCTGGAGAAGGAAAAA TGGCATCTTCAACACCCGCCTCTCCTGCACCTTCG

GATATACTGTCAAGGCTACCACAGTCAGAACGCCCTCCTGGGCGGT GGACATGATGAGATTTAATATTAACGACTTTGTT

CCCCCGGGAGGGGGGACCAACGAAATCTCTATACCCTTTGAATACT ACAGAATAAGAAAGGTTAAGGTTGAATTCTGGCC

CTGCTCCCCAATCACCCAGGGTGACAGGGGAGTGGGCTCCACTGC TGTTATTCTAGATGATAACTTTGTAACTAGGGCCA

CAGCCCTAACCTATGGCCCCTATGTAAACTACTCCTCCCGCCATACA ATCCCCCAACCCTTCTCCTACCACTCCCGGTAC

TTTACCCCCAAACCTGTCCTTGATTCCACTATTGATTACTTCCAACC AAACAACAAAAGGAATCAGCTTTGGCTGAGACT

ACAAACCTCGGCAAATGTGGACCACGTAGGCCTCGGCATTGCGTTC GAAAACAGTACATACGACCAGGACTACAATATCC

GGGTAACTATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCC CCACTTAAACCCTAA

SEQ ID NO：4

Sequence of INP-F

5’-GCGCATATGGCACTGGAT-3’

SEQ ID NO：5

Sequence of INP-R

5’-GCTCTCGAGGGTCTGCAGATT-3’

SEQ ID NO：6

pET-28 a-inp-F sequence

5’-ATACCGCGGATCCGGATATAGTTCC-3’

SEQ ID NO：7

pET-28 a-inp-R sequence

5’-AATGAGCTCTCACTGCCCGCTTT-3’

SEQ ID NO：8

Sequence of cap-F

5’-ACACATATGACGTATCCAAGGAGGC-3’

SEQ ID NO：9

Sequence of cap-R

5’-ACTCTCGAGTTAGGGTTTAAGTGGG-3’

SEQ ID NO：10

Sequences of lysis-E-F

5’-TCCATACCGCGGTCAGCCAAACGTCTCTTCAG-3’

SEQ ID NO：11

Sequences of lysis-E-R

5’-CGCGGATCCTCACTCCTTCCGCACGTAAT-3’

SEQ ID NO：12

Sequence of P1

5’-CCCATGCCCTGAATTTCCATA-3’

SEQ ID NO：13

Sequence of P2

5’-TAAACTACTCCTCCCGCCATAC-3’

SEQ ID NO：14

Sequence of specific gene of circovirus

CCCATGCCCTGAATTTCCATATGAAATAAATTACTGAGTCTTTTTTAT CACTTCGTAATGGTTTTTATTTATTCATTAAGGGTTAAGTGGGGGGTC TTTAAGGTTAAATTCTCTGAATTGTACATACATGGTTACACGGATATT GTATTCCTGGTCGTATATACTGTTTTCGAACGCAGTGCCGAGGCCTA CGTGGTCTACATTTCCAGTAGTTTGTAGTCTCAGCCACAGCTGATTT CTTTTGCTGTTTGGTTGGAAGTAATCAATAGTGGAATCTAGGACAG GTTTGGGGGTAAAGTAGCGTGAGTGGTAGGAGAAGGGCTGGGTTA TGGTATGGCGGGAGGAGTAGTTTA

SEQ ID NO：15

Sequence of TaqMan probes

5 '-FAM-ATGTATGTACAATTCAGAGAATTTA-TAMRA-3' (note: FAM at the 5 'end is a fluorophore 6-carboxyfluorescein, TAMRA at the 3' end is a quencher).

Claims

1. A method for preparing bacterial ghost, comprising cloning an INP signal sequence and a lysis cassette gene E-lysis into the same expression vector, and transforming bacteria, wherein the INP signal sequence is represented by SEQ ID NO. 1, and the lysis cassette gene E-lysis is represented by SEQ ID NO. 2, wherein the method further comprises cloning an exogenous antigen gene immediately downstream of the INP signal sequence, wherein the exogenous antigen gene is a Cap protein gene of porcine circovirus PCV2, wherein the Cap protein gene sequence is represented by SEQ ID NO. 3, and wherein the bacteria is Escherichia coli.

2. The method of claim 1, wherein the method further comprises inducing expression of the lytic cassette gene E-lysis by raising the culture temperature from 37 ℃ to above 42 ℃ after inducing expression of the foreign antigen gene.

3. The method of claim 1 or 2, wherein the expression vector is a prokaryotic expression vector.

4. The method of claim 3, wherein the vector is pET-28 a.

5. An expression vector, which comprises an INP signal sequence, an exogenous antigen gene and a cleavage box gene E-lysine, wherein the INP signal sequence is a sequence represented by SEQ ID NO. 1, the sequence of the cleavage box gene E-lysine is a sequence represented by SEQ ID NO. 2, and the exogenous antigen gene is close to the downstream of the INP signal sequence, wherein the exogenous antigen gene is a Cap protein gene of porcine circovirus PCV2, and the Cap protein gene sequence is a sequence represented by SEQ ID NO. 3.

6. The expression vector of claim 5, wherein the expression vector is a prokaryotic expression vector.

7. The expression vector of claim 5, wherein the expression vector is pET-28 a.

8. A bacterial ghost prepared by the method of claim 1.

9. Use of the bacterial ghost of claim 8 for the preparation of a porcine circovirus vaccine.