CN108384896A - A kind of RT-PCR detection kit and its detection method of Koi herpesvirus - Google Patents
A kind of RT-PCR detection kit and its detection method of Koi herpesvirus Download PDFInfo
- Publication number
- CN108384896A CN108384896A CN201810432783.9A CN201810432783A CN108384896A CN 108384896 A CN108384896 A CN 108384896A CN 201810432783 A CN201810432783 A CN 201810432783A CN 108384896 A CN108384896 A CN 108384896A
- Authority
- CN
- China
- Prior art keywords
- pcr amplification
- kit
- koi herpesvirus
- reagent
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses the RT PCR detection kits and its detection method of a kind of Koi herpesvirus, the primer sets include primer S1, S2, wherein：S1:5’‑AAGGCTTAGTAGCTTACCAT‑3’,S2：5 ' CAAGGTAGCTGAGTCGACCTATG 3 ', S3：5’‑ATAAGGGCTGAGTCCTGAT‑3’.The present invention designs specific primer S1, S2 and S3, can carry out specific amplification to Koi herpesvirus.The dedicated kit of the present invention has very strong sensibility, and coincidence rate can be widely applied for the antidiastole of Koi herpesvirus up to 100% compared with the methods of virus purification and IFA.
Description
Technical field
The present invention relates to veterinary biological virus detection techniques fields, and in particular to a kind of RT-PCR inspections of Koi herpesvirus
Test agent box and its detection method.
Background technology
Koi herpesvirus (Koi herpesvirus), abbreviation KHV.Because it is mainly by DNA class bleb filterable virus
Caused by infection also known as carp nephritis and the gill gangrene virus, Asia in 2004 also by report infect Koi herpesvirus.
China is classified as two class animal epidemics, is that World Organization for Animal Health (OIE) must notifiable disease.Also known as carp herpesviral
3 types (CyHV-3) belong to herpetoviridae, and virus has a cyst membrane, and nucleocapsid is icosahedron, 170~230nm of diameter, and viral nucleic acid is
Double-stranded DNA.The disease is mainly in spring, autumn, incubation period 14d, and morbidity 24~48h after symptom occurs and starts death, dead in 2~4d
Rate is rapid, can reach 80%~100%.
It is very harmful to culture fishery since the death rate of the disease fancy carp and carp is up to 75%~95%, and fancy carp blister
Vaccine of the exanthema viral disease at present without effective drug and commercialization establishes a kind of reverse transcription of Koi herpesvirus for treating
PCR diagnostic methods and dedicated kit can facilitate and occur fast and accurately to diagnose epidemic disease in early days in epidemic disease, be the anti-of epidemic disease
Control provides effective reference.
Invention content
In view of this, the purpose of the present invention is to provide a kind of RT-PCR detection kit of Koi herpesvirus and its inspections
Survey method, the kit can quickly distinguish Koi herpesvirus.
To achieve the goals above, the technical solution adopted in the present invention is：
A kind of RT-PCR detection kit of Koi herpesvirus, the primer sets include primer S1, S2, S3, wherein：
S1：5 ,-AAGGCTTAGTAGCTTACCAT-3,；
S2：5 ,-CAAGGTAGCTGAGTCGACCTATG-3,；
S3：5 ,-ATAAGGGCTGAGTCCTGAT-3,.
Application of the primer sets in preparing for Koi herpesvirus differential diagnosis kit a kind of described in.
A kind of Koi herpesvirus differential diagnosis kit of the primer sets.
The kit further includes nucleic acid extracting reagent, Reverse Transcription, PCR amplification reagent, and/or Ago-Gel
Electrophoresis reagents.
The Reverse Transcription include 10 × M-MLV buffer solutions, dNTP, M-MLV reverse transcriptase, RNase enzyme inhibitors,
S2 primers.
The PCR amplification reagent includes 10 × PCR amplification buffer solution, dNTP, S1 primer, S2 primers, TaqDNA polymerizations
Enzyme and distilled water.
PCR amplification system constructed by the PCR amplification reagent is：10 × PCR amplification buffer solution, 5.0 μ L,
2.5mmol/LdNTP8.0 μ L, 1.0 μ L of 10mmol/LS1 primers, 1.0 μ L of 10mmol/LS2 primers, 5U/ μ LTaqDNA polymerases
1.0 μ L, 3.0 μ L of template, add distilled water to 50 μ L.
A kind of application method of the kit, including nucleic acid extraction, reverse transcription, PCR amplification and Ago-Gel electricity
Swimming.
The PCR amplification condition is：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C extend
90s, totally 35 recycle；Last 72 DEG C of extensions 10min.
Beneficial effects of the present invention：
The present invention designs specific primer S1, S2, S3 by the difference of comparison Koi herpesvirus, can be to fancy carp blister
Exanthema virus carries out specific amplification；Dedicated kit is had developed on this basis, first extracts viral RNA, and it is anti-to reuse S2 primers
Transcription synthesis cDNA, and detection Koi herpesvirus is differentiated using RT-PCR method.Compared with prior art, of the invention special
Kit has very strong sensibility, can be widely applied for the antidiastole of clinical Koi herpesvirus.
Specific implementation mode
To make the objectives, technical solutions, and advantages of the present invention clearer, below in conjunction with specific embodiment, to this hair
Bright to be described in further detail, the embodiment is only for explaining the present invention, is not intended to limit the scope of the present invention..
Experimental method used in following embodiments is the conventional method of this field unless otherwise specified, or according to institute of manufactory
It is recommended that condition and implementation steps.
The structure of embodiment 1, differential diagnostic method
1, design of primers
Two specific primers are designed, it is specific as follows:
S1：5 ,-AAGGCTTAGTAGCTTACCAT-3, (SEQ ID NO.1)
S2：5 ,-CAAGGTAGCTGAGTCGACCTATG-3, (SEQ ID NO.2)
S3：5 ,-ATAAGGGCTGAGTCCTGAT-3, (SEQ ID NO.3)
PCR amplification is carried out using S1, S2 and S3, it is 836bp that vaccine strain, which is expected amplified fragments size, and now separation strains are expected
Amplified fragments size is 578bp.
2, the extraction of viral RNA
Take strain cell culture fluid, after multigelation 3 times, 5000g centrifuges 15min, takes supernatant spare.
(1) 0.2ml chloroforms are taken, isometric supernatant is added, acutely rocks 15s, are placed at room temperature for 3min, then 12,000g,
4 DEG C of centrifugation 5min.Be divided into 3 layers after centrifugation, it is nethermost it is red be phenol-chloroform phase, a middle layer, upper layer is colourless water
Phase, RNA are present in water phase；
(2) upper strata aqueous phase in step (1) is transferred in the clean EP pipes of another, the isopropyl of 0.5ml precoolings is added
Alcohol is stored at room temperature 10min, then 12,000g, 4 DEG C of centrifugation 10min；
(3) it outwells supernatant, 75% ethyl alcohol of 1ml volume fractions is added and washs RNA precipitate, after mixing, 7500g, 4 DEG C of centrifugations
5min；
(4) supernatant is outwelled, 10min is placed at room temperature for, is then added in right amount without RNAse water dissolutions RNA to get to total serum IgE.
3, reverse transcription
The RNA extracted using step 2 carries out reverse transcription as template, obtains cDNA, and reverse transcription reaction system is：
| Template ribonucleic acid | 4.9μL |
| S2 primers (10mmol/L) | 0.3μL |
| RTase enzyme inhibitors (40U/ μ L) | 0.3μL |
| M-MLV reverse transcriptase (200U/ μ L) | 0.5μL |
| dNTP(2.5mmol/L) | 2.0μL |
| 10 × M-MLV buffer solutions | 2.0μL |
Reaction condition is：42 DEG C of heat preservations 60min, 70 DEG C of 10min.
4, PCR (PCR)
4.1PCR reaction system
The cDNA obtained using step 3 carries out PCR amplification as template, and PCR reaction systems are：
| dNTP(2.5mmol/L) | 8.0μL |
| 10 × PCR amplification buffer solution | 5μL |
| S1 primers (10mmol/L) | 1.0μL |
| S2 primers (10mmol/L) | 1.0μL |
| S3 primers (10mmol/L) | 1.0μL |
| cDNA | 3.0μL |
| Taq DNA polymerase (5U/ μ L) | 1.0μL |
| ddH2O | To 50 μ L |
4.2PCR reaction condition optimization
The PCR reaction conditions of vaccine strain are optimized, respectively with annealing temperature be 54 DEG C, 55 DEG C, 56 DEG C, 57 DEG C, 58
DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C carry out PCR reaction amplification vaccine strains, reaction condition is：95 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.It was found that at 57 and 62 DEG C
The segment of 836bp sizes can be amplified, it is in the same size with expection.
The PCR reaction conditions of existing ground separation strains are optimized, respectively with annealing temperature be 52 DEG C, 53 DEG C, 54 DEG C, 55
DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C carry out PCR reaction amplification now separation strains, reaction condition are：95 DEG C of pre- changes
Property 5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.It was found that going out at 57 DEG C
The segment of existing 578bp sizes, it is in the same size with expection.
In summary it reacts, the annealing temperature of composite PCR is finally set as 57 DEG C by the present invention, the reaction condition after optimization
For：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions
10min.Pcr amplification product is placed in -20 DEG C of preservations.
5, electrophoresis
To PCR product into row agarose gel electrophoresis, voltage 100V, electrophoresis 40min, under DNA gel imaging system instrument
Observe result.
The dedicated kit of the present invention includes nucleic acid extracting reagent, Reverse Transcription, PCR used in above-mentioned detection method
Amplifing reagent, agarose gel electrophoresis reagent.
Embodiment 2, sensitivity experiment
Now it will carry out 10 times of gradient dilutions by separation strains virus liquid, it is 5.4 × 10 to make virus concentration4-5.4×10- 4Copies/ μ L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 5.4 × 10- 3Copies/ μ L it is amplifiable go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 5.4 × 10- 3Copies/ μ L, but the 9th swimming lane 5.4 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 5.4 × 10- 3copies/μL。
Vaccine strain virus liquid is subjected to 10 times of gradient dilutions, it is 1.5 × 10 to make virus concentration4-1.0×10-4copies/μ
L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 1.5 × 10-3Copies/ μ L are amplifiable
Go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 1.5 × 10-3Copies/ μ L, but the 9th swimming
Road 1.5 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 1.5 × 10-3copies/μL。
The above is only presently preferred embodiments of the present invention, is not imposed any restrictions to the present invention, every according to the present invention
Technical spirit changes any simple modification, change and equivalent structure made by above example, still falls within skill of the present invention
In the protection domain of art scheme.
Sequence table
<110>Zhang Chaoming, Yan Yuzhou, Zhang Shenghui, Li Wen get
<120>A kind of RT-PCR detection kit and its detection method of Koi herpesvirus
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
aaggcttagt agcttaccat 20
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
caaggtagct gagtcgacct atg 23
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ataagggctg agtcctgat 19
Claims (9)
1. a kind of RT-PCR detection kit of Koi herpesvirus, which is characterized in that the primer sets include S1, S2, S3,
Wherein：
S1：5’-AAGGCTTAGTAGCTTACCAT-3’；
S2：5’-CAAGGTAGCTGAGTCGACCTATG-3’；
S3：5’-ATAAGGGCTGAGTCCTGAT-3’.
2. a kind of primer sets as described in claim 1 answering in preparing for Koi herpesvirus differential diagnosis kit
With.
3. a kind of Koi herpesvirus differential diagnosis kit including primer sets as described in claim 1.
4. kit according to claim 3, which is characterized in that the kit further includes nucleic acid extracting reagent, anti-
Transcript reagent, PCR amplification reagent, and/or agarose gel electrophoresis reagent.
5. kit according to claim 4, which is characterized in that the Reverse Transcription is buffered including 10 × M-MLV
Liquid, dNTP, M-MLV reverse transcriptase, RNase enzyme inhibitors, S2 primers.
6. kit according to claim 4, which is characterized in that the PCR amplification reagent is slow including 10 × PCR amplification
Fliud flushing, dNTP, S1 primer, S2 primers, Taq archaeal dna polymerases and distilled water.
7. kit according to claim 6, which is characterized in that the PCR amplification body constructed by the PCR amplification reagent
System is：10 × PCR amplification buffer solution, 5.0 μ L, 2.5mmol/L dNTP8.0 μ L, 1.0 μ L of 10mmol/L S1 primers, 10mmol/L
1.0 μ L of S2 primers, 1.0 μ L of 5U/ μ L Taq archaeal dna polymerases, 3.0 μ L of template, add distilled water to 50 μ L.
8. a kind of application method such as claim 3-7 any one of them kits, which is characterized in that including nucleic acid extraction,
Reverse transcription, PCR amplification and agarose gel electrophoresis.
9. the application method of kit according to claim 8, which is characterized in that the PCR amplification condition is：95℃
Pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810432783.9A CN108384896A (en) | 2018-05-08 | 2018-05-08 | A kind of RT-PCR detection kit and its detection method of Koi herpesvirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810432783.9A CN108384896A (en) | 2018-05-08 | 2018-05-08 | A kind of RT-PCR detection kit and its detection method of Koi herpesvirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108384896A true CN108384896A (en) | 2018-08-10 |
Family
ID=63071364
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810432783.9A Withdrawn CN108384896A (en) | 2018-05-08 | 2018-05-08 | A kind of RT-PCR detection kit and its detection method of Koi herpesvirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108384896A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006254750A (en) * | 2005-03-16 | 2006-09-28 | Eiken Chem Co Ltd | Method for detecting carp herpes virus (khv) |
| CN103060475A (en) * | 2013-01-18 | 2013-04-24 | 中国水产科学研究院长江水产研究所 | LAMP detection kit for Koi herpesvirus and detection method |
| CN104032037A (en) * | 2014-06-23 | 2014-09-10 | 浙江省淡水水产研究所 | Cyprinid herpesvirus detection kit and detection method thereof |
| CN106350608A (en) * | 2016-09-28 | 2017-01-25 | 中国科学院水生生物研究所 | Detection kit and detection method for Cyprinid herpesvirus III |
-
2018
- 2018-05-08 CN CN201810432783.9A patent/CN108384896A/en not_active Withdrawn
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006254750A (en) * | 2005-03-16 | 2006-09-28 | Eiken Chem Co Ltd | Method for detecting carp herpes virus (khv) |
| CN103060475A (en) * | 2013-01-18 | 2013-04-24 | 中国水产科学研究院长江水产研究所 | LAMP detection kit for Koi herpesvirus and detection method |
| CN104032037A (en) * | 2014-06-23 | 2014-09-10 | 浙江省淡水水产研究所 | Cyprinid herpesvirus detection kit and detection method thereof |
| CN106350608A (en) * | 2016-09-28 | 2017-01-25 | 中国科学院水生生物研究所 | Detection kit and detection method for Cyprinid herpesvirus III |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105112559B (en) | A kind of kit and its application for being used to detect coronavirus | |
| CN104846125A (en) | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primers, probe and kit for detecting MERS (Middle East Respiratory Syndrome), and detection method thereof | |
| CN111394431B (en) | Method for detecting nucleic acid by using double real-time fluorescent isothermal amplification technology | |
| CN105543414B (en) | A kind of Respiratory Syncytial Virus(RSV) A/B hypotype multiple fluorescence quantitative PCR detection primer group and probe groups and its kit and preparation method | |
| CN102534050B (en) | Triple polymerase chain reaction (PCR) detecting primer group, reagent kit and method for diagnosing grass carp reovirus | |
| CN104328222A (en) | Kit capable of detecting and parting dengue viruses by reverse transcription PCR and detection method of kit | |
| CN113025726A (en) | Primer, probe, kit and method for visual rapid detection of schistosoma japonicum nucleic acid by LFD-RPA | |
| Kim et al. | Isolation and identification of monkeypox virus MPXV-ROK-P1-2022 from the first case in the Republic of Korea | |
| CN101812539B (en) | Hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and production method thereof | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| CN103451315B (en) | Loop-mediated isothermal amplification detection primer set and kit for rotaviruses as well as detection method | |
| CN105002169A (en) | DHAV-3 fluorescent quantitation RT-LAMP detection reagent kit and application and method thereof | |
| CN101487064B (en) | Method and special reagent kit for detecting five zoonosis virus | |
| Xia et al. | Rapid detection of Banna virus by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) | |
| CN102876813A (en) | Real-time fluorescence RT-HDA (Reverse Transcriptase-Helicase-Dependent Isothermal Amplification) kit and primer for detecting avian influenza virus | |
| CN102912038B (en) | RT-HDA kit and primer for detecting avian influenza virus | |
| CN105671209A (en) | Primers, probe, kit and method for detecting bovine coronavirus | |
| CN110643740A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for Palimam serogroup virus | |
| CN108384896A (en) | A kind of RT-PCR detection kit and its detection method of Koi herpesvirus | |
| CN105463131A (en) | Human bocavirus LAMP (loop-mediated isothermal amplification) detection kit | |
| CN108300812A (en) | A kind of RT-PCR detection kit and its detection method of Pigeon paramyxovirus type I | |
| CN109355433A (en) | A kind of very fast fluorescence PCR detection reagent kit of Hantaan virus and its primer combination of probe | |
| CN104342502A (en) | Molecular beacon probe, primer and method for quickly detecting dengue virus | |
| CN102618627B (en) | Internal reference detection system and kit for isothermal nucleic acid amplification reaction | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180810 |
|
| WW01 | Invention patent application withdrawn after publication |