CN108384848B

CN108384848B - Application of circ _0021132 in serum as diagnostic marker of deep vein thrombosis

Info

Publication number: CN108384848B
Application number: CN201810489377.6A
Authority: CN
Inventors: 王彬; 李霞; 刘明; 赵霖; 张云虹; 张振; 郝清智; 朱肖肖; 魏然; 郭强; 尹训强
Original assignee: Affiliated Hospital of Shandong University of Traditional Chinese Medicine
Current assignee: Affiliated Hospital of Shandong University of Traditional Chinese Medicine
Priority date: 2018-05-21
Filing date: 2018-05-21
Publication date: 2021-04-30
Anticipated expiration: 2038-05-21
Also published as: CN108384848A

Abstract

The invention discloses application of circ _0021132 in serum as a diagnostic marker for deep venous thrombosis, and develops a corresponding detection kit by using circ _0021132 as the diagnostic marker for diagnosing deep venous thrombosis.

Description

Application of circ _0021132 in serum as diagnostic marker of deep vein thrombosis

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to application of circ _0021132 in serum as a diagnostic marker for deep vein thrombosis.

Background

Deep Vein Thrombosis (DVT) is a common peripheral vascular disease with an annual incidence of about 1.6% and a rapidly increasing incidence after the age of 45. The acute pulmonary embolism complication of the DVT is a common acute lethal reason, and sequelae such as swelling of affected limbs, stasis dermatitis, intractable crus ulcer and the like caused by vein valve damage are frequently seen in the chronic stage, so that the life and health of a patient are seriously harmed, and the rapid and accurate diagnosis of the DVT is of great clinical significance. However, the clinical symptoms and signs of DVT lack specificity and, based on these diagnoses or exclusions, DVT has proven inaccurate. D-dimer (D-dimer) is the main biological index currently used clinically for diagnosing DVT, but is not a specific serological index of thromboembolic diseases, and the expression of the D-dimer can be increased in diseases such as infection, trauma, tumor and the like. The ultrasonic image examination has important significance for diagnosing DVT, but has the influences of factors such as high price, limitation of instruments and equipment, high requirement on professional ability of an examining doctor and the like. Therefore, the search for biological indexes with strong specificity, high sensitivity, good stability and convenient operation has important significance for clinical diagnosis and treatment of DVT.

With the development of deep sequencing technologies and the completion of multiple genome projects, large amounts of non-coding RNA have been identified, and more research has found that what was once referred to as "dark material" or "junk RNA" in the genome because it was unable to encode proteins plays an important role in many life activities. Epigenetic study of non-coding RNA is one of the hottest biological subjects in recent years, and the knowledge of non-coding RNA is continuously refreshed by the results of infinite studies. circRNA is a special class of non-coding RNA molecules recently identified after microRNA, and is a new star with great development potential for rising of RNA family, and although the large-scale research time is not long, related papers are published in the journal of NCS equi-class journal. The circRNA molecule is rich in microRNA complementary binding sites, is called competitive endogenous RNA (ceRNA), plays the role of microRNA molecule sponge in cells, competitively binds and seals the complementary binding sites of the microRNA and a target gene, further relieves the inhibition of the microRNA on the target gene, and up-regulates the expression and function of the target gene. Different from the traditional linear RNA, the circRNA molecule has a closed ring structure, is not influenced by RNA exonuclease, has more stable expression and is not easy to degrade, so the circRNA molecule has good application prospect as a potential disease diagnosis index.

In summary, there is a need to search for new effective markers for clinical diagnosis, treatment and prognosis detection of deep venous thrombosis, and provide basis for diagnosis, treatment and development of related drugs.

Disclosure of Invention

In view of the above prior art, the inventors have conducted extensive technical research and long-term clinical practice to provide a related product for diagnosing deep vein thrombosis, and to provide an application of circ _0021132 as a marker of deep vein thrombosis.

In a first aspect of the invention, there is provided the use of circ _0021132 as a diagnostic marker for deep vein thrombosis in the manufacture of a product for use in the diagnosis of deep vein thrombosis.

Wherein the nucleic acid sequence of the circ _0021132 is as follows:

TGATCCCGTACCACATTCTGATCGTACCAAGCAAGAAGCTGGGGGGCTCCATGTTCACTGCCAACCCATGGATCTGTATATCAGGAGAATTGGGTGAGACACAGATCATGCAGATTCCCAGGAATGTGCTAGAGATGACCTTCGAGTGCCAGAACTTGGGGAAGCTTACTACTGTCCAGATTGGCCATGATAACTCTGGGCTGTATGCCAAATGGCTGGTGGAGTATGTGATGGTCAGGAATGAGATCACAGGACATACCTACAA

further, the circ _0021132 is circ _0021132 in the serum sample.

In a second aspect of the invention, the application of the kit or the gene chip for detecting the circ _0021132 in preparing products for diagnosing deep vein thrombosis is provided.

Further, the kit comprises at least a forward primer 5'-AACTCTGGGCTGTATGCCAA-3' and a reverse primer 5'-TGGGTTGGCAGTGAACATGG-3' for circ _ 0021132.

Further, the gene chip at least comprises a probe which is hybridized with the nucleic acid sequence of the circ _ 0021132.

Further, the product can diagnose whether the patient has deep vein thrombosis by detecting the expression level of circ _0021132 in serum, and the high expression of circ _0021132 is related to the occurrence and development of the deep vein thrombosis.

Further, the product for detecting the expression level of circ _0021132 comprises: products for diagnosing deep vein thrombosis by detecting the expression level of circ _0021132 by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip or gene sequencing.

In a third aspect of the invention, there is provided a product for diagnosing deep vein thrombosis, the product being characterized in that: the product can diagnose deep vein thrombosis by detecting the expression level of circ _0021132 in serum, and high-throughput detection results show that the expression of circ _0021132 in a DVT group is obviously improved compared with that of normal people.

Further, the product is a chip or a detection kit; wherein the chip comprises at least a probe which hybridizes to the nucleic acid sequence of circ _ 0021132.

Further, the detection kit comprises a reagent for preparing a reverse transcription reaction system and a reagent for preparing a qPCR reaction system.

In a fourth aspect of the invention, there is provided the use of circ _0021132 in the manufacture of a medicament for the treatment of deep vein thrombosis.

Further, the drug is an inhibitor of circ _ 0021132.

Compared with the prior art, the technical scheme of the invention has the beneficial effects that:

(1) according to the invention, through high-throughput deep sequencing and expanded clinical sample expression verification, circ _0021132 obtained by screening can be used as a marker for diagnosing deep venous thrombosis, and the diagnosis efficiency is up to 92.4%.

(2) The invention provides a basis for developing a drug for inhibiting the circ _0021132 target in the future.

(3) The invention takes the circ _0021132 as a diagnostic marker for diagnosing the deep venous thrombosis, develops a corresponding detection kit, has high detection sensitivity, high specificity and convenient detection, meets the detection requirement of patients diagnosing the deep venous thrombosis, and has high diagnostic accuracy through clinical verification.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1: differential circRNA screening.

FIG. 2: circ _0021132 expresses verification.

FIG. 3: ROC Curve graph, A is circ _0021132ROC graph, B is D-dimerROC graph.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, and/or combinations thereof, unless the context clearly indicates otherwise.

Interpretation of terms:

circ _ 0021132: the nucleic acid sequence of the circular RNA0021132 is shown as SEQ ID NO. 1.

As described in the background art, the prior art has certain defects in the diagnosis of deep venous thrombosis by adopting D-dimer and the like, and in order to solve the technical problems, the invention obtains circ _0021132 through high-throughput deep sequencing and screening and can be used as a diagnostic marker of deep venous thrombosis.

In another embodiment of the present invention, the circ _0021132 is circ _0021132 in a serum sample.

In a specific embodiment of the present invention, the related specific technical solution includes:

(1) venous blood from DVT patients and healthy humans (6 per group) was collected, mononuclear cells were isolated, and differential circular RNA was screened by high throughput sequencing.

(2) Sample size was expanded (50 each per group) and fluorescent real-time quantitative pcr (qpcr) was validated to screen for differential circular RNA expression.

(3) Analysis of clinical data (age, sex).

(4) Logistic regression model analysis.

(5) ROC curve analysis examines the efficacy and optimal cutoff value.

In an exemplary embodiment of the invention, the application of the kit or the gene chip for detecting the circ _0021132 in preparing products for diagnosing deep vein thrombosis is provided.

In a specific embodiment of the invention, the kit comprises at least forward primer 5'-AACTCTGGGCTGTATGCCAA-3' and reverse primer 5'-TGGGTTGGCAGTGAACATGG-3' for circ _ 0021132.

In one embodiment of the invention, the gene chip comprises at least a probe hybridizing to the nucleic acid sequence of circ _ 0021132.

In one embodiment of the invention, the product can diagnose whether patients have deep vein thrombosis by detecting the expression level of circ _0021132 in serum, and the high expression of circ _0021132 is related to the occurrence and development of deep vein thrombosis.

In another embodiment of the present invention, the product for detecting the expression level of circ _0021132 in serum comprises: products for diagnosing deep vein thrombosis by detecting the expression level of circ _0021132 by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip or gene sequencing.

Wherein the gene sequencing is capable of detecting a relative change in the level of gene expression, such as Illumina sequencing. The Illumina platform is a Sequencing method based on Sequencing-By-Synthesis (SBS) technology. The reversible blocking technology can realize that only one base is synthesized each time, the fluorescent group is marked, the corresponding laser is used for exciting the fluorescent group, and the exciting light is captured, so that the base information is read. The original image Data file obtained by high-throughput sequencing is analyzed and converted into an original sequencing sequence through Base recognition (Base Calling), the sequence is called Raw Data or Raw Reads, and the result is stored in a FASTQ (fq for short) file format. Sequencing the clear Reads with the designated reference genome using hisat2 to obtain the position information on the reference genome or genes and the sequence characteristic information specific to the sequenced sample. The expression level of a gene is directly reflected by the abundance of the transcript, and the higher the abundance degree of the transcript, the higher the expression level of the gene. In transcriptome sequencing analysis, the expression level of a gene can be estimated by counting the number of sequencing sequences (reads) that map to exon regions of the transcript. The transcript expression was calculated using FPKM (Fragments Per kb Per Million Reads) as the number of Fragments Per kilobase Per Million Fragments from a particular transcript. FPKM considers the influence of sequencing depth and transcript length on fragments counting, and is the most common method for estimating the expression level of the transcripts at present. The FPKM calculation formula is as follows:

in an exemplary embodiment of the invention, there is provided a product for diagnosing deep vein thrombosis, the product characterized by: the product can diagnose deep vein thrombosis by detecting the expression level of circ _0021132 in serum, and high-throughput detection results show that the expression of circ _0021132 in a DVT group is obviously improved compared with that of normal people.

In one embodiment of the invention, the product is a chip or a test kit; wherein the chip comprises at least a probe which hybridizes to the nucleic acid sequence of circ _ 0021132.

In one embodiment of the present invention, for the detection kit, the detection system comprises a reverse transcription reaction system and a qPCR reaction system, and the detection kit comprises reagents for preparing the reverse transcription reaction system and reagents for preparing the qPCR reaction system.

In one embodiment of the present invention, the reagents used for preparing the reverse transcription reaction system include at least reverse transcription buffer (MLV-5 XBuffer), dNTP mix, RNAse protein inhibitor (RNAsin), reverse transcriptase mix (M-MLV) and polythymidine (OligodT).

In a specific embodiment of the invention, the reagents for preparing the qPCR reaction system at least comprise a forward primer solution and a reverse primer solution for circ _0021132, and further comprise a SYBR Green mixed solution and nuclease-free pure water.

In an exemplary embodiment of the invention, there is provided the use of circ _0021132 in the manufacture of a medicament for the treatment of deep vein thrombosis.

In one embodiment of the present invention, the drug is an inhibitor of circ _0021132, and the inhibitor of circ _0021132 refers to a product capable of reducing the expression level of circ _0021132, and the product comprises: siRNA expression vector for inhibiting circ _0021132 expression level and Cas9-sgRNA co-expression vector obtained by siRNA and CRISPR mediated gene knock-down strategy, and compound, composition or reagent for reducing circ _0021132 expression level. Wherein, the siRNA expression vector for inhibiting the expression level of the circular RNA by a knocking-down method and the Cas9-sgRNA co-expression vector are commercialized and can be prepared by a conventional technical means.

In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.

In the following examples, the reagents used were all analytical grade and were commercially available unless otherwise indicated. Experimental procedures not specifically identified herein are generally carried out under conventional conditions such as those described in the molecular cloning guidelines published by scientific Press, J. SammBruk et al, or under conditions recommended by the manufacturer. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention.

1. Subject inclusion and exclusion criteria:

(one) source of cases

All cases are from 50 patients in peripheral angiopathy departments of affiliated hospitals of Shandong Chinese medicine university from 2016 to 06 to 2017 in total. The blood samples of the normal control group are all from healthy physical examination persons in subsidiary hospitals of Shandong Chinese medicine university, and are 50 cases of diseases without heart, brain, lung, liver and kidney diseases and thrombotic diseases and known influence on research indexes.

(II) diagnostic criteria

Diagnostic standard for deep venous thrombosis of lower limbs

(1) The pain of the affected limb is distending or severe, and the femoral trigone or the crus have obvious tenderness; the skin of the affected limb appears dark red and the temperature rises.

(2) There are many DVT risk factors such as bed rest, operation, trauma, malignant tumor, travel, thrombophilia, past venous thromboembolism history, pregnancy, etc.

(3) Ultrasound doppler, venous flow maps, venography, and the like can make definitive diagnoses.

(III) criteria for case selection

1) Inclusion case criteria

(1) Patients of 20-80 years old.

(2) The deep vein thrombosis of the lower limb is only formed.

2) Rule of case exclusion

(1) Those under 20 years of age or over 80 years of age.

(2) Complicated with serious complications such as heart, brain, lung diseases, and liver and kidney dysfunction.

(3) Patients with mental disease.

(4) The diseases such as acute arterial embolism, acute lymphangitis, primary pelvic tumor, shank injury hematoma, shank fibrositis and the like are eliminated.

2. High-throughput detection:

collecting DVT and peripheral blood of healthy people, and detecting the expression of the transcriptome by an Illumina Hiseq Xten high-throughput sequencing platform; the Feature Extraction software and the Genespring software carry out standardized analysis on the data and screen different circRNAs and LncRNAs.

qPCR validation of differential circRNA expression:

(1) cell extraction of RNA

Take 5X 10⁶～1×10⁷Adding 1ml of Trizon into each cell, fully and uniformly mixing, and standing at room temperature for 5-10 min; adding 200 μ l/1mlTrizon chloroform, covering the EP tube tightly and shaking vigorously for 15 s; centrifugation at 4 ℃: 12000rpm is multiplied by 10min, and the upper aqueous phase is taken in a new EP tube; adding isopropanol with the same volume, gently inverting and mixing, and standing at room temperature for 10 min; centrifugation at 4 ℃: 12000rpm is multiplied by 10 min; discarding the supernatant, adding 1ml of 75 (v/v)% ethanol (anhydrous ethanol: DNase/RDase-free water: 3:1), and gently mixing; centrifugation at 4 ℃: 12000rpm is multiplied by 5 min; discarding the supernatant, and adding 1ml of absolute ethyl alcohol; centrifuging at 4 ℃ and at 12000rpm for 5 min; discarding the supernatant (removing residual liquid as much as possible), and drying at room temperature or in vacuum for 10-20 min; adding appropriate amount of DNase/RDase-free water (usually 30-50 μ l) according to the amount of RNA precipitation to dissolve RNA; after mixing, the concentration was measured and recorded for reverse transcription.

(2) RT assay

Taking 0.2ml of EP tube to mark the name and date of the sample, and adding RNA, DNase/RDase-free water and OligodT into the marked EP tube according to requirements; running RT-1 program at 70 deg.C for 5min (Table 1); MIX of MLV-5 XBuffer, dNTP, RNAsin and M-MLV prepared according to the system is added into the EP tube, an RT-2 program is operated, the temperature is 42 ℃, 1h is carried out, cDNA is obtained, and a PCR experiment is carried out (table 2).

TABLE 1 RNA and OligodT

TABLE 2 reverse transcription reaction System

Volume of the system	20μl
		MLV-5×buffer	4μl
dNTP	2μl
		RNAsin	1μl
M-MLV	1μl
		RNA+OligodT	11μl

(3) qPCR experiments: dissolving SYBR, the primers and the cDNA, performing instantaneous centrifugation, mixing uniformly, and placing on ice; DNase/RDase-free water.

TABLE 3 PCR reaction system (20. mu.l)

Reaction system	20μl
		Primer F (10 μm)	1.2μl
Primer R (10 μm)	1.2μl
		SYBR	10μl
cDNA	2μl
		DNase/RDase-free water	5.6μl

Instantaneous centrifugation; the 7500 program was run and conditions were set as in the table below.

TABLE 4 PCR procedure

TABLE 5 circ _0021132 primer sequences

circ_0021132	Sequence(5'->3')
		Forward primer	AACTCTGGGCTGTATGCCAA(SEQ ID NO:2)
Reverse primer	TGGGTTGGCAGTGAACATGG(SEQ ID NO:3)
		Product length	142bp

4. Statistical analysis:

SPSS22.0 software (SPSS inc., USA) was used. Continuous variables are expressed by Median (Median) and mean ± standard deviation (x ± SD); the measurement data is tested by t, and the count data is tested by χ²And (6) checking. Diagnostic ability was judged by plotting Receiver Operating Characteristic (ROC) curves and calculating the corresponding area under the curve (AUC). The optimal cutoff value is selected as the value corresponding to the maximum sum of sensitivity and specificity. The area under the curve AUC variability was compared using the medcale10.4.7.0 software. P<0.05 (double-sided) is statistically different. And (4) analyzing the testing efficiency and the sample size by adopting R software, wherein the testing efficiency is that R is more than or equal to 0.8.

Results

1. High throughput assay results

The high throughput results showed that circ _0021132, circ _0005396, LncRNA ENST00000513368, and LncRNA nossat 175366 were significantly different in DVT group expression than the normal control group, wherein circ _0021132 was significantly higher in DVT group expression than the normal control group with P <0.05 as shown in fig. 1. The applicant has already protected as other patent applications with respect to the specific technical solutions of circ _0005396, LncRNA ENST00000513368 and LncRNA non sat 175366.

qPCR validation of circ _0021132 expression

As shown in fig. 2, the DVT group circ _0021132 expression was significantly increased compared to the normal control group (P < 0.05).

3. Analysis of two groups of clinical data

(1) Sex: normal control group 23 men and 27 women; the distribution of the gender among the male 21 cases and the female 29 cases of the DVT patients is shown in the table 6, and the comparison difference of the gender among the groups is not significant (P >0.05) and is comparable (see the table 6).

TABLE 6 comparison of gender between groups

Note: gender distribution channel X between groups²Inspection, P>0.05。

(2) Age: age comparisons between groups were not statistically significant (P >0.05) and comparable (see Table 7).

TABLE 7 age comparison between groups

Note: the age between groups was tested for t, P > 0.05.

Logistic regression analysis: see table 8.

TABLE 8 Logistic regression analysis

Model 1, constructing a single-factor Logistic regression Model by taking circ _0021132 as an independent variable;

model 2, constructing a multi-factor Logistic regression Model by taking age and circ _0021132 as independent variables;

model 3, constructing a multi-factor Logistic regression Model by taking gender and circ _0021132 as independent variables;

model 4A multifactor Logistic regression Model was constructed with gender, age, circ _0021132 as arguments.

The results of the single-factor Logistic regression model constructed by using circ _0021132 as an independent variable and the multi-factor Logistic regression model constructed after respectively correcting age and gender and simultaneously correcting age and gender show that the statistical results obtained by correction and non-correction are consistent, so that the circ _0021132 is determined to have the potential of diagnosing DVT.

ROC curve analysis test efficiency and optimal cutoff value

The results are shown in FIG. 3, where the area under the circ _0021132ROC curve is 0.924, higher than that of D-dimer (0.816), and p is < 0.05. circ _0021132 relative expression above 1.84, diagnosed as DVT; relative expression levels below 1.84, not diagnosed as DVT; the diagnostic efficiency was 92.4%.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Shandong Chinese medicine university subsidiary hospital

<120> application of circ _0021132 in serum as diagnostic marker of deep vein thrombosis

<130> 2018

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 265

<212> RNA

<213> circ _0021132 sequence

<400> 1

ugaucccgua ccacauucug aucguaccaa gcaagaagcu ggggggcucc auguucacug 60

ccaacccaug gaucuguaua ucaggagaau ugggugagac acagaucaug cagauuccca 120

ggaaugugcu agagaugacc uucgagugcc agaacuuggg gaagcuuacu acuguccaga 180

uuggccauga uaacucuggg cuguaugcca aauggcuggu ggaguaugug auggucagga 240

augagaucac aggacauacc uacaa 265

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

aactctgggc tgtatgccaa 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

tgggttggca gtgaacatgg 20

Claims

1. The application of a kit or a gene chip for detecting the expression quantity of circ _0021132 in preparing a product for diagnosing the deep venous thrombosis of the lower limbs;

the nucleic acid sequence of the circ _0021132 is shown as SEQ ID NO. 1.

2. Use according to claim 1, characterized in that: the kit includes a forward primer 5'-AACTCTGGGCTGTATGCCAA-3' and a reverse primer 5'-TGGGTTGGCAGTGAACATGG-3' for circ _ 0021132.

3. Use according to claim 1, characterized in that: the gene chip comprises a probe hybridized with circ _ 0021132.

4. Use according to claim 1, characterized in that: the product can diagnose whether patients suffer from lower limb deep vein thrombosis by detecting the expression level of circ _0021132 in serum.