CN108384781B - Mouse sperm genome DNA extracting method - Google Patents
Mouse sperm genome DNA extracting method Download PDFInfo
- Publication number
- CN108384781B CN108384781B CN201810495023.2A CN201810495023A CN108384781B CN 108384781 B CN108384781 B CN 108384781B CN 201810495023 A CN201810495023 A CN 201810495023A CN 108384781 B CN108384781 B CN 108384781B
- Authority
- CN
- China
- Prior art keywords
- room temperature
- added
- centrifuge tube
- centrifuged
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The method that the present invention relates to a kind of to extract high quality genomic DNA from mouse sperm, the method carry out DNA extraction after specific sample pretreatment, treatments of the sample step is utilized again.Genomic DNA concentration, the purity is high of extraction, integrality is good, sufficiently meets the requirement of PCR amplification.
Description
Technical field
The present invention relates to the extracting method of DNA a kind of, the extraction operation method of DNA in especially a kind of sperm.
Background technique
It is well known that genomic DNA is the carrier of animal inhereditary material, the development of molecular biology be unable to do without genome
The extraction and preservation of DNA.Extracting DNA from the tissue such as the blood of animal, muscle or liver at present has been mature and universal skill
Art, but the sperm of male would generally be saved in mouse model preparation process to ensure project later period demand, inhereditary material
I.e. sperm is present in sperm.And sperm is and organizes extremely different sample, the chromatin shape of sperm different from other cells
At have passed through double strength and assembling.The densification phenomenon of mature sperm core causes sperm relative to other histiocytic dyeing
Body is finer and close, and genomic DNA is not easy to be detached from protamine, so that sperm DNA discharges difficulty, low yield in digestion.Group
Sperm genomic DNA cannot be separated by knitting genome method for extracting.In practical applications, the semen volume frozen is less, common wheat
The sperm of tube method freezen protective only has 10 μ l/ pipe, is difficult to obtain the DNA of enough late detections by traditional extraction mode.
Still lack in the prior art and is directed to mouse sperm, the effective ways that especially frozen semen DNA is extracted, purport of the present invention
Groping to establish a kind of method for reliably extracting high quality DNA from mouse frozen semen, extracting genome DNA can be filled up
Technological gap in technology about extracting genome DNA in mouse sperm, especially frozen semen then promotes and applies and passes through this
Method can will freeze or fresh mouse sperm DNA is extracted and done coherent detection.
Summary of the invention
The present invention provides a kind of methods that high quality DNA is reliably extracted from mouse frozen semen.The method according to
Secondary includes sample pretreatment, treatments of the sample and DNA extraction step, which is characterized in that
Sample pretreatment step are as follows:
(1) it takes 10 μ l sperm in centrifuge tube, 75% ethyl alcohol vortex is added and mixes, centrifugation is carefully toppled over and discarded supernatant；
(2) multiple step (1) is primary；
(3) room temperature is centrifuged, and remaining ethyl alcohol is sucked out with liquid-transfering gun；
(4) room temperature is dried；
Treatments of the sample step are as follows:
(1) 200 μ l-500 μ l Tail-Buffer resuspension is added in Xiang Shangshu centrifuge tube to precipitate, addition Triton-X100,
DTT and Proteinase K is uniformly mixed and is placed on 50 DEG C of metal bath oscillators, water-bath or the interior overnight incubation of 55 DEG C of baking ovens；Institute
State the component of Tail-buffer are as follows: EDTA (PH8.0), the 100mM of the Tris-HCl (PH8.0) of final concentration of 50mM, 100mM
NaCl and 1%SDS solution.
(2) room temperature is centrifuged, careful to draw in supernatant to new centrifuge tube, certain herein it is noted that avoiding drawing flocculent deposit
Object；Then DNA extraction is carried out.
Preferably, the formula of the Tail-buffer is as shown in the table:
Preferably, wherein DNA extraction step is
Ethanol precipitation: being added the dehydrated alcohol of -20 DEG C of pre-coolings of 950 μ l and turns upside down centrifuge tube 8 times with sufficiently mixed
Even, room temperature 14,000g is centrifuged 20min, carefully topples over and discards supernatant；500 μ l, 75% ethyl alcohol is added and the centrifuge tube 8 that turns upside down
Secondary washing one time, room temperature 14,000g is centrifuged 10min, carefully topples over and discards supernatant；14,000g centrifugation 1min, are sucked with liquid-transfering gun
Remaining 75% ethyl alcohol, room temperature dry 20min, visually observe no liquid residual, it is ensured that remain without ethyl alcohol, 30 μ l are added
ddH20 room temperature sufficiently dissolves 20min, and finger flicks 10 times/5min, saves or be used for follow-up test after electrophoresis detection concentration；
Or
Phenol: chloroform extraction method: being added isometric phenol: chloroform, and the concussion that is vortexed is to mix well, the centrifugation of 14,000g room temperatures
20min carefully draws 300 μ l supernatant liquids with the 1ml suction nozzle for cutting off tip and excessive fire, until new 1.5ml centrifuge tube；It is added
The dehydrated alcohol of -20 DEG C of pre-coolings of 600 μ l simultaneously turns upside down centrifuge tube 8 times to mix well, and room temperature 14,000g is centrifuged 10min,
Carefully topple over and discards supernatant；500 μ l, 75% ethanol washing is added one time, room temperature 14,000g is centrifuged 10min, carefully topples over and discards
Supernatant；14,000g centrifugation 1min, suck remaining 75% ethyl alcohol with liquid-transfering gun, room temperature dries 20min；30 μ l ddH are added20
Room temperature sufficiently dissolves 20min, and finger flicks 10 times/5min, saves or be used for after ultraviolet specrophotometer and electrophoresis detection concentration
Follow-up test.
Preferably, the centrifugal condition in sample pretreatment step is room temperature 14, and 000g is centrifuged 5min, and flash-off time is
10min。
Preferably, the dosage of Tail-Buffer is 400 μ l in treatments of the sample step, and the Triton-X100 of addition is 2.5 μ
The Triton-X100 of l 0.5%.
Preferably, the dosage of Tail-Buffer is 400 μ l in treatments of the sample step, and the DTT of addition is 20 μ l 1M's
DTT。
Preferably, the dosage of Tail-Buffer is 400 μ l in treatments of the sample step, and the Proteinase K of addition is 20 μ
The Proteinase K of l 10mg/ml.
Preferably, room temperature 14 in the step of treatments of the sample (2), 000g is centrifuged 10min, careful to draw≤380 μ l supernatants extremely
In new 1.5ml centrifuge tube.
The present invention also provides a kind of mouse sperm genome DNA extracting reagent kits comprising:
Reagent I:75% ethyl alcohol
Reagent II:Tail-Buffer, formula are
The Triton-X100 of reagent III:0.5%: by Triton-X100 doubling dilution to 0.5%；
Formula: reagent IV:1M DTT weighs 1.54g DTT and is dissolved in 10ml ddH2In 0；
Reagent V:10mg/ml Proteinase K.
Further, the kit is also provided and is extracting the application in mouse sperm genomic DNA.
The genome DNA extracting method that the present invention is established for mouse sperm has the positive effect that:
1. can extract the DNA in mouse frozen semen using operating method of the invention, the genomic DNA of extraction is dense
Degree and purity is high, and pcr template can be used for and detected.
2. extraction step of the present invention is simple and easy, by simply pre-process and treatments of the sample step substantially increase it is small
The extraction effect of mouse sperm DNA, genomic DNA concentration, the purity is high of extraction, integrality is good, sufficiently meets wanting for PCR amplification
It asks.
Detailed description of the invention
Fig. 1 is that the extraction reagent of 1 sperm genomic DNA of the embodiment of the present invention and method extract freezing mouse sperm genome
The agarose gel electrophoresis figure of DNA.Wherein, 1-10,2-10,3-10,4-10,5-10,6-10,7-10 are respectively represented with 10 μ l essences
Liquid is the genomic DNA that starting material is extracted by the way of experimental group 1-7 in embodiment 1.T14 is λ-T14digest
Marker, stripe size are respectively as follows: 19329bp/7743bp/6223bp/4254bp/3472bp/2690bp/1882bp/
1489bp/925bp/421bp/74bp.DL 2000marker stripe size is respectively as follows: 2000bp/1000bp/750bp/
500bp/250bp/100bp。
It is solidifying as the amplified production agarose of pcr template using the frozen semen genome extracted that Fig. 2 is the embodiment of the present invention 1
Gel electrophoresis figure.Wherein, 1-10,2-10,3-10,4-10,5-10,6-10,7-10 are respectively represented using 10 μ l sperm as starting material
The genomic DNA for using the mode of experimental group 1-7 in embodiment 1 to extract is template；"+" is provided with B6J rat-tail sample
Genomic DNA is that template is expanded；N is blank control；DL2000marker:2000bp 1000bp 750bp 500bp
250bp\100bp
Specific embodiment
Present invention will be described in further detail below with reference to the accompanying drawings, to enable those skilled in the art referring to specification text
Word can be implemented accordingly.
Embodiment 1: mouse frozen semen DNA and analysis are extracted
One, reagent
1M DTT formula: it weighs 1.54g DTT (dithiothreitol (DTT)) and is dissolved in 10ml ddH2In 0.
0.5% Triton-X100: it regard Triton-X100 doubling dilution to 0.5% as liquid storage.
Tail Buffer is formulated (500ml)
Proteinase K (article No. V900887-100MG, brand Vetec).
Two, experimental group:
Experimental group 1: sample pretreatment+treatments of the sample (Tail-Buffer+Triton-X100+DTT+Proteinase K)
+ DNA is extracted
Experimental group 2: treatments of the sample (Tail-Buffer+Triton-X100+DTT+Proteinase K)+DNA is extracted
Experimental group 3: sample pretreatment+treatments of the sample (Tail-Buffer+Proteinase K)+DNA is extracted
Experimental group 4: sample pretreatment+treatments of the sample (Tail-Buffer+Triton-X100+Proteinase K)+DNA
It extracts
Experimental group 5: sample pretreatment+treatments of the sample (Tail-Buffer+DTT+Proteinase K)+DNA is extracted
Experimental group 6: treatments of the sample (Tail-Buffer+Triton-X100+Proteinase K)+DNA is extracted
Experimental group 7: treatments of the sample (Tail-Buffer+DTT+Proteinase K)+DNA is extracted
Experimental group 1 specific steps are as follows:
1, sample pretreatment
(1) common straw method frozen semen volume is 10 μ l/ pipe, is 10 μ l sperm volumes of test in different disposal method
Under extraction efficiency.It takes the frozen semen of respective volume in 1.5ml centrifuge tube, 500 μ l, 75% ethyl alcohol vortex is added and mixes,
Room temperature 14,000g are centrifuged 5min, carefully topple over and discard supernatant (should can see tube bottom at this time has white precipitate)；
(2) it is primary to repeat step (1)；
(3) 14,000g room temperature are centrifuged 1min, and remaining ethyl alcohol is sucked out with liquid-transfering gun；
(4) room temperature dries 10min；
2, treatments of the sample
(1) 400 μ l Tail-Buffer are added in Xiang Shangshu 1.5ml centrifuge tube, precipitating is resuspended, add 2.5 μ l's 0.5%
The Proteinase K of Triton-X100, the DTT (dithiothreitol (DTT)) of 20 μ l 1M, 20 μ l 10mg/ml are uniformly mixed postposition
It is incubated overnight in 50 DEG C of metal bath oscillators, water-bath or 55 DEG C of baking ovens；
(2) room temperature 14,000g be centrifuged 10min, cut pipette tips excessive fire after carefully draw≤380 μ l supernatants to new 1.5ml from
In heart pipe (certain herein it is noted that avoiding drawing flocky precipitate)；
3.DNA extracts (ethanol precipitation)
The dehydrated alcohol of -20 DEG C of 950 μ l (2.5 times of volumes, v/v) pre-coolings is added and turns upside down centrifuge tube 8 times with abundant
It mixes, room temperature 14,000g is centrifuged 20min, carefully topples over and discards supernatant；500 μ l, 75% ethyl alcohol and the centrifuge tube that turns upside down is added
8 washings one time, room temperature 14,000g is centrifuged 10min, carefully topples over and discards supernatant；14,000g centrifugation 1min, are inhaled with liquid-transfering gun
Remaining 75% ethyl alcohol is removed, room temperature dries 20min (visually observing no liquid residual, it is ensured that remain without ethyl alcohol).
30 μ l ddH are added20 room temperature sufficiently dissolves 20min (finger flicks 10 times/5min).For use.
Sample pretreatment step is omitted compared with experimental group 1 in the operating procedure of experimental group 2, other steps and experimental group 1
It is identical.
The operating procedure of experimental group 3 uses Tail-Buffer+ compared with experimental group 1, in treatments of the sample step
Proteinase K, other steps are identical as experimental group 1.
The operating procedure of experimental group 4 uses Tail-Buffer+Triton- compared with experimental group 1, in treatments of the sample step
X100+Proteinase K, other steps are identical as experimental group 1.
The operating procedure of experimental group 5 uses Tail-Buffer+DTT+ compared with experimental group 1, in treatments of the sample step
Proteinase K, other steps are identical as experimental group 1.
Sample pretreatment step is omitted compared with experimental group 1 in the operating procedure of experimental group 6, and in treatments of the sample step
Using Tail-Buffer+Triton-X100+Proteinase K, other steps are identical as experimental group 1.
Sample pretreatment step is omitted compared with experimental group 1 in the operating procedure of experimental group 7, and in treatments of the sample step
Using Tail-Buffer+DTT+Proteinase K, other steps are identical as experimental group 1.
4, DNA is qualitatively and quantitatively detected:
(1) concentration and purity detecting: the genomic DNA obtained using the above-mentioned each experimental group of nucleic acid quantification apparatus measures it is dense
Degree and purity.Data are as shown in table 1.A260/A280 is used to characterize the purity of DNA, and normal value is lower than this between 1.7-1.9
Range shows to be higher than this range there are protein contamination, shows that the degradation of genomic DNA is polluted or occurred there are RNA.
Table 1
As can be seen from Table 1, sample pretreatment, treatments of the sample step different operation means for the core that finally extracts
Acid concentration, purity significantly affect, when original samples amount is 10 μ l, the genomic DNA concentration highest that experimental group 1 is extracted,
There are significant difference (p < 0.01) for concentration between other each groups, and the purity of DNA is in normal value.The purity of other each groups
Substantially in normal value, but concentration is lower than experimental group 1.Be comprehensively compared each group as a result, showing the processing mode of experimental group 1 small
The synthesis optimal effectiveness of purity and concentration is obtained in terms of the extraction of mouse sperm DNA.
(2) integrity detection:
The Ago-Gel for preparing 0.8%, has carried out electrophoresis for the genomic DNA of resulting each experimental group.It can be with by Fig. 1
Find out, specific sample pretreatment, treatments of the sample and the DNA of experimental group 1 extract the mode combined, genome obtained
DNA band is clear, without miscellaneous band and traction, no disperse (not degrading).
(3) PCR is detected:
PCR amplification is carried out by template of the genomic DNA of extraction, the target gene of amplification is mouse H11 genetic fragment, is expanded
Primer sequence when increasing:
mus H11-inF1:GGGGCCATAAATGCTATTTTAATTCCACT
mus H11-inR1:CCACCTTTCTTCAGTTAGCTTCTGTACAC
Amplified product band size 647bp.
Amplified production is subjected to agarose gel electrophoresis, as shown in Fig. 2, the extracted genomic DNA of the method for the present invention can
Purpose band is obtained with Successful amplification, illustrates that the extracted genomic DNA of the present invention fully meets the requirement of nucleic acid amplification experiment.
Although the embodiments of the present invention have been disclosed as above, but its is not only in the description and the implementation listed
With.It can be applied to various suitable the field of the invention completely.It for those skilled in the art, can be easily
Realize other modification.Therefore without departing from the general concept defined in the claims and the equivalent scope, the present invention is simultaneously unlimited
In specific details and legend shown and described herein.
Claims (2)
1. a kind of extracting method of mouse frozen semen genomic DNA successively includes that sample pretreatment, treatments of the sample and DNA are mentioned
Take step, which is characterized in that
Sample pretreatment step are as follows: (1) it takes 10 μ l sperm in centrifuge tube, 500 μ l, 75% ethyl alcohol vortex is added and mixes, room temperature
14,000g centrifugation 5min, carefully topple over and discard supernatant；
(2) it is primary to repeat step (1)；
(3) room temperature is centrifuged, and remaining ethyl alcohol is sucked out with liquid-transfering gun；
(4) room temperature dries 10min；
Treatments of the sample step are as follows:
(1) 400 μ l Tail-Buffer are added in Xiang Shangshu centrifuge tube, precipitating is resuspended, the Triton- of 2.5 μ l 0.5% is added
The Proteinase K of X100, the DTT of 20 μ l 1M and 20 μ l 10mg/ml, be uniformly mixed be placed on 50 DEG C of metal bath oscillators,
It is incubated overnight in water-bath or 55 DEG C of baking ovens；The component of the Tail-buffer are as follows: the Tris- of the PH8.0 of final concentration of 50mM
NaCl the and 1%SDS solution of EDTA, 100mM of the PH8.0 of HCl, 100mM；
(2) room temperature is centrifuged, careful to draw in supernatant to new centrifuge tube, certain herein it is noted that avoiding drawing flocky precipitate；
Then DNA extraction is carried out, wherein DNA extraction step is ethanol precipitation: the anhydrous second of -20 DEG C of pre-coolings of 950 μ l is added
Alcohol simultaneously turns upside down centrifuge tube 8 times to mix well, and room temperature 14,000g is centrifuged 20min, carefully topples over and discards supernatant；It is added 500
75% ethyl alcohol of μ l and centrifuge tube 8 times washings one time of turning upside down, room temperature 14,000g is centrifuged 10min, carefully topples over and discards supernatant；
14,000g centrifugation 1min, suck remaining 75% ethyl alcohol with liquid-transfering gun, and room temperature dries 20min, visually observe no liquid residual,
Ensure no ethyl alcohol residual, 30 μ l ddH are added20 room temperature sufficiently dissolves 20min, and finger flicks 10 times/5min, and electrophoresis detection is dense
Follow-up test is saved or is used for after degree；
Or
Phenol: chloroform extraction method: being added isometric phenol: chloroform, and to mix well, 14,000g room temperatures are centrifuged 20min for the concussion that is vortexed,
300 μ l supernatant liquids are carefully drawn with the 1ml suction nozzle for cutting off tip and excessive fire, until new 1.5ml centrifuge tube；Be added 600 μ l-
The dehydrated alcohol of 20 DEG C of pre-coolings simultaneously turns upside down centrifuge tube 8 times to mix well, and room temperature 14,000g is centrifuged 10min, carefully topples over
It discards supernatant；500 μ l, 75% ethanol washing is added one time, room temperature 14,000g is centrifuged 10min, carefully topples over and discards supernatant；14,
000g is centrifuged 1min, sucks remaining 75% ethyl alcohol with liquid-transfering gun, room temperature dries 20min；30 μ l ddH are added20 room temperature is abundant
20min is dissolved, finger flicks 10 times/5min, saves or be used for follow-up test after ultraviolet specrophotometer and electrophoresis detection concentration；
The formula of the Tail-buffer is as shown in the table:
2. according to the method described in claim 1, it is characterized in that room temperature 14,000g centrifugation in (2) the step of treatments of the sample
10min, it is careful to draw in≤380 μ l supernatants to new 1.5ml centrifuge tube.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810495023.2A CN108384781B (en) | 2018-05-22 | 2018-05-22 | Mouse sperm genome DNA extracting method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810495023.2A CN108384781B (en) | 2018-05-22 | 2018-05-22 | Mouse sperm genome DNA extracting method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108384781A CN108384781A (en) | 2018-08-10 |
| CN108384781B true CN108384781B (en) | 2019-05-07 |
Family
ID=63071246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810495023.2A Active CN108384781B (en) | 2018-05-22 | 2018-05-22 | Mouse sperm genome DNA extracting method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108384781B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296062A (en) * | 2011-08-29 | 2011-12-28 | 中国农业大学 | Method for extracting genomic DNA of frozen semen of bull |
-
2018
- 2018-05-22 CN CN201810495023.2A patent/CN108384781B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296062A (en) * | 2011-08-29 | 2011-12-28 | 中国农业大学 | Method for extracting genomic DNA of frozen semen of bull |
Non-Patent Citations (1)
| Title |
|---|
| Preparation of Genomic DNA from Mammalian Sperm;Weyrich, A;《Curr.Protoc. Mol. Biol.》;20121231;第98卷(第1期);第2.13.1–2.13.3节，临界参数部分，troubleshooting部分 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108384781A (en) | 2018-08-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3636769B1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN113151397B (en) | Nucleic acid extraction kit for extracting virus sample based on magnetic bead method | |
| WO2012159564A1 (en) | High throughput methylation detection method | |
| CN104024426B (en) | The method for tracing of testing sample and detection kit in the secondary sequencing technologies of DNA | |
| CN104962553A (en) | Using method for extracting virus DNA by using micro-nucleic acid releasing agent | |
| CN102533956B (en) | Method for improving high throughput sequencing efficiency of prokaryote transcriptome | |
| CN108315387A (en) | Few cells ChIP methods | |
| WO2009097511A3 (en) | Two stage enrichment of cell-free fetal dna in maternal plasma | |
| WO2012155577A1 (en) | Method for separating and purifying rna from biomaterial | |
| WO2023116681A1 (en) | Method for preparing random sgrna full-coverage group of target sequence | |
| CN110358816B (en) | Primer set and kit for chicken-derived cell PCR detection and application | |
| CN114410836B (en) | Kit and method for detecting human parvovirus B19 by integrating sample treatment, nucleic acid extraction and multiplex isothermal amplification | |
| CN108384781B (en) | Mouse sperm genome DNA extracting method | |
| EP3587590A1 (en) | Nucleic acid depletion and detection | |
| CN103695419B (en) | A kind of Viral nucleic acid extraction reagent | |
| CN111363793A (en) | PCR amplification reaction system without whole blood taking, amplification kit and amplification method thereof | |
| CN106350510B (en) | Method, kit and its application of rapidly extracting Oviductus Ranae genomic DNA | |
| CN108841819A (en) | For extracting the kit and method of dissociative DNA | |
| CN104498509B (en) | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection | |
| CN113718343A (en) | Rapid RNA library building method and kit | |
| CN112111561A (en) | Library construction kit suitable for FFPE sample, library construction method and application | |
| CN104032015A (en) | Fluorescent quantitative PCR detection kit for lamb liver fasciola gigantica and application of kit | |
| CN107523564A (en) | A kind of extracting method of simple economy oncomelania total tissue RNA | |
| CN107043809A (en) | A kind of Isospora suis qRT PCR quantitatively detect construction method | |
| CN109897890B (en) | Nondestructive babuya penguin sex identification method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: No.12 Xuefu Road, Pukou high tech Industrial Development Zone, Nanjing, Jiangsu 210032 Patentee after: Jiangsu Jicui Yaokang Biotechnology Co., Ltd Address before: No.12 Xuefu Road, Pukou high tech Industrial Development Zone, Nanjing, Jiangsu 210032 Patentee before: GEMPHARMATECH Co.,Ltd. |
|
| CP01 | Change in the name or title of a patent holder |