CN108315463A - Primer sets for detecting 1768 gene of corn and its application - Google Patents

Abstract

The present invention relates to a kind of for detecting the primer sets of 1768 genes and its application in corn.The base sequence for expanding first couple of specific primer Fo1 74 of DNA fragmentation on the left of the gene is：Forward primer is held from 5 ' ends to 3 '：GCTGCCATCCTGAAATCATA；Reverse primer is held from 5 ' ends to 3 '：CCATGCTCTGGTCTCCTCAT；The base sequence for expanding second couple of specific primer Fo1 109 of the gene right DNA fragmentation is：Forward primer is held from 5 ' ends to 3 '：TGCACCATGTCCGTATGTTT；Reverse primer is held from 5 ' ends to 3 '：GACAGCGACTTTTCCTGGAG.The presence or absence of 1768 genes and heterozygosis or homozygotic state in each single plant of corn hybridization breeding filial generation can be detected using these two pair molecular labeling.This detection method accuracy is high, easy to operate.

Description

Primer sets for detecting 1768 gene of corn and its application

Technical field

The present invention relates to one kind for detecting in corn1768The primer sets of gene and its application.

Background technology

Corn (Zea Mays L.) be corn race in grass family, the maize seed of Zea, in Zea only there are one Maize culture kind, not yet finds wild species at present.But in corn race, there are seven categories in addition to Zea.Wherein originate from There are five Asia belongs to, three categories originating from America.Class Zea is a category nearest with maize seed relationship, including two A kind i.e.:Wild Mexican corn and perennial corn.Corn presses its Seed shape, and endosperm property and structure and scale shell have Nothing can be divided into nine types or subspecies.That is Hard grain type, dent type, half dent type, silty type, saccharoid type, sweet tea powder type, glutinous matter Type, bursting type and there is shifting type.Corn origin Latin America Mexico, one band of Peru.The Ming Dynasty (1500-1511) starts to be passed to China.Through more than 400 years acclimatization, planting and selecting formd various ecotypic abundant local varieties.Presently, Feed consumption is still the most important consumer channel of corn, accounts about 70% of aggregate consumption or so, and grain ration consumption is not It is so high in the imagination, only occupy 5% proportion.Remaining major part is all by store as grain reserves.Due to it Available energy it is high, linoleic content is higher, so being most popular one of feed.Although the albumen that it is included contains Measure that relatively low and type is on the low side, but still cannot shake it becomes a kind of status of very important grain.

Corn yield and its seed size and endosperm turgor are closely bound up, and endosperm is the storage of nutriment in seed Place is a kind of reproducible, raw material that can be utilized by biological decomposition.People can be better by improveing endosperm speciality Applied to feed, food processing and deep processed product.Therefore the research of the related gene of control seed size and endosperm development It has great theoretical and practical significance.Abundant something lost of the corn because of the excellent genetic manipulation of its species and long-term accumulation simultaneously It passes and learns resource, become the modular system of science of heredity and genomics research.In addition corn is right as efficient C4 plants Studying biological yield and photosynthesis energy mode also has important research meaning.

1768By genetic analysis, it is found that it is the recessive mutation of a Dominant gene, Opaque is presented in mutant （opaque kernel）Phenotype, this be it is a kind of influence extensive mutant type, wherein most of endosperm development is at silty, This kind of mutation makes it all have seed development mechanism, metabolic pathway and nutrient accumulation by influencing many important biomolecule processes There is important research meaning.Homology analysis and function prediction are carried out according to 1768, thus it is speculated that1768For RRP44 genes, this base It is very thorough because what is studied in yeast and the mankind, its homologous gene is had found in arabidopsis, the major function of RRP44 is that have 3 ' to 5 ' exoribonucleases are active and participate in mature cellRNAProcessing and degradation.The growth and development of plant is risen It has arrived and its important role, we are extracted1768Alcohol soluble protein in wild type and mutant ripe seed endosperm, passes through SDS-PAGE is detected, it has been found that the content of 27KDa alcohol soluble proteins decreases in mutant in mutant, research shows that alcohol As compensation response, non-content of prolamine can increased the decline plant of molten protein content accordingly, and then improve jade The nutritive value of rice.For1768 The exploration of gene function, can be with the regulatory mechanism and corn of research and analysis alcohol soluble protein Equilibrium relation between quality and quality proposes a new approach and possibility, for corn product for the improvement of corn quality Matter improvement has great importance.

The positioning of the gene is by map-based cloning, which is obtained by molecular mark Technology, the technology are mainly the gene to control targe character using the DNA molecular marker with objective trait gene close linkage The GENERALIZATION OF MODERN BREEDING TECHNIQUE of indirect selections is carried out, which can carry out choosing that is accurate and stablizing in early stage to the transfer of target gene It selects, while can also solve the problems, such as to utilize recessive gene to identify hardly possible once again, therefore can achieve the purpose that improve breeding efficiency, with Conventional breeding is compared, which can be improved 2-3 times of breeding efficiency.The basic characteristics of molecular mark technology have：（1） Selected molecular labeling must can distinguish (the homozygosis of hybrid strain in breeding process1768Type and homozygous wildtype class Type) and their hybrid generations (F1 generation) dominant primer sets；（2）The primer sets of acquisition are chain with control targe character gene Situation, the probability of wrong choosing is lower in chain more close generation behind；（3）The primer sets can distinguish mutant and domestic all masters Want breeding parent.There is no be located in previous research1768Primer sets on gene and with its complete linkage, therefore can not The objective trait controlled the gene carries out DNA molecular marker assisted Selection, meanwhile, mutation can be distinguished by also not obtaining in the past The evaluation of markers of body and domestic all main breeding parents.So the acquisition and identification for this kind label are to studying corn The important foundation of the function of internal RRP44 genes.

Invention content

One of the objects of the present invention is to provide one kind for detecting corn1768The primer sets of gene.

The second object of the present invention is to provide the purposes of the primer sets.

In order to achieve the above objectives, the present invention adopts the following technical scheme that：

One kind is for detecting corn1768The primer sets of gene, it is characterised in that：

The base sequence for expanding first couple of specific primer Fo1-74 of DNA fragmentation on the left of the gene is：

Forward primer is held from 5 ' ends to 3 '：GCTGCCATCCTGAAATCATA；

Reverse primer is held from 5 ' ends to 3 '：CCATGCTCTGGTCTCCTCAT；

The base sequence for expanding second couple of specific primer Fo1-109 of the gene right DNA fragmentation is：

Forward primer is held from 5 ' ends to 3 '：TGCACCATGTCCGTATGTTT；

Reverse primer is held from 5 ' ends to 3 '：GACAGCGACTTTTCCTGGAG.

It is a kind of above-mentioned for detecting corn1768The primer sets of gene hybridization parent during detecting and distinguishing corn breeding The application of this and its hybrid generation genotype.

2 are provided in the present invention to be located at1768Gene chromosome physical location both sides, and it is dominant with its close linkage DNA molecular marker.It is had also discovered while the two molecular labelings are provided and utilizes the two dominant DNA molecular markers pair1768Base Method because carrying out molecular marker assisted selection.The maximum features and applications of the two molecular labelings is can be to any life of corn The DNA of long developmental stage and any tissue carries out genotype identification, and at the same time it is detected in each single plant of crossbreeding filial generation1768The presence or absence of gene and be that heterozygosis or homozygotic state accuracy are very high, detection procedure operation is simple, to utilize1768 The DNA molecular marker assistant breeding of gene provides important technological means.

Description of the drawings

Fig. 1 is1768Mutation type surface figure and alcohol soluble protein disparity map；

Fig. 2 is separation situation of the label 1 under W22 backgrounds in F2 groups, and the DNA of 20 seeds, 1-10 are wild type altogether （Including+/+and1768/+）, 11-20 is1768/1768Pure and mild mutant（-/-）；

Fig. 3 is separation situation of the label 2 under W22 backgrounds in F2 groups, and the DNA of 20 seeds, 1-10 are wild type altogether （Including+/+and1768/+）, 11-20 is1768/1768Pure and mild mutant（-/-）；

Fig. 4 is the illustrated position of 2 molecular labelings physical location on No. 1 the short arm of a chromosome of corn in the present invention, wherein CEN1 No. 1 chromosome centromere is represented, TEL represents telomere；

Fig. 5 is polymorphic situation of the label 1 between different self-mating systems；

Fig. 6 is polymorphic situation of the label 2 between different self-mating systems.

Specific implementation method

With reference to specific implementation example, the present invention is further explained.It should be understood that these examples be merely to illustrate the present invention without For limiting the scope of the invention.The experimental method of specific experiment condition is not specified in the following example, usually according to conventional strip Part, such as molecular cloning（Molecular Cloning: A Laboratory Manual,3rd ed.）Or plant molecular biology - laboratory manual（Plant Molecular Bilogy:A Laboratory Manual, Melody S. Clark are compiled, Springer-verlag Berlin Heidelberg, 1997 publish）, described in condition, or according to proposed by manufacturer Condition.

Embodiment one：The acquisition of two dominant molecular labelings

By map based cloning to corn1768Gene carries out the assignment of genes gene mapping, and the gene in positioning section is found on maizeGDB, It is sequenced, it is found that the gene leads to the base of exon front end 13 of back in the 20th introne end AG mutation titles CG Missing.Sequence alignment is carried out with the gene of identity function in arabidopsis, it is found that homology is very high, it is believed that is that there are 3 ' to 5 ' ribose Exonuclease activity and the gene for participating in the processing of mature cell RNA and degrading.

The present invention learns that the gene is located at No. 1 chromosome by classic map position clonal fashion.It is educated by molecular labeling auxiliary Kind technology obtains1768F2 groups, extract the genome of pure and mild mutant, each single plant of wild type and F2 groups.It carries out first Coarse positioning, a screening part has polymorphic SSR marker on the basis of coarse positioning（Fo1-74 and Fo1-109）, by upper group 1768The assignment of genes gene mapping is between Fo1-74 and Fo1-109.This is two pairs of molecular labelings therein, if expect it is more have it is more The molecular labeling of state, can be according to known B73 genome sequences between Fo1-74 and Fo1-109（http:// www.genome.ariZona.edu/fpC/maiZ）Carry out design primer.

The specific primer and base sequence of amplification of DNA fragments Fo1-74 be

Forward primer is held from 5 ' ends to 3 '：GCTGCCATCCTGAAATCATA；

Reverse primer is held from 5 ' ends to 3 '：CCATGCTCTGGTCTCCTCAT；

The specific primer and base sequence of amplification of DNA fragments Fo1-109 be：

Forward primer is held from 5 ' ends to 3 ': TGCACCATGTCCGTATGTTT；

Reverse primer is held from 5 ' ends to 3 '：GACAGCGACTTTTCCTGGAG.

By being sequenced and comparing sequence, the sequence difference of pure and mild mutant and pure and mild wild type is searched out, by being sequenced It is pure and mild can to obtain hybrid strain in differentiation breeding process for row exploitation label1768Type hybridizes with pure and mild wild type and its The dominant molecular labeling Fo1-74 and Fo1-109 of the genotype of filial generation.

Two dominant molecular labeling Fo1-74 and Fo1-109 of embodiment is same1768The confirmation of linkage relationship

Extracting1768/1768With F2 after W22 background hybridizations for group's genome, the DNA of 20 seeds carries out linkage relationship altogether Verification.Wherein 1-10 is the seed of wild type phenotype, and genotype includes（+ /+and1768/+）；11-20 is pure and mild mutation type surface Seed, genotype is（-/-）.By the DNA of this 20 seeds carry out two labels with1768The determination of linkage relationship（Referring to Attached drawing 2 and 3）.Analysis of experimental results surface, Fo1-74 are same with Fo1-1091768It is very chain, it can be increased by the two primers Population, to achieve the purpose that gene location.Molecular labeling Fo1-74 and Fo1-109 on chromosome with1768Physical bit It sets relationship characteristic and participates in attached drawing 4.

Polymorphism verification of three molecular labeling of embodiment between different parents

Choose 12 kinds of widely applied self-mating systems be respectively Huang C, B73, BIM, it is dense 137,9801, it is comprehensive 3,9086, W22, PH4CV, Zheng 58 and yellow early 4, extracts its genomic DNA, polymorphic different cultivars between dominant molecular labeling by pcr response analysis two Property.Analysis result shows that the involved dominant molecular labeling Fo1-74 and Fo1-109 of two couples can be distinguished in the present invention1768With Remaining all self-mating system, detailed results are referring to attached Figures 5 and 6.This result further illustrates, uses two molecule marks in the present invention Note can arrive precise Identification in any breeding background population1768Gene.

Although the present invention describes specific example, there is any to be apparent to practitioners skilled in the art, The present invention can be made various changes and be changed under the premise without departing from the spirit and scope of the present invention.Therefore, appended right It is required that covering all these variations within the scope of the present invention.

<110>Shanghai University

<120>Primer sets for detecting 1768 gene of corn and its application

<160>4

<210>1

<211>20

<212>Single stranded DNA

<213>Artificial sequence

<400>1

GCTGC CATCC TGAAA TCATA 20

<210>2

<211> 20

<212>Single stranded DNA

<213>Artificial sequence

<400>2

CCATG CTCTG GTCTC CTCAT 20

<210>3

<211>20

<212>Single stranded DNA

<213>Artificial sequence

<400>3

TGCAC CATGT CCGTA TGTTT 20

<210>4

<211>20

<212>Single stranded DNA

<213>Artificial sequence

<400> 4

GACAG CGACT TTTCC TGGAG 20

Sequence table

<110>Shanghai University

<120>Primer sets for detecting 1768 gene of corn and its application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 1

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 2

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 3

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 4

Claims (2)

1. one kind is for detecting corn1768The primer sets of gene, it is characterised in that：

The base sequence for expanding first couple of specific primer Fo1-74 of DNA fragmentation on the left of the gene is：

Forward primer is held from 5 ' ends to 3 '：GCTGCCATCCTGAAATCATA；

Reverse primer is held from 5 ' ends to 3 '：CCATGCTCTGGTCTCCTCAT；

The base sequence for expanding second couple of specific primer Fo1-109 of the gene right DNA fragmentation is：

Forward primer is held from 5 ' ends to 3 '：TGCACCATGTCCGTATGTTT；

Reverse primer is held from 5 ' ends to 3 '：GACAGCGACTTTTCCTGGAG.

2. a kind of according to claim 1 for detecting corn1768The molecular labeling of gene is educated in detection and differentiation corn Application during kind in hybrid strain and their hybrid generation types.