CN110041422B - SNP (Single nucleotide polymorphism) locus related to growth of largemouth bass and application thereof - Google Patents
SNP (Single nucleotide polymorphism) locus related to growth of largemouth bass and application thereof Download PDFInfo
- Publication number
- CN110041422B CN110041422B CN201810037972.6A CN201810037972A CN110041422B CN 110041422 B CN110041422 B CN 110041422B CN 201810037972 A CN201810037972 A CN 201810037972A CN 110041422 B CN110041422 B CN 110041422B
- Authority
- CN
- China
- Prior art keywords
- seq
- micropterus salmoides
- hsc70
- growth
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a growth-related SNP locus of micropterus salmoides and application thereof, wherein the growth-related SNP locus is located at the 821 th and 2804 th basic groups of a gene sequence of HSC 70-1. The invention discovers that allele C and allele G exist AT the C +821G position of HSC70-1 to form three genotypes of CC, GC and GG, and allele A and allele T exist AT the A +2804T position to form three genotypes of AA, AT and TT. When the genotypes of the 821 st and 2804 th bases are CC and TT, the growth traits of the individual are obviously better than those of the individuals with other genotypes. By utilizing the phenomenon, the micropterus salmoides parents with CC and TT genotypes reserved in production are removed from individuals with other genotypes, and then a micropterus salmoides variety with high growth speed and stable heredity can be quickly obtained, namely the SNP locus can be applied to screening of the quickly-growing micropterus salmoides parents.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to an SNP (single nucleotide polymorphism) locus associated with growth traits of largemouth bass and application thereof.
Background
Perch in large mouth (Micropterus salmoidesL.), also called as micropterus salmoides, is native to North America, has the advantages of strong adaptability, quick growth, less diseases, low temperature resistance, short growth cycle, delicious taste and the like, and is one of important freshwater aquaculture fishes. In 1983, the method is introduced from Taiwan in China to Guangdong province, and cultivation is carried out in most regions of the country. However, for more than 30 years of introduction, production units do not pay attention to the operation rules to be followed by parent seed reservation, and the parents cannot be supplemented and introduced from the original production place regularly, so that the genetic diversity of the cultured largemouth bass is reduced, the production performance is also reduced, and the main effects are that the growth speed is reduced, the bait conversion efficiency is low, and the disease resistance is also greatly reduced. Wherein the growth rate is related to the yield of micropterus salmoides And the breeding benefit. The growth and degeneration trend of micropterus salmoides directly restricts the development of micropterus salmoides breeding industry. Therefore, the work of improving the growth rate of micropterus salmoides is very important.
The selection of high-quality parent fish is one of the main methods for improving the growth speed of cultured fish, and aims to change the genetic structure of cultured groups and enable offspring to obtain genetic characteristics of higher growth speed and better disease resistance. In production, the traditional method is to select large and strong fish as a seed-reserving parent, namely, whether parent fish is reserved or not is determined according to phenotype. The method is convenient, quick and simple, but is greatly influenced by human factors, and in addition, the largemouth black bass belongs to the fishes with the carnivorous characteristic as the main part, the predatory performance is strong, and the bait is insufficient, so that the black bass can cannibalize with each other, and the growth of the black bass is greatly different. Thus, the quality of the largemouth bass parent cannot be judged to achieve the ideal effect only by the phenotype. With the development of molecular biology and genetics, a plurality of genetic markers, such as AFLP, RAPD, SSR, SNP and other markers, have emerged, wherein the SNP markers are increasingly the first choice genetic markers in genetic breeding research due to wide distribution, suitability for high-throughput automated analysis and stable heredity. If the genetic markers can be associated with production traits, the selective breeding on the DNA level can be realized, the adverse factors greatly influenced by human factors in the traditional method are overcome, the selection accuracy is improved, individuals with excellent traits can be identified in the early stage, and excellent backup parents are screened out, so that the breeding period is shortened, and the breeding process is accelerated. By finding out the molecular marker related to the rapid growth of the largemouth bass, the screening efficiency of the fast-growing parents is improved.
Disclosure of Invention
One of the purposes of the invention is to provide a SNP locus related to the growth traits of micropterus salmoides.
Another object of the present invention is to provide a method for screening a parent of a fast-growing largemouth bass.
The technical scheme adopted by the invention is as follows:
the amino acid sequence of the micropterus salmoides HSC70-1 is shown as SEQ ID NO: 1 is shown.
The gene sequence of the micropterus salmoides HSC70-1 is SEQ ID NO: 2, wherein S at position 821 is a base C or G, and W at position 2804 is a base A or T.
The micropterus salmoides HSC70-1 gene sequence is applied to judging the growth speed of micropterus salmoides.
The SNP locus related to the growth rate of the largemouth bass is positioned in the HSC70-1 gene sequence SEQ ID NO: 2 at position 821 and at position 2804.
The SNP locus is applied to judging the growth speed of micropterus salmoides.
The SNP locus is applied to screening of fast-growing micropterus salmoides.
A method for screening a fast-growing largemouth bass detects whether an SNP locus at the 821 th base of a largemouth bass HSC70-1 gene sequence is a CC homozygote, if so, the fast-growing largemouth bass is detected; or detecting whether the SNP locus at 2804 th base of the HSC70-1 gene sequence is TT homozygote, if so, the fast-growing largemouth bass is obtained.
Further, the method comprises the following steps:
1) extracting DNA of micropterus salmoides;
2) and detecting whether SNP sites at 821 st and 2804 th basic groups of the micropterus salmoides HSC70-1 gene sequence are CC and TT homozygotes respectively by using the extracted DNA as a template through PCR.
Further, the PCR detection is specifically performed by performing primary PCR amplification on the Lateolabrax japonicus DNA by using primers P1F and P1R, and primers P2F and P2R respectively to obtain a primary PCR product,
P1F：5'- TGAAGCCTACCTCGGAAAAGT -3'（SEQ ID NO.3），
P1R：5'- AGCATCCTTAGTGGCCTGGCGC -3'（SEQ ID NO.4），
P2F：5'- TCCACCAGCTTATCAGACTGT -3'（SEQ ID NO.5），
P2R：5'- GGTCAACCCTCCAAGTAACTT -3'（SEQ ID NO.6）；
respectively carrying out extension amplification on the primary PCR product by using primers P1 and P2, and determining whether SNP sites at 821-2804 th bases of a micropterus salmoides HSC70-1 gene sequence are CC and TT homozygotes or not by sequencing analysis on the obtained product;
P1：5'- TTACTTAGCATAGCTCTGGACA -3'（SEQ ID NO.7），
P2：5'- CTGTAGGGGGTAACTGAAGGGT -3'（SEQ ID NO.8）。
further, the reaction system for the primary PCR amplification is:
DNA 1μl
10×buffer 1.5μl
25mmol of MgCl2 1.5μl
dNTP 0.3μl
Upstream primer 0.15. mu.l
0.15. mu.l of downstream primer
Taq enzyme 0.3. mu.l
H2Supplementing O to 15 μ l;
the primary PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 15s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 30s for 24 cycles; extension at 72 ℃ for 3 min.
Further, the reaction system of the extension amplification is as follows:
mu.l of primary PCR product
Snapshot Mix reagent 1. mu.l
P1 primer 2. mu.l
P2 primer 2. mu.l
Supplementing water to 6 μ l;
the extension amplification reaction procedure is as follows: pre-denaturation at 96 ℃ for 1 min; denaturation at 96 ℃ for 10s, annealing at 52 ℃ for 5s, and extension at 60 ℃ for 30s, for 30 cycles.
The invention has the beneficial effects that:
(1) the invention can quickly obtain the variety of the micropterus salmoides with high growth speed and stable heredity by removing individuals with other genotypes from the micropterus salmoides parents which retain CC and TT genotypes in the production. Compared with the traditional method, the method has the advantages of strong purposiveness, direct action effect, simple operation, quick detection, low detection cost and convenience for wide popularization and use.
(2) The invention greatly reduces the blindness of parent screening of micropterus salmoides, and can quickly obtain micropterus salmoides individuals with high growth speed and stable heredity.
Detailed Description
The present invention will be further described with reference to the following examples.
Example 1 acquisition of SNP marker associated with growth trait of Lateolabrax
The application researches show that the amino acid sequence of a heat shock protein HSC70-1 (heat shock protein 70) of the largemouth bass is shown as SEQ ID NO: 1, the whole length of the coding region sequence of the micropterus salmoides HSC70-1 gene is 3382 bp (SEQ ID NO: 2), and the coding region sequence consists of 8 exons and 7 introns. Respectively finding a SNP locus at 821 th and 2804 th sites of a heat shock protein HSC70-1 gene sequence (SEQ ID NO: 2) of largemouth bass, and finding that allele C and allele G exist at 821 th base position through Snapshot method typing to form three genotypes of CC, GC and GG; allele A and allele T are present AT base position 2804, constituting three genotypes AA, AT and TT.
The random population with 430 samples for correlation analysis in the experiment is bred in the same batch and cultured in the same pond, and the sampling time is consistent, so that the difference of time, environment and artificial feeding conditions is not considered when the model is established. The frequency distribution of different genotypes at 821-2804 sites of micropterus salmoides HSC70-1 gene in random population is shown in tables 1 and 2 respectively. Among them, the genotype frequency of the CC homozygote at the SNP site at position 821 was low at 7.21%, and the genotype frequency of the TT homozygote at the SNP site at position 2804 was low at 7.21%.
TABLE 1 Lateolabrax japonicus HSC70-1 Gene 821 site different genotypes frequency distribution in random population
TABLE 2 frequency distribution of different genotypes at 2804 th site of micropterus salmoides HSC70-1 gene in random population
Association analysis of SNP and traits
The multiple comparison results of the growth traits of different genotypes of the micropterus salmoides HSC70-1 gene at 821 th site and 2804 th site are respectively shown in the tables 3 and 4. The average phenotype values of 5 growth traits (body mass, full length, head length, body height and caudal peduncle length) measured by CC genotype individuals at position 821 are all higher than the average value of CG and GG genotype individuals, wherein the CC genotype individuals have significant difference with the CG and GG genotype individuals in body mass and full length (the CC genotype individuals and the GG genotype individuals have significant difference in body mass and full length respectively: ( P< 0.05). The average phenotype values of 5 growth traits (body mass, full length, head length, body height and tail stalk length) measured by TT genotype individuals AT position 2804 are all higher than the average values of AT type and AA type individuals, wherein the TT genotype individuals have significant differences from the AT type and AA genotype individuals in body mass and full length (the TT genotype individuals have significant differences in body mass and full lengthP＜0.05)。
The correlation analysis result shows that the genotype formed by the SNP locus of the micropterus salmoides HSC70-1 gene has obvious influence on the quality and the full-length character (P<0.05), the growth traits of individuals with the genotypes CC and TT are obviously better than those of individuals with other genotypes.
TABLE 3 multiple comparison of growth traits among individuals of different genotypes at site 821 of the HSC70-1 Gene
TABLE 4 multiple comparison of growth traits among individuals of different genotypes at position 2804 in the HSC70-1 Gene
As can be seen from the data in tables 1-4, the SNP sites at positions 821 and 2804 of the HSC70-1 gene sequence (SEQ ID NO: 2) are closely related to the growth trait of Lateolabrax japonicus. The required largemouth black bass parent strain which grows quickly can be screened quickly and accurately by detecting whether the SNP locus at the 821 st position of the largemouth black bass HSC70-1 gene sequence (SEQ ID NO: 2) is a CC homozygote or not, or detecting whether the SNP locus at the 2804 th position is a TT homozygote or not.
Example 2 method for screening fast-growing micropterus salmoides
The SNP locus is utilized to screen the fast-growing largemouth bass parent, and the method comprises the following steps:
the primer sequence:
two pairs of primers are designed according to the heat shock protein HSC70-1 gene sequence of the micropterus salmoides for PCR amplification, and the primers are designed and synthesized as follows:
P1F：5'- TGAAGCCTACCTCGGAAAAGT -3'（SEQ ID NO.3），
P1R：5'- AGCATCCTTAGTGGCCTGGCGC -3'（SEQ ID NO.4），
P2F：5'- TCCACCAGCTTATCAGACTGT -3'（SEQ ID NO.5），
P2R：5'- GGTCAACCCTCCAAGTAACTT -3'（SEQ ID NO.6）；
the primers are expected to amplify 2 DNA bands, i.e. SEQ ID NO: 9 (size 176 bp) and SEQ ID NO: 10 (size 222 bp).
(II) sample DNA submission (alkaline lysis method):
1. cutting 10-20 mg of a largemouth bass fin ray to be detected, and filling into a clean EP tube;
2. adding 180 muL of 50 mmol/L NaOH solution, and carrying out water bath for 20 min (normal temperature), wherein shaking is carried out for a plurality of times;
3. adding 20 mu L of 1mol/L Tris-HCL solution (PH = 8.0), and fully vortexing and shaking;
4. and (3) placing the sample tube into a centrifuge for 10 min at 12000 rpm, and sucking supernatant fluid to obtain the genomic DNA of the largemouth bass for later use.
(III) PCR system for primary amplification of primers:
the reaction system and the amplification conditions of the primary PCR amplification are as follows:
| DNA | 1μl |
| 10×buffer | 1.5μl |
| 25mmol of MgCl2 | 1.5μl |
| dNTP | 0.3μl |
| Upstream primer (P1F or P2F) | 0.15μl |
| Downstream primer (P1R or P2R) | 0.15μl |
| Taq enzyme | 0.3μl |
| H2O | Make up to 15 μ l |
(IV) PCR amplification program of primer primary amplification:
(V) performing single-base extension on the purified PCR product
And (3) using a Snapshot method to obtain a PCR product for the first time as a template, extending a base of the primer to terminate at a polymorphic site, detecting on a sequencer, and knowing whether the base of the polypeptide site is CC or TT according to the color of a peak.
The extension reaction system is as follows:
purification of PCR product 2. mu.l
Snapshot Mix reagent 1. mu.l
Extension primer P12. mu.l
Extension primer P22. mu.l
Make up to 6. mu.l with water.
The sequence of the extension primer is as follows: p1: 5'-TTACTTAGCATAGCTCTGGACA-3' (SEQ ID NO. 7) and P2: 5'-CTGTAGGGGGTAACTGAAGGGT-3' (SEQ ID NO. 8).
The extension reaction conditions are as follows:
sixthly, detecting the size of the extension product and the color of the peak on a sequencer, and determining whether the SNP locus at the 821 st base of the HSC70-1 gene sequence of the parent to be detected is a CC homozygote or not, if so, the rapidly growing largemouth bass is obtained; or detecting whether the SNP locus at 2804 th base of the HSC70-1 gene sequence is TT homozygote, if so, the fast-growing largemouth bass is obtained.
The detection method can be operated within 10 hours, can simultaneously detect a plurality of samples, and can provide a quick and accurate detection result for the subsequent fine variety breeding and identification of the micropterus salmoides. By identifying the dominant allele, the germplasm quality of the micropterus salmoides is evaluated on the DNA level, and the purpose is stronger. The cost required by detecting one sample by using the method is about 3 yuan, and the method is low in cost and suitable for popularization and use.
In conclusion, the applicant researches and discovers that one SNP is respectively found AT the C +821G position and the A +2804T position of a micropterus salmoides heat shock protein HSC70-1 gene sequence, allele C and allele G exist AT the C +821G position through Snapshot method typing, three genotypes CC, GC and GG are formed, allele A and allele T exist AT the A +2804T position, and three genotypes AA, AT and TT are formed. In a random population test, two SNP sites have obvious influence on body mass and full-length traits, and the growth traits of individuals with genotypes of CC and TT at 821 base positions and 2804 base positions are obviously better than those of individuals with other genotypes. Therefore, a primer is designed according to the heat shock protein HSC70-1 gene sequence of the micropterus salmoides, and a parent which has excellent growth traits and is stable in heredity is effectively identified. By using the method, the micropterus salmoides parents with CC and TT genotypes reserved in the production are removed from other genotypes of individuals, and the micropterus salmoides variety with high growth speed and stable heredity can be quickly obtained.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> Zhujiang aquatic research institute of Chinese aquatic science research institute
<120> growth-related SNP (single nucleotide polymorphism) locus of largemouth bass and application thereof
<130>
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 650
<212> PRT
<213> Artificial sequence
<400> 1
Met Ser Lys Gly Pro Ala Val Gly Ile Asp Leu Gly Thr Thr Tyr Ser
1 5 10 15
Cys Val Gly Val Phe Gln His Gly Lys Val Glu Ile Ile Ala Asn Asp
20 25 30
Gln Gly Asn Arg Thr Thr Pro Ser Tyr Val Ala Phe Thr Asp Ser Glu
35 40 45
Arg Leu Ile Gly Asp Ala Ala Lys Asn Gln Val Ala Met Asn Pro Thr
50 55 60
Asn Thr Val Phe Asp Ala Lys Arg Leu Ile Gly Arg Arg Phe Asp Asp
65 70 75 80
Thr Val Val Gln Ser Asp Met Lys His Trp Pro Phe Asn Val Ile Asn
85 90 95
Asp Asn Thr Arg Pro Lys Val Gln Val Glu Tyr Lys Gly Glu Thr Lys
100 105 110
Ser Phe Tyr Pro Glu Glu Val Ser Ser Met Val Leu Thr Lys Met Lys
115 120 125
Glu Ile Ala Glu Ala Tyr Leu Gly Lys Thr Val Asn Asn Ala Val Ile
130 135 140
Thr Val Pro Ala Tyr Phe Asn Asp Ser Gln Arg Gln Ala Thr Lys Asp
145 150 155 160
Ala Gly Thr Ile Ser Gly Leu Asn Val Leu Arg Ile Ile Asn Glu Pro
165 170 175
Thr Ala Ala Ala Ile Ala Tyr Gly Leu Asp Lys Lys Val Gly Ser Glu
180 185 190
Arg Asn Val Leu Ile Phe Asp Leu Gly Gly Gly Thr Phe Asp Val Ser
195 200 205
Ile Leu Thr Ile Glu Asp Gly Ile Phe Glu Val Lys Ser Thr Ala Gly
210 215 220
Asp Thr His Leu Gly Gly Glu Asp Phe Asp Asn Arg Met Val Asn His
225 230 235 240
Phe Ile Ala Glu Phe Lys Arg Lys Tyr Lys Lys Asp Ile Ser Asp Asn
245 250 255
Lys Arg Ala Val Arg Arg Leu Arg Thr Ala Cys Glu Arg Ala Lys Arg
260 265 270
Thr Leu Ser Ser Ser Thr Gln Ala Ser Ile Glu Ile Asp Ser Leu Tyr
275 280 285
Glu Gly Val Asp Phe Tyr Thr Ser Ile Thr Arg Ala Arg Phe Glu Glu
290 295 300
Leu Asn Ala Asp Leu Phe Arg Gly Thr Leu Asp Pro Val Glu Lys Ser
305 310 315 320
Leu Arg Asp Ala Lys Met Asp Lys Gly Gln Ile His Asp Ile Val Leu
325 330 335
Val Gly Gly Ser Thr Arg Ile Pro Lys Ile Gln Lys Leu Leu Gln Asp
340 345 350
Phe Phe Asn Gly Lys Glu Leu Asn Lys Ser Ile Asn Pro Asp Glu Ala
355 360 365
Val Ala Tyr Gly Ala Ala Val Gln Ala Ala Ile Leu Ser Gly Asp Lys
370 375 380
Ser Glu Asn Val Gln Asp Leu Leu Leu Leu Asp Val Thr Pro Leu Ser
385 390 395 400
Leu Gly Ile Glu Thr Ala Gly Gly Val Met Thr Val Leu Ile Lys Arg
405 410 415
Asn Thr Thr Ile Pro Thr Lys Gln Thr Gln Thr Phe Thr Thr Tyr Ser
420 425 430
Asp Asn Gln Pro Gly Val Leu Ile Gln Val Tyr Glu Gly Glu Arg Ala
435 440 445
Met Thr Arg Asp Asn Asn Leu Leu Gly Lys Phe Glu Leu Thr Gly Ile
450 455 460
Pro Pro Ala Pro Arg Gly Val Pro Gln Ile Glu Val Thr Phe Asp Ile
465 470 475 480
Asp Ala Asn Gly Ile Met Asn Val Ser Ala Val Asp Lys Ser Thr Gly
485 490 495
Lys Glu Asn Lys Ile Thr Ile Thr Asn Asp Lys Gly Arg Leu Ser Lys
500 505 510
Glu Asp Ile Glu Arg Met Val Gln Glu Ala Glu Lys Tyr Lys Ala Glu
515 520 525
Asp Asp Val Gln Arg Asp Lys Val Ser Ala Lys Asn Gly Leu Glu Ser
530 535 540
Tyr Ala Phe Asn Met Lys Ser Thr Val Glu Asp Glu Lys Leu Ala Gly
545 550 555 560
Lys Ile Ser Asp Glu Asp Lys Gln Lys Ile Leu Asp Lys Cys Asn Glu
565 570 575
Val Ile Gly Trp Leu Asp Lys Asn Gln Thr Ala Glu Arg Asp Glu Tyr
580 585 590
Glu His Gln Gln Lys Glu Leu Glu Lys Val Cys Asn Pro Ile Ile Thr
595 600 605
Lys Leu Tyr Gln Ser Ala Gly Gly Met Pro Gly Gly Met Pro Glu Gly
610 615 620
Met Pro Gly Gly Phe Pro Gly Ala Gly Gly Ala Ala Pro Gly Gly Gly
625 630 635 640
Ser Ser Gly Pro Thr Ile Glu Glu Val Asp
645 650
<210> 2
<211> 3382
<212> DNA
<213> Artificial sequence
<400> 2
atgtctaagg gaccagcagt tggtatcgat cttgggacca cctactcctg tgttggtgtg 60
ttccagcatg gcaaagttga aatcatcgcc aatgaccaag gcaacaggac cacacccagc 120
tacgtggcct tcacagacag tgagaggctg atcggagatg cagccaagaa tcaggttgcc 180
atgaacccca ccaacacagt ctttggtaag tattaaacgg ggaaattgtg gtcttgtgtc 240
actcttgcct gcgtaaaatc aaacatttta tatatagtaa atagtaaaac gccttaaagt 300
ccaatactaa ctgcttataa agagactggc acctctgtcg gtggtaaaac agtaaagtct 360
tatctatgaa ctcgaggcaa gaatggaaca agactgaaat cttaagtggc cgtattaaac 420
aacttcctca ctgtgatgac gattttcctg ccattcgtag tttccaccag aggttgaaag 480
accaaagatg gcccaaatcc ttccttggat gtctgagtga tattcttaaa ggaagcccag 540
agcatattat attttttttc cattaaaccc taaactgtct tttgcagatg ccaaacgact 600
gattggccgc aggtttgacg acacagttgt gcagtcagat atgaagcact ggccatttaa 660
tgtcatcaat gataacaccc gccccaaggt tcaagttgaa tacaaaggcg agacaaagtc 720
cttctaccca gaggaggtct catctatggt gctgacaaag atgaaggaga ttgctgaagc 780
ctacctcgga aaagtatgtt acttagcata gctctggaca saactccaaa tataaaatta 840
tatgaagtga tgctaatttt tttcttattc ccttcaagac tgtcaacaat gctgtaatta 900
cggtacccgc ctacttcaac gactcccagc gccaggccac taaggatgct ggcacaatct 960
ctggcctcaa tgtcctgcgt atcatcaatg aaccaaccgc tgctgccatt gcctatgggt 1020
tggacaagaa ggtaaataaa actagaaaac ttccaattac acttgcatga tggccaatgt 1080
accatcttga attgaggtaa taaaacataa ctgagtagat tttaaatgtt actaacttaa 1140
tttcaggttg ggtctgaaag gaacgttctc atctttgatc ttggtggtgg caccttcgat 1200
gtttccatct tgaccatcga ggatggcatc tttgaggtca agtccactgc tggagatact 1260
catcttggcg gtgaggattt cgacaaccgc atggtcaacc acttcattgc agagttcaag 1320
cgcaagtaca agaaagacat cagtgacaac aagagagctg tccgtcgcct gcgcaccgct 1380
tgcgagaggg caaagcgcac cctgtcttcc agcacccagg ccagcattga aatcgactct 1440
ctgtacgagg gagtcgactt ctatacctca atcaccaggg ctcgctttga ggagctcaac 1500
gctgacctct tccgtggcac cctggaccct gtggagaagt cgctccgtga tgccaagatg 1560
gataaagggc agattcacga catagtgttg gtcggtggct ccactcgtat ccccaagatc 1620
cagaagctgc tccaggattt cttcaatgga aaggagctca acaagagcat caatccagat 1680
gaagccgtgg cctatggagc tggtaagtaa accaaacatt tccatccaat tagagctcta 1740
gatataaatt tctactgaga agtatttttg ttgaattgtt aagagattaa catgaaaaat 1800
atccaccttc agtccctttc aaaatctaac cagccgccct tatttacagc tgtccaggct 1860
gccatcctgt ctggtgacaa gtctgagaat gtccaggact tgctgctttt ggacgtcacc 1920
cctctctccc tgggaattga gaccgctgga ggtgtcatga ctgtcctgat caaacgtaac 1980
accactattc ctaccaagca gacgcagacc ttcaccacct actctgacaa ccagcctggt 2040
gtgctcatcc aggtgaggac gctggttgat ggggttcagt tgtttgtgca attcataatt 2100
ctaacagaat taacataatt ataaattcat ttcggggatg ttggagagac tgaagtgaca 2160
ttgcatacgt ccaacaggtt tatgagggcg agcgtgccat gacaaaggac aacaacctgc 2220
tgggcaagtt tgagctgacg ggcatccccc ctgctcctcg tggtgttccc cagatagagg 2280
tgacgtttga tattgatgcc aatggaatcc ttaatgtctc tgctgtagac aagagcactg 2340
gcaaggagaa caagatcacc atcaccaatg acaagggtac aaaaaagtct gcttaaccca 2400
aataccgctg cagtgtccca acaacggatg attaaatggt aatcttgcct gttttatgcc 2460
aggtcgtctc agcaaggagg acattgaacg catggtccaa gaagctgaga agtacagggc 2520
tgaagacgac gtccagcgtg acaaggtgtc agccaaaaat ggcctggagt cgtatgcttt 2580
caacatgaag tcgaccatgg aagatgaaaa gcttgctggc aagatcagtg atgaagacaa 2640
gcagaagatc ttggacaagt gcaacgagat tattggctgg ctggacaaga accaggtggg 2700
aattgttggt tttggaacct gtgatccacc agcttatcag actgtctatt cctgtctgct 2760
aagcgaattt agagatatat actgtagggg gtaactgaag ggtwggggtc tatatataca 2820
aacaaatatg tttctgagaa ggagaaaatg aacgataact gaaaatacgg taataaacta 2880
atttaacaaa catagccttc tgatctcagt ataggaaaaa tgcttaagtt acttggaggg 2940
ttgaccccag agttttgatt tttttcaaca tgcaaatgta taatttacta ggaagtaagc 3000
aatgggtcta ggattttgca ggtctgctaa acgtcatcag agaatggtga ttttatgtgt 3060
agacactatc gttttgtcag gctaaattat cctcatctgt gtttcaacaa tagcagagtt 3120
taaactgaac tgagtattaa ctgtcaatta attccaattg agaatatatg atttgatttg 3180
tttgtactag actgcagaaa aagatgaata tgaacaccag caacaagaac tggagagggt 3240
gtgtaacccc atcatcacca agctgtacca gagtggtggt gatgtgacag gtgggatgtc 3300
cagtggaatg ccaggcggat tccctggggc tggtggtgct ccagccgctg gaggatcctc 3360
tggaccaact tgtggagggg ga 3382
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
tgaagcctac ctcggaaaag t 21
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence
<400> 4
agcatcctta gtggcctggc gc 22
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<400> 5
tccaccagct tatcagactg t 21
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<400> 6
ggtcaaccct ccaagtaact t 21
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence
<400> 7
ttacttagca tagctctgga ca 22
<210> 8
<211> 22
<212> DNA
<213> Artificial sequence
<400> 8
ctgtaggggg taactgaagg gt 22
<210> 9
<211> 176
<212> DNA
<213> Artificial sequence
<400> 9
tgaagcctac ctcggaaaag tatgttactt agcatagctc tggacacaac tccaaatata 60
aaattatatg aagtgatgct aatttttttc ttattccctt caagactgtc aacaatgctg 120
taattacggt acccgcctac ttcaacgact cccagcgcca ggccactaag gatgct 176
<210> 10
<211> 222
<212> DNA
<213> Artificial sequence
<400> 10
tccaccagct tatcagactg tctattcctg tctgctaagc gaatttagag atatatactg 60
tagggggtaa ctgaagggtt ggggtctata tatacaaaca aatatgtttc tgagaaggag 120
aaaatgaacg ataactgaaa atacggtaat aaactaattt aacaaacata gccttctgat 180
ctcagtatag gaaaaatgct taagttactt ggagggttga cc 222
Claims (7)
1. A SNP molecular marker related to the growth rate of largemouth bass, which is positioned in the HSC70-1 gene sequence SEQ ID NO: 2, wherein the base at position 821 is C or G, and the base at position 2804 is A or T.
2. The application of the reagent for detecting the SNP molecular marker according to claim 1 in judging the growth speed of micropterus salmoides.
3. The application of the reagent for detecting the SNP molecular marker in claim 1 in screening of fast-growing largemouth bass.
4. A method for screening fast-growing micropterus salmoides is characterized in that HSC70-1 gene sequences of micropterus salmoides are detected to be SEQ ID NO: 2, if the SNP molecular marker at the 821 st basic group is CC homozygote, the largemouth bass rapidly grows; or/and detecting the HSC70-1 gene sequence SEQ ID NO: 2, if the SNP molecular marker at the 2804 th base is TT homozygote, the large-mouth black bass can grow rapidly.
5. The method of claim 4, comprising the steps of:
1) extracting DNA of micropterus salmoides;
2) and (3) detecting whether SNP molecular markers at 821-st and 2804-th bases of a micropterus salmoides HSC70-1 gene sequence are CC and TT homozygotes respectively by using the extracted DNA as a template through PCR.
6. The method of claim 5, wherein the PCR detection is performed by performing a primary PCR amplification on Lateolabrax japonicus DNA using primers P1F and P1R, and P2F and P2R to obtain a primary PCR product,
P1F：5'- TGAAGCCTACCTCGGAAAAGT -3'（SEQ ID NO.3），
P1R：5'- AGCATCCTTAGTGGCCTGGCGC -3'（SEQ ID NO.4），
P2F：5'- TCCACCAGCTTATCAGACTGT -3'（SEQ ID NO.5），
P2R：5'- GGTCAACCCTCCAAGTAACTT -3'（SEQ ID NO.6）；
respectively carrying out extension amplification on the primary PCR product by using primers P1 and P2, and determining whether SNP molecular markers at 821-2804 th bases of a micropterus salmoides HSC70-1 gene sequence are CC and TT homozygotes or not by sequencing analysis on the obtained product;
P1：5'- TTACTTAGCATAGCTCTGGACA -3'（SEQ ID NO.7），
P2：5'- CTGTAGGGGGTAACTGAAGGGT -3'（SEQ ID NO.8）。
7. the method of claim 6, wherein the reaction system of the primary PCR amplification is:
DNA 1μl
10×buffer 1.5μl
25mmol of MgCl2 1.5μl
dNTP 0.3μl
0.15. mu.l of upstream primer
0.15. mu.l of downstream primer
Taq enzyme 0.3. mu.l
H2Supplementing O to 15 μ l;
the primary PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 15s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 30s for 24 cycles; extension at 72 ℃ for 3 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810037972.6A CN110041422B (en) | 2018-01-16 | 2018-01-16 | SNP (Single nucleotide polymorphism) locus related to growth of largemouth bass and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810037972.6A CN110041422B (en) | 2018-01-16 | 2018-01-16 | SNP (Single nucleotide polymorphism) locus related to growth of largemouth bass and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110041422A CN110041422A (en) | 2019-07-23 |
| CN110041422B true CN110041422B (en) | 2022-07-19 |
Family
ID=67272867
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810037972.6A Active CN110041422B (en) | 2018-01-16 | 2018-01-16 | SNP (Single nucleotide polymorphism) locus related to growth of largemouth bass and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110041422B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111073983B (en) * | 2020-01-20 | 2020-11-24 | 中国水产科学研究院珠江水产研究所 | SNP marker related to identification of northern subspecies and Florida subspecies of largemouth bass and application thereof |
| CN113637766A (en) * | 2021-07-30 | 2021-11-12 | 中国水产科学研究院珠江水产研究所 | InDel molecular marker related to genetic sex identification of micropterus salmoides and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009009439A2 (en) * | 2007-07-06 | 2009-01-15 | The Regents Of The University Of California | Snps associated with fatty acid composition of bovine meat and milk |
| CN104073486A (en) * | 2014-06-23 | 2014-10-01 | 中国水产科学研究院珠江水产研究所 | SNP site related to rapid growth of largemouth black bass as well as identification method and application thereof |
| WO2016061711A1 (en) * | 2014-10-21 | 2016-04-28 | 北京盖兰德生物科技有限公司 | Method for identifying wuzhishan miniature pig inbred line by using 145 snp |
| CN106701931A (en) * | 2016-12-14 | 2017-05-24 | 中国水产科学研究院珠江水产研究所 | SNP (single nucleotide polymorphism) marker related to rapid growth of micropterus salmoide L. 'excellent bass No. 1' and application of SNP marker |
-
2018
- 2018-01-16 CN CN201810037972.6A patent/CN110041422B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009009439A2 (en) * | 2007-07-06 | 2009-01-15 | The Regents Of The University Of California | Snps associated with fatty acid composition of bovine meat and milk |
| CN104073486A (en) * | 2014-06-23 | 2014-10-01 | 中国水产科学研究院珠江水产研究所 | SNP site related to rapid growth of largemouth black bass as well as identification method and application thereof |
| WO2016061711A1 (en) * | 2014-10-21 | 2016-04-28 | 北京盖兰德生物科技有限公司 | Method for identifying wuzhishan miniature pig inbred line by using 145 snp |
| CN106701931A (en) * | 2016-12-14 | 2017-05-24 | 中国水产科学研究院珠江水产研究所 | SNP (single nucleotide polymorphism) marker related to rapid growth of micropterus salmoide L. 'excellent bass No. 1' and application of SNP marker |
Non-Patent Citations (1)
| Title |
|---|
| Tissue- and stressor-specific differential expression of two hsc70 genes in carp;Khaled Said Ali;《full text links》;20030801;第307卷(第3期);第503-509页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110041422A (en) | 2019-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106701931B (en) | SNP marker related to rapid growth of Micropterus salmoides 'Youbei No. 1' and application thereof | |
| CN108315439B (en) | SNP molecular marker related to growth of pelteobagrus vachelli and application thereof | |
| CN109182556B (en) | SNP molecular marker related to growth traits of pelteobagrus vachelli and application | |
| CN113913533B (en) | SNP molecular marker related to grass carp characters and application thereof | |
| CN104073486B (en) | A kind of SNP site relevant to Micropterus salmoides fast-growth and authentication method thereof and application | |
| CN107164463B (en) | SNP marker for determining and/or genetically improving growth traits of pigs | |
| CN107580631B (en) | Method for predicting palm oil yield of test oil palm plant and SNP detection kit | |
| CN110041422B (en) | SNP (Single nucleotide polymorphism) locus related to growth of largemouth bass and application thereof | |
| CN111719012A (en) | dCAPS molecular marker primer pair for identifying dehydration rate genotype of corn kernel and application | |
| CN108250285B (en) | Haplotype marker related to rapid growth of largemouth bass and application thereof | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN113862375A (en) | SNP (Single nucleotide polymorphism) marker of AANAT (ananas site-directed translation) and ASMT (antisense-fluorescent marker) genes of cattle and application thereof | |
| CN111057772B (en) | SNP (Single nucleotide polymorphism) marker related to growth traits of grass carps and application thereof | |
| CN110938635B (en) | Japonica rice grain length gene, molecular marker closely linked with same and application | |
| CN108004236B (en) | Corn stalk rot disease-resistant molecular breeding method and application thereof | |
| CN109504792B (en) | Molecular marker related to rice stigma exsertion as well as screening method and application thereof | |
| KR101946162B1 (en) | Snp markers for discriminating raphanus sativus cultivar and uses thereof | |
| CN111378765B (en) | SNP (Single nucleotide polymorphism) marker of fast-growing grass carp individual and application of SNP marker | |
| CN110564867A (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN106554996B (en) | Megalobrama amblycephala transferrin receptor gene SNP molecular marker and application thereof | |
| CN109811085B (en) | Primer for identifying purity of autumn-sown Chinese cabbage Zhenlun No. 6 seeds and application of primer | |
| CN114657263A (en) | Molecular marker for Cyprinus carpiod No. 2 identification, identification method and application | |
| CN114438221A (en) | SNP molecular marker related to black porgy growth traits and application thereof | |
| CN111705146A (en) | Molecular marker for identifying duck jute feather character and application thereof | |
| CN107142321B (en) | A kind of mongolian amygdalus seed specificity microsatellite locus and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |